FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2013853691> ?p ?o ?g. }

• W2013853691 endingPage "24814" @default.
• W2013853691 startingPage "24805" @default.
• W2013853691 abstract "Neutrophils play important roles in host innate immunity and various inflammation-related diseases. In addition, neutrophils represent an excellent system for studying directional cell migration. However, neutrophils are terminally differentiated cells that are short lived and refractory to transfection; thus, they are not amenable for existing gene silencing techniques. Here we describe the development of a method to silence gene expression efficiently in primary mouse neutrophils. A mouse stem cell virus-based retroviral vector was modified to express short hairpin RNAs and fluorescent marker protein at high levels in hematopoietic cells and used to infect mouse bone marrow cells prior to reconstitution of the hematopoietic system in lethally irradiated mice. This method was used successfully to silence the expression of Gβ1 and/or Gβ2 in mouse neutrophils. Knockdown of Gβ2 appeared to affect primarily the directionality of neutrophil chemotaxis rather than motility, whereas knockdown of Gβ1 had no significant effect. However, knockdown of both Gβ1 and Gβ2 led to significant reduction in motility and responsiveness. In addition, knockdown of Gβ1 but not Gβ2 inhibited the ability of neutrophils to kill ingested bacteria, and only double knockdown resulted in significant reduction in bacterial phagocytosis. Therefore, we have developed a short hairpin RNA-based method to effectively silence gene expression in mouse neutrophils for the first time, which allowed us to uncover divergent roles of Gβ1 and Gβ2 in the regulation of neutrophil functions. Neutrophils play important roles in host innate immunity and various inflammation-related diseases. In addition, neutrophils represent an excellent system for studying directional cell migration. However, neutrophils are terminally differentiated cells that are short lived and refractory to transfection; thus, they are not amenable for existing gene silencing techniques. Here we describe the development of a method to silence gene expression efficiently in primary mouse neutrophils. A mouse stem cell virus-based retroviral vector was modified to express short hairpin RNAs and fluorescent marker protein at high levels in hematopoietic cells and used to infect mouse bone marrow cells prior to reconstitution of the hematopoietic system in lethally irradiated mice. This method was used successfully to silence the expression of Gβ1 and/or Gβ2 in mouse neutrophils. Knockdown of Gβ2 appeared to affect primarily the directionality of neutrophil chemotaxis rather than motility, whereas knockdown of Gβ1 had no significant effect. However, knockdown of both Gβ1 and Gβ2 led to significant reduction in motility and responsiveness. In addition, knockdown of Gβ1 but not Gβ2 inhibited the ability of neutrophils to kill ingested bacteria, and only double knockdown resulted in significant reduction in bacterial phagocytosis. Therefore, we have developed a short hairpin RNA-based method to effectively silence gene expression in mouse neutrophils for the first time, which allowed us to uncover divergent roles of Gβ1 and Gβ2 in the regulation of neutrophil functions. Neutrophils are the most abundant leukocytes in the blood and play an essential role in the early stages of the innate immune responses by ingesting and killing invading pathogens. In response to inflammatory stimuli, neutrophils first adhere to and extravasate through blood vessels and then migrate through the interstitial tissue toward the site of inflammation. Although neutrophils play an important role in the host defense, uncontrolled inflammatory reactions are associated with a variety of pathological conditions, including ischemia-reperfusion injury during heart attack and strokes, arteriosclerosis, rheumatoid arthritis, and allergic reactions (1Kelly M. Hwang J.M. Kubes P. J. Allergy Clin. Immunol. 2007; 120: 3-10Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 2Nathan C. Nat. Rev. Immunol. 2006; 6: 173-182Crossref PubMed Scopus (2065) Google Scholar, 3Dinauer M.C. Methods Mol. Biol. 2007; 412: 489-504Crossref PubMed Scopus (44) Google Scholar). Therefore, understanding how neutrophil recruitment and function is regulated is critical for developing potential treatments for a number of disorders. Neutrophils are also a fine model system to study directional cell migration and chemotaxis because of their ability to migrate rapidly and directionally under a shallow gradient of chemoattractants. Chemotaxis is a fundamental biological process used by a variety of cell types and underlies a wide range of developmental, physiological, and pathophysiological events. It consists of two basic components, directionality and motility (4Parent C.A. Curr. Opin. Cell Biol. 2004; 16: 4-13Crossref PubMed Scopus (163) Google Scholar, 5Wu D. Cell Res. 2005; 15: 52-56Crossref PubMed Scopus (65) Google Scholar, 6Stephens L. Milne L. Hawkins P. Curr. Biol. 2008; 18: R485-R494Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 7Brandman O. Meyer T. Science. 2008; 322: 390-395Crossref PubMed Scopus (335) Google Scholar, 8Weiner O.D. Neilsen P.O. Prestwich G.D. Kirschner M.W. Cantley L.C. Bourne H.R. Nat. Cell Biol. 2002; 4: 509-513Crossref PubMed Scopus (437) Google Scholar). Most of the neutrophil chemoattractants, including formyl-Met-Leu-Phe (fMLP), 2The abbreviations used are: fMLPformyl-Met-Leu-PheshRNAshort hairpin RNACMVcytomegalovirusLTRlong terminal repeatYFPyellow fluorescent proteinFACSfluorescence-activated cell sortingmiR30microRNA 30. bind to their specific cell surface receptors that are coupled to heterotrimeric G proteins, which upon activation regulate numerous downstream effectors. Studies in Dictyostelium cells demonstrated that the Gβ subunit plays a critical role in signal transduction to chemotaxis regulation (9Wu L. Valkema R. Van Haastert P.J. Devreotes P.N. J. Cell Biol. 1995; 129: 1667-1675Crossref PubMed Scopus (182) Google Scholar, 10Kay R.R. Langridge P. Traynor D. Hoeller O. Nat. Rev. Mol. Cell Biol. 2008; 9: 455-463Crossref PubMed Scopus (5) Google Scholar). However, the importance of Gβ subunits in neutrophil chemotaxis has yet been investigated. formyl-Met-Leu-Phe short hairpin RNA cytomegalovirus long terminal repeat yellow fluorescent protein fluorescence-activated cell sorting microRNA 30. Despite basic scientific and clinical importance of neutrophil research, it has been hindered by the fact that these cells are terminally differentiated, short lived, and thus not amenable to in vitro manipulations, including transfection. Targeted gene inactivation in mice has been the only approach to provide primary neutrophils for loