FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2013826368> ?p ?o ?g. }

• W2013826368 endingPage "26691" @default.
• W2013826368 startingPage "26683" @default.
• W2013826368 abstract "Polymerase chain reaction-based screening of an arrayed human P1 artificial chromosome (PAC) library using primer pairs specific for the human type I hair keratins hHa3-II or hHa6, led to the isolation of two PAC clones, which covered 190 kilobase pairs (kbp) of genomic DNA and contained nine human type I hair keratin genes, one transcribed hair keratin pseudogene, as well as one orphan exon. The hair keratin genes are 4–7 kbp in size, exhibit intergenic distances of 5–8 kbp, and display the same direction of transcription. With one exception, all hair keratin genes are organized into 7 exons and 6 positionally conserved introns. On the basis of sequence homologies, the genes can be grouped into three subclusters of tandemly arranged genes. One subcluster harbors the highly related genes hHa1, hHa3-I, hHa3-II, and hHa4. A second subcluster of highly related genes comprises the novel genes hHa7 and hHa8, as well as pseudogene ΨhHaA, while the structurally less related genes hHa6, hHa5, and hHa2 are constituents of the third subcluster. As shown by reverse transcription-polymerase chain reaction, all hair keratin genes, including the pseudogene, are expressed in the human hair follicle. The transcribed pseudogene ΨhHaA contains a premature stop codon in exon 4 and exhibits aberrant pre-mRNA splicing. Evolutionary tree construction reveals an early divergence of hair keratin genes from cytokeratin genes, followed by the segregation of the genes into the three subclusters. We suspect that the 190-kbp domain contains the entire complement of human type I hair keratin genes. Polymerase chain reaction-based screening of an arrayed human P1 artificial chromosome (PAC) library using primer pairs specific for the human type I hair keratins hHa3-II or hHa6, led to the isolation of two PAC clones, which covered 190 kilobase pairs (kbp) of genomic DNA and contained nine human type I hair keratin genes, one transcribed hair keratin pseudogene, as well as one orphan exon. The hair keratin genes are 4–7 kbp in size, exhibit intergenic distances of 5–8 kbp, and display the same direction of transcription. With one exception, all hair keratin genes are organized into 7 exons and 6 positionally conserved introns. On the basis of sequence homologies, the genes can be grouped into three subclusters of tandemly arranged genes. One subcluster harbors the highly related genes hHa1, hHa3-I, hHa3-II, and hHa4. A second subcluster of highly related genes comprises the novel genes hHa7 and hHa8, as well as pseudogene ΨhHaA, while the structurally less related genes hHa6, hHa5, and hHa2 are constituents of the third subcluster. As shown by reverse transcription-polymerase chain reaction, all hair keratin genes, including the pseudogene, are expressed in the human hair follicle. The transcribed pseudogene ΨhHaA contains a premature stop codon in exon 4 and exhibits aberrant pre-mRNA splicing. Evolutionary tree construction reveals an early divergence of hair keratin genes from cytokeratin genes, followed by the segregation of the genes into the three subclusters. We suspect that the 190-kbp domain contains the entire complement of human type I hair keratin genes. group of overlapping clones P1 artificial chromosome polymerase chain reaction restriction enzyme kilobase pair(s) base pair(s). The keratin multigene family comprises the cytokeratins or soft α-keratins, which are expressed in the various types of epithelia, and the hair keratins or hard α-keratins, involved in the formation of hard keratinized structures. Both can be divided into type I (acidic) and type II (basic-neutral) proteins that form the 10-nm intermediate filament network of epithelial cells by obligatory association of equimolar amounts of type I and type II keratins (1Fuchs E. Weber K. Annu. Rev. Biochem. 1994; 63: 345-382Crossref PubMed Scopus (1282) Google Scholar, 2Steinert P.M. Steven A.C. Roop D.R. Cell. 1985; 42: 411-419Abstract Full Text PDF PubMed Scopus (288) Google Scholar). Disturbances of intermediate filament formation through deleterious mutations in keratins can lead to a weakening of the structural integrity of the respective epithelial cells, resulting in hereditary disorders of skin, mucosa, nail, or hair (3Corden L.D. McLean W.H.I. Exp. Dermatol. 1996; 5: 297-307Crossref PubMed Scopus (195) Google Scholar, 4Lane E.B. Curr. Opin. Genet. Dev. 1994; 4: 412-418Crossref PubMed Scopus (43) Google Scholar, 5Winter H. Rogers M.A. Gebhardt M. Wollina U. Boxall L. Chitayat D. Babul-Hirji R. Stevens H.P. Zlotogorski A. Schweizer J. Hum. Genet. 1997; 101: 165-169Crossref PubMed Scopus (92) Google Scholar, 6Winter H. Rogers M.A. Langbein L. Stevens H.P. Leigh I.M. Labreze C. Roul S. Taieb A. Krieg T. Schweizer J. Nat. Genet. 1997; 16: 372-374Crossref PubMed Scopus (159) Google Scholar, 7Winter H. Labreze C. Chapalain V. Surleve-Bazeille J. Mercier M. Rogers M.A. Taieb A. Schweizer J. J. Invest. Dermatol. 1998; 111: 169-172Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Although initial studies of hair keratin proteins of several species indicated the existence of eight major type hair keratins, four type I members, termed Ha1–Ha4, and four type II members, termed Hb1–Hb4, as well as of one minor hair keratin pair, Hax/Hbx (8Heid H.W. Werner E. Franke W.W. Differentiation. 1986; 32: 101-119Crossref PubMed Scopus (152) Google Scholar, 9Lynch M.H. O'Guin W.M. Hardy C. Mak L. Sun T.T. J. Cell Biol. 1986; 103: 2593-2606Crossref PubMed Scopus (304) Google Scholar, 10Heid H.W. Moll I. Franke W.W. Differentiation. 1988; 37: 215-230Crossref PubMed Scopus (164) Google Scholar, 11Heid H.W. Moll I. Franke W.W. Differentiation. 1988; 37: 137-157Crossref PubMed Scopus (223) Google Scholar), it has recently been shown that the hair keratin family is distinctly more complex. In man, sequences of seven type I hair keratins, hHa1, hHa2, hHa3-I, hHa3-II, hHa4, 1L. Langbein, M. A. Rogers, H. Winter, and J. Schweizer, manuscript in preparation. hHa5, hHa6 (previously designated hHRa1)1 and four type II hair keratins, hHb1, hHb3, hHb5, and hHb6, have been elucidated by molecular cloning, and their differential expression in the hair matrix, cortex, and cuticle of the hair follicle has been shown (12Fink P. Rogers M.A. Korge B. Winter H. Schweizer J. Biochim. Biophys. Acta. 1995; 1264: 12-14Crossref PubMed Scopus (18) Google Scholar, 13Rogers M.A. Nischt R. Korge B. Krieg T. Fink T.M. Lichter P. Winter H. Schweizer J. Exp. Cell Res. 1995; 220: 357-362Crossref PubMed Scopus (53) Google Scholar, 14Yu J., Yu, D.-W. Checkla D.M. Freedberg I.M. Bertolino A.P. J. Invest. Dermatol. 1993; 101: 56s-59sAbstract Full Text PDF PubMed Scopus (75) Google Scholar, 15Rogers M.A. Schweizer J. Krieg T. Winter H. Mol. Biol. Rep. 1995; 20: 155-161Crossref Scopus (18) Google Scholar, 16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar, 17Rogers M.A. Langbein L. Praetzel S. Moll I. Krieg T. Winter H. Schweizer J. Differentiation. 1997; 61: 187-194Crossref PubMed Scopus (52) Google Scholar). To date, complete sequences for one human type I and two type II hair keratin genes have been described (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar, 18Bowden P.E. Hainey S.D. Parker G. Jones D.O. Zimonjic D. Popescu N. Hodgins M.B. J. Invest. Dermatol. 1998; 110: 158-164Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Fluorescence in situ hybridization analyses to human metaphase chromosomes have shown that the type I hair keratin gene hHa2 was located on chromosome 17q12-q21, whereas the genes of the type II hair keratins hHb1 and hHb6 were found on chromosome 12q13 (13Rogers M.A. Nischt R. Korge B. Krieg T. Fink T.M. Lichter P. Winter H. Schweizer J. Exp. Cell Res. 1995; 220: 357-362Crossref PubMed Scopus (53) Google Scholar, 18Bowden P.E. Hainey S.D. Parker G. Jones D.O. Zimonjic D. Popescu N. Hodgins M.B. J. Invest. Dermatol. 1998; 110: 158-164Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). With the exception of the human type I cytokeratin K18 gene which maps to chromosome 12q13 (19Waseem A. Gough A.C. Spurr N.K. Lane E.B. Genomics. 1990; 7: 186-194Crossref Scopus (36) Google Scholar), the genes for a large number of human type I and type II cytokeratins are also located on chromosome 17q12-q21 and 12q13, respectively (20Rosenberg M. RayChaudhury A. Shows T.B. Le Beau M.M. Fuchs E. Mol. Cell. Biol. 1988; 8: 722-736Crossref PubMed Scopus (132) Google Scholar, 21Romano V. Raimondi E. Bosco P. Feo S. Di Pietro C. Leube R.E. Troyanovsky S.M. Ceratto N. Genomics. 1992; 14: 495-497Crossref PubMed Scopus (15) Google Scholar, 22Romano V. Bosco P. Rocchi M. Costa G. Leube R.E. Franke W.W. Romano G. Cytogenet. Cell Genet. 1988; 48: 148-151Crossref PubMed Scopus (70) Google Scholar, 23Lessin S.R. Huebner K. Isobe M. Croce C.M. Steinert P.M. J. Invest. Dermatol. 1988; 91: 572-578Abstract Full Text PDF PubMed Google Scholar), thus indicating the existence of keratin type-specific gene clusters on distinct chromosomes of the human genome. In the course of the characterization of the human type IhHa2 hair keratin gene on a λ contig,2 we discovered a partial genomic sequence of the hHa5 gene lying approximately 8.0 kbp upstream of the hHa2 gene (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar). The present study attempts a bidirectional expansion and analysis of thehHa2/hHa5 gene region by means of combined λ and P1 artificial chromosome (PAC) cloning in order to learn more about the organization of the human type I hair keratin gene cluster on chromosome 17q12-q21 and to possibly detect novel type I hair keratin genes. The characterization of thehHa2 gene, as well as the partial characterization of thehH5 gene on λ clones ghkI2.12 and ghkI2.17, respectively, has been described previously (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar). In order to obtain the 5′ region of hHa5, a 0.3-kbp PstI-XhoI (linker) fragment of the hHa5 cDNA (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar) was used as a probe for the screening of the human genomic λ DNA library cloned into λ DashII (Stratagene, Heidelberg, Germany). The isolated λ clone, termed ghkI5.7, was subcloned as a 4.5-kbp HindIII-NotI fragment, which contained the majority of the hHa5 gene and a 9.0-kbpHindIII-NotI fragment, which harbored the complete sequence for the human hHa6 hair keratin gene. Complete characterization of this λ clone was performed as described previously (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar). PCR fragments generated by means of specific 3′-primer pairs from the noncoding regions of the human hHa3-II cDNA (15Rogers M.A. Schweizer J. Krieg T. Winter H. Mol. Biol. Rep. 1995; 20: 155-161Crossref Scopus (18) Google Scholar) as well as from the hHa6 gene (see λ clone characterization and Table I), were used to screen an arrayed human genomic PAC library. This library was derived from Sau3a-digested human genomic DNA cloned into the BamHI site of the PAC vector AD10SacBII (library and vector from Genome Systems Inc., St. Louis, MO). PCR screening with the hHa3-II probe resulted in the isolation of two clones (termed PAC1 and PAC2) that appeared 80% identical as evaluated byNdeI-NotI (linker) restriction enzyme (RE) digestion of each PAC clone. The larger clone, PAC1 was further characterized. PCR screening with the hHa6 primer pair resulted in the isolation of one PAC clone, termed PAC3. PCR analysis was performed using the Boehringer Expand Long PCR System (Boehringer, Mannheim, Germany) according to the manufacturer's instructions. The sequences of the primer pairs and PCR conditions are listed in Table I and below.Table IOligonucleotide primer pairs and PCR conditions used in this studyPCR productOligonucleotide sequenceSizeAnnealing temperaturebp°ChHa3-II 3′cagaagtatagcagtaagacagcaagaggaaagtttattaggc30855hHa6 3′gacagcccacttggtcggctgaaaagcacagtta15856hHa3-Igagattttggactctgtcttcatttcttctcctcctggttgtggg128862hHa4cctgcttttccattacctgttcaagtaaatgaagtctcctcctg157862hHa6agctccttgctaagctgcaacgctatgccaggagaacacact168462ΨhHaAactgtgggcaaagcaggatcatcaggaggcaacagaagagag156962hHa7gctgcctccatgtgcctcttctgctaccggttgatttaggg135862hHa8ctcctggagcaagaaatgtctctgtccctggtatctcatagcc145762 Open table in a new tab Clones PAC1 and 3 were initially analyzed for the presence of human type I hair keratin genes by PCR-based analysis using specific primers derived from cDNA clones of hHa1 (12Fink P. Rogers M.A. Korge B. Winter H. Schweizer J. Biochim. Biophys. Acta. 1995; 1264: 12-14Crossref PubMed Scopus (18) Google Scholar), hHa2 (13Rogers M.A. Nischt R. Korge B. Krieg T. Fink T.M. Lichter P. Winter H. Schweizer J. Exp. Cell Res. 1995; 220: 357-362Crossref PubMed Scopus (53) Google Scholar), hHa3-II (15Rogers M.A. Schweizer J. Krieg T. Winter H. Mol. Biol. Rep. 1995; 20: 155-161Crossref Scopus (18) Google Scholar), hHa4,1 hHa5 (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar) and hHa61 (see also, λ clone analysis), as well as from a genomic hHa3-I clone. 3The complete genomic sequence of the hHa3-I gene was a generous gift of Dr. A. P. Bertolino, Department of Dermatology, New York University, New York.PCR conditions were the same as used for PAC clone isolation. The PAC1 and PAC3 DNA was digested with NdeI and NotI (linker) and separated on 0.8% agarose long gels. The separated RE fragments were Southern blotted overnight onto Hybond N+ nylon membranes using 0.4 m NaOH, 0.6m NaCl as a transfer solution; 0.5 m Tris/HCl, pH 7.4, for neutralization followed by UV cross-linking of the DNA (Stratalinker, Stratagene, La Jolla, CA). The RE fragments containing conserved α-helical regions of human hair keratins were detected by low stringency hybridization of these blots with an α-helical PCR probe of the hHa1 cDNA (12Fink P. Rogers M.A. Korge B. Winter H. Schweizer J. Biochim. Biophys. Acta. 1995; 1264: 12-14Crossref PubMed Scopus (18) Google Scholar) using procedures described in the ECL random priming DNA labeling, hybridization, and detection system (Amersham Pharmacia Biotech). Hybridization was performed at 60 °C overnight; post hybridization washes were carried out with 1–1× SSC plus 0.1% SDS and with 1–0.5× SSC plus 0.1% SDS for 20 min. at 62 °C each. This same procedure was also used for analysis of the isolated NdeI subclones described below. Multiple RE fragments of NdeI-NotI cut PAC1 and PAC3 DNA were separated on 0.8% agarose long gels. Individual bands or groups of bands were excised from the gel, purified from agarose (agarose gel extraction kit, Boehringer, Mannheim, Germany), quantitated, and ligated into a dephosphorylated, NdeI-cut pGEM5Z sequencing vector. Insert-containing colonies were selected by blue/white screening. Miniprep DNA was prepared and RE digested with NdeI or withPstI and StyI in order to determine if more than one individual fragment was present in each ligation. Each unique subclone was then end-sequenced, and maxiprep DNA (Qiagen, Hilden, Germany) was prepared. This procedure resulted in the cloning of 80–90% of the RE fragments present on the PAC clones. 1) Generation of specific PAC subclone data bases: All NdeI subclones isolated were end-sequenced, and a data base of fragment end sequences was generated. Orientation of the fragments to each other was performed by generation of sequencing primers derived from the reverse and complement of each end sequence in order to sequence across the adjacent NdeI site via PAC DNA sequencing (termed crossover sequencing). Comparison of this crossover sequence by the FASTA program (Heidelberger Unix Sequence Analysis Resource, HUSAR) with the data base of end fragments allowed the discovery of the correct neighboring end fragment adjoining the end sequence analyzed. 2) Final contig closure: Initially, closure of the remaining open DNA fragments was attempted by PAC sequencing (primer walking) using the crossover sequences obtained from end fragments that had not found an adjacent partner. If no new NdeI site was found after sequencing 1 kbp of PAC DNA, then combinations of crossover oligos were used as primer pairs in long range PCR reactions using the Expand Long PCR System (Boehringer, Mannheim, Germany). The agarose gel separated PCR products were excised and end-sequenced by means of the crossover primers, used to generate the PCR product. A PCR product was considered genuine only when it exhibited the correct sequences from both sides compared with the initial PAC DNA sequence. These experiments were repeated twice. PCR primer pairs and sequencing primers were selected using the Oligo 5.0 software program (MedProbe, Oslo, Norway). Repetitive sequences were generally eliminated by comparison with the repetitive element data base REPBASE from HUSAR. Plasmid DNA, PAC DNA, and PCR products were sequenced using a 33P Chain Termination Cycle Sequencing Kit (Amersham Pharmacia Biotech) according to the manufacturer's instructions. 0.3 μg (plasmid), 3 μg (PAC), or 0.1–0.7 μg (PCR product) of DNA was used per sequencing with 10 pmol of the respective primer. Cycle sequencing conditions were 95 °C for 30 s; 55 °C for 30 s; 72 °C for 90 s; 45 cycles were performed. Sequencing reactions were separated on 5.7% polyacrylamide, 8 m urea gels. At a later date, fluorescence dye terminator cycle sequencing was performed using either the Amplitaq FS- (Applied Biosystems, Weiterstadt, Germany) or Thermosequenase (Amersham Pharmacia Biotech) cycle sequencing kits. 1 μg (Plasmid), 5 μg (PAC), or 0.2–1.2 μg (PCR products) of DNA were used with 10 pmol of the respective primer. Cycle sequencing conditions were 96 °C for 15 s; 55 °C for 8 s, 60 °C for 240 s; 24 or 30 cycles were performed. The fluorescence-labeled sequencing reactions were analyzed on a ABI 310 capillary electrophoresis sequencing apparatus (Applied Biosystems, Weiterstadt, Germany). In general, DNA sequence analysis was performed with several programs contained in the Wisconsin GCG package as provided by HUSAR. Contig generation and sequence correction was performed using the contig analysis software GELENTER or the STADEN program. Amino acid multialignments were performed using the software program CLUSTAL. Enhancer sequence recognition sites were determined using the TRANSFAC data base (24Wingender E. Kel A.E. Karas H. Heinemeyer T. Dietze P. Knuppel R. Romaschenko A.G. Kolchanov N.A. Nucleic Acids Res. 1997; 25: 265-268Crossref PubMed Scopus (131) Google Scholar). The 74-amino acid residues of the 2B α-helical subdomain of several human type I cytokeratins (K9–17, 19–20) and of all type I hair keratins presented here were used for multiple amino acid alignment using the software program CLUSTAL (HUSAR). Evolutionary tree construction was achieved using the CLUSTREE program (HUSAR). In order to further ensure the statistical significance of the produced data, distance matrices for each individual tree were generated using the program DISTANCES (HUSAR) and evaluated using the software program SPLITS (HUSAR). Total RNA was extracted from the bulbs of 10–20 freshly plucked human hair follicles using the RNeasy kit (Qiagen, Hilden, Germany). The RNA was reverse transcribed with Superscript II according to the manufacturer's protocol (Life Technologies, Inc., Eggenstein, Germany). PCR amplification of the generated cDNA was performed using the Expand Long PCR System (Boehringer, Mannheim, Germany) and the primer pair specific for each individual keratin (see Table I). PCR conditions were 94 °C for 2 min, subsequently 94 °C for 10 s, X °C for 30 s, 68 °C. for 2 min for 10 cycles then an additional 20 cycles using the same conditions but with 20 s of added elongation time for each cycle. X = annealing temperature listed in Table I. The PCR products were separated on 1% agarose gels. DNA purification and sequencing was performed as stated above. The combination of PAC and λ cloning allowed the isolation of a 190 kbp contiguous stretch of human genomic DNA harboring 10 human type I hair keratin genes (Fig. 1). The originally described λ contig (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar), together with the newly isolated λ clone, contain the entirehHa2, hHa5, and hHa6 genes and cover part of the PAC 3 clone, a 135-kbp genomic fragment obtained by PAC bank screening using specific PCR primers for the hHa6 gene (see Table I). PAC3 contains eight hair keratin genes (hHa6, hHa5, hHa2, hHa8, hHa7, ΨhHaA, hHa1, and hHa4) (Fig. 1). PAC1, which was isolated using specific PCR primers for the hHa3-II cDNA (see Table I) (15Rogers M.A. Schweizer J. Krieg T. Winter H. Mol. Biol. Rep. 1995; 20: 155-161Crossref Scopus (18) Google Scholar), is a 125-kbp genomic fragment harboring six hair keratin genes (hHa7, ΨhHaA, hHa1, hHa4, hHa3-II, and hHa3-I). PAC3 and PAC1 have an overlap of ∼64 kbp, both clones exhibiting thehHa7, ΨhHaA, hHa1, and hHa4 genes in common (Fig. 1). The size of the hair keratin genes ranges from 4.2 to 7.5 kbp, and the genes are separated from each other by 5.5–18.4 kbp (Fig. 2). Type I hair keratin genes hHa6, hHa2, hHa8, hHa7, ΨhHaA, hHa1, hHa4, hHa3-II, and hHa3-I are each divided into 7 exons and 6 introns. This is in contrast to the exon/intron organization of type I cytokeratin genes, which exhibit an additional, positionally highly variable intron in the region coding for the tail domain (2Steinert P.M. Steven A.C. Roop D.R. Cell. 1985; 42: 411-419Abstract Full Text PDF PubMed Scopus (288) Google Scholar). However, both gene families show exceptions to these rules, in that cytokeratin geneK9 possesses an 8th (25Reis A. Hennies H.C. Langbein L. Digweed M. Mischke D. Drechsler M. Schrock E. Royer-Pokora B. Franke W.W. Sperling K. Kuster W. Nat. Genet. 1994; 6: 174-179Crossref PubMed Scopus (231) Google Scholar) and hair keratin genehHa5 a 7th intron (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar), both being located in the 3′-noncoding region of the genes. Apart from the exon/intron boundaries of intron 7 of the hHa5 gene, all other exon/intron boundaries in type I hair keratin genes are positionally conserved, and all genes are transcribed in the same direction (Fig. 2; sequence accession numbers are presented in Table II).Figure 2Physical NdeI map of the 190-kbp region covered by clones PAC1 and PAC3. The physical map shown is contiguous. Vertical black lines show NdeI RE sites. Gray boxes denote individual exons, the white box marks a putative orphan exon. Black numbers below each individual NdeI fragment indicate the size in kilobase pairs. The plus signs following the black numbering indicate subcloned NdeI fragments. Black horizontal arrowsshow the direction of transcription of the genes. The white horizontal arrow indicates the theoretical transcription direction of the orphan exon. White inverted triangles demarcate end points of the λ contig. Black asterisks show the position of the HindIII sites used in the original subcloning of the λ contig (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar). Red bars indicate areas of finished sequencing, yellow bars denote areas of two pass/crossover sequencing. Blue bars demarcate areas closed by long range PCR.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IISize and sequence accession numbers for the hair keratin genes presented in this studyGene nameSequence sizeAccession no.bphHa15400Y16787hHa214117X90761hHa3-I5756Y16788hHa3-II7993Y16789hHa46552Y16790hHa55800Y16791hHa64667Y16792ΨhHaA6773Y16795hHa77494Y16793hHa85999Y16794The DNA sequences presented were submitted to the GenBank™/EBI database. The DNA accession number for the hHa2 gene was taken from Rogers et al. (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar). Open table in a new tab The DNA sequences presented were submitted to the GenBank™/EBI database. The DNA accession number for the hHa2 gene was taken from Rogers et al. (16Rogers M.A. Winter H. Langbein L. Krieg T. Schweizer J. J. Invest. Dermatol. 1996; 107: 633-638Abstract Full Text PDF PubMed Scopus (26) Google Scholar). In addition to these hair keratin genes, we identified a 263-bp DNA sequence, located 12.2 kbp upstream of the hHa8 gene, which exhibited a 68% sequence homology with the region coding for the α-helical part of exon 1 in human type I hair keratin genes (Fig. 2). Amino acid translation showed that the transcriptional direction of the sequence was the same as that of all other hair keratin genes located on the contig. However, the resulting protein sequence displayed only low homology with the characteristic helix initiation motif of type I cyto- and hair keratins. Moreover, even under low stringency conditions, a hHa1 cDNA derived α-helical probe did not hybridize to the 10.5-kbp NdeI fragment immediately downstream of the critical sequence (Fig. 2), thus indicating that the region 3′ to the putative exon does not encode further α-helical sequences. Finally, sequencing of a further 2 kbp downstream of the 263 bp region revealed sequences completely unrelated to that coding for α-helical segments. It therefore appears that the critical 263 bp sequence represents an orphan exon, a phenomenon seen previously also in a cosmid clone harboring sheep type II wool keratin genes (26Powell B.C. Cam G.R. Fietz M.J. Rogers G.E. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 5048-5052Crossref PubMed Scopus (34) Google Scholar). Multiple comparisons of the amino acid sequences derived from the 10 hair keratin genes led to a striking sorting of the keratin proteins into three groups, A and B being structurally highly related hair keratins, and a third group C, containing structurally more heterogeneous hair keratins. Group A encompassed hair keratins hHa1, hHa3-I, hHa3-II, 4While carrying out this sequencing project we noticed several sequencing errors in the previously published hHa1 (12Fink P. Rogers M.A. Korge B. Winter H. Schweizer J. Biochim. Biophys. Acta. 1995; 1264: 12-14Crossref PubMed Scopus (18) Google Scholar) (accession no. X86570) and hHa3-II (15Rogers M.A. Schweizer J. Krieg T. Winter H. Mol. Biol. Rep. 1995; 20: 155-161Crossref Scopus (18) Google Scholar) (accession no. X82634) cDNAs. Corrections to these cDNA sequences have been submitted to the GenBankTM/EBI data base under the same accession numbers. and the newly described hHa4 hair keratin which exhibited an overall amino acid identity of 89% (Fig. 3). Besides the rod domains, the homologous regions also comprised the entire head domains which are strictly conserved in size in this group, as well as 10 amino acid residues long carboxyl-terminal sequences adjacent to the end of the α-helical rod domains (Fig. 3). Hair keratin hHa1 has previously been found to be the ortholog of the murine mHa1 hair keratin (12Fink P. Rogers M.A. Korge B. Winter H. Schweizer J. Biochim. Biophys. Acta. 1995; 1264: 12-14Crossref PubMed Scopus (18) Google Scholar, 27Bertolino A.P. Checkla D.M. Notterman R. Sklaver I. Schiff T.A. Freedberg I.M. DiDona G.J. J. Invest. Dermatol. 1988; 91: 541-546Abstract Full Text PDF PubMed Google Scholar), whereas the new hair keratin hHa4 is orthologous with the murine mHa4 hair keratin (28Bertolino A.P. Checkla D.M. Heitner S. Freedberg I.M. Yu D.W. J. Invest. Dermatol. 1990; 94: 297-303Abstract Full Text PDF PubMed Google Scholar). Human hair keratins hHa1 and hHa4 possess 417 and 395 amino acid residues, respectively, and have calculated molecular masses of 47236 and 44719 Da. Within the group A hair keratins, hHa3-I and hHa3-II exhibit the by far highest sequence identity with each other (93.3%). Both contain 405 amino acid residues and have calculated molecular masses of 45934 and 46213 Da. They are highly related to the partial sequence of the murine hHa3 hair keratin (29Winter H. Siry P. Tobiasch E. Schweizer J. Exp. Cell Res. 1994; 212: 190-200Crossref PubMed Scopus (44) Google Scholar). Based on a common sequence motif PIG(S/P)CVTNPC in their carboxyl-terminal domains (see Fig. 3), we speculate that hHa3-II may represents the ortholog of the murine mHa3 hair keratin (29Winter H. Siry P. Tobiasch E. Schweizer J. Exp. Cell Res. 1994; 212: 190-200Crossref PubMed Scopus (44) Google Scholar). Group B contained hair keratins ΨhHaA, hHa7, and hHa8 (Fig. 4). These are novel hair keratins, which have not yet been described in other species. Their overall sequence homology is in the range of 81%; however, due to an almost completely identical head domain, comparison of hHa7 and hHa8 only, leads to a much higher homology value of 92.6%. Hair keratins hHa7 and hHa8 comprise 408 and 415 amino acid residues, respectively, wi" @default.
• W2013826368 created "2016-06-24" @default.
• W2013826368 creator A5002375590 @default.
• W2013826368 creator A5021875307 @default.
• W2013826368 creator A5034833482 @default.
• W2013826368 creator A5053274927 @default.
• W2013826368 creator A5054900882 @default.
• W2013826368 date "1998-10-01" @default.
• W2013826368 modified "2023-10-14" @default.
• W2013826368 title "Characterization of a 190-Kilobase Pair Domain of Human Type I Hair Keratin Genes" @default.
• W2013826368 cites W1479725497 @default.
• W2013826368 cites W1530427417 @default.
• W2013826368 cites W1580811574 @default.
• W2013826368 cites W1748312647 @default.
• W2013826368 cites W1823748583 @default.
• W2013826368 cites W1965350188 @default.
• W2013826368 cites W1973212917 @default.
• W2013826368 cites W1978881490 @default.
• W2013826368 cites W1982319313 @default.
• W2013826368 cites W1985534974 @default.
• W2013826368 cites W1986334292 @default.
• W2013826368 cites W1990204628 @default.
• W2013826368 cites W1992381021 @default.
• W2013826368 cites W1998036640 @default.
• W2013826368 cites W1998075825 @default.
• W2013826368 cites W2000158011 @default.
• W2013826368 cites W2003236361 @default.
• W2013826368 cites W2008978694 @default.
• W2013826368 cites W2011934741 @default.
• W2013826368 cites W2012688915 @default.
• W2013826368 cites W2014960294 @default.
• W2013826368 cites W2015270157 @default.
• W2013826368 cites W2016468092 @default.
• W2013826368 cites W2017265815 @default.
• W2013826368 cites W2018576877 @default.
• W2013826368 cites W2023484466 @default.
• W2013826368 cites W2027882497 @default.
• W2013826368 cites W2030456774 @default.
• W2013826368 cites W2031605069 @default.
• W2013826368 cites W2034944907 @default.
• W2013826368 cites W2037824747 @default.
• W2013826368 cites W2044453539 @default.
• W2013826368 cites W2044735117 @default.
• W2013826368 cites W2045467759 @default.
• W2013826368 cites W2053014860 @default.
• W2013826368 cites W2055824128 @default.
• W2013826368 cites W2055936328 @default.
• W2013826368 cites W2057931621 @default.
• W2013826368 cites W2063081845 @default.
• W2013826368 cites W2066092624 @default.
• W2013826368 cites W2067263021 @default.
• W2013826368 cites W2071925187 @default.
• W2013826368 cites W2072407487 @default.
• W2013826368 cites W2073507293 @default.
• W2013826368 cites W2075879868 @default.
• W2013826368 cites W2076817979 @default.
• W2013826368 cites W2076858319 @default.
• W2013826368 cites W2079431376 @default.
• W2013826368 cites W2083327399 @default.
• W2013826368 cites W2089101779 @default.
• W2013826368 cites W2094221027 @default.
• W2013826368 cites W2097060373 @default.
• W2013826368 cites W2101190148 @default.
• W2013826368 cites W2101378064 @default.
• W2013826368 cites W2122412289 @default.
• W2013826368 cites W2125911728 @default.
• W2013826368 cites W2129590511 @default.
• W2013826368 cites W2145939619 @default.
• W2013826368 cites W2146964179 @default.
• W2013826368 cites W320318737 @default.
• W2013826368 cites W4255236716 @default.
• W2013826368 doi "https://doi.org/10.1074/jbc.273.41.26683" @default.
• W2013826368 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9756910" @default.
• W2013826368 hasPublicationYear "1998" @default.
• W2013826368 type Work @default.
• W2013826368 sameAs 2013826368 @default.
• W2013826368 citedByCount "73" @default.
• W2013826368 countsByYear W20138263682013 @default.
• W2013826368 countsByYear W20138263682014 @default.
• W2013826368 countsByYear W20138263682018 @default.
• W2013826368 countsByYear W20138263682020 @default.
• W2013826368 countsByYear W20138263682021 @default.
• W2013826368 countsByYear W20138263682022 @default.
• W2013826368 countsByYear W20138263682023 @default.
• W2013826368 crossrefType "journal-article" @default.
• W2013826368 hasAuthorship W2013826368A5002375590 @default.
• W2013826368 hasAuthorship W2013826368A5021875307 @default.
• W2013826368 hasAuthorship W2013826368A5034833482 @default.
• W2013826368 hasAuthorship W2013826368A5053274927 @default.
• W2013826368 hasAuthorship W2013826368A5054900882 @default.
• W2013826368 hasBestOaLocation W20138263681 @default.
• W2013826368 hasConcept C104317684 @default.
• W2013826368 hasConcept C108335385 @default.
• W2013826368 hasConcept C142669718 @default.
• W2013826368 hasConcept C1491633281 @default.
• W2013826368 hasConcept C153911025 @default.
• W2013826368 hasConcept C54355233 @default.
• W2013826368 hasConcept C78383274 @default.

• next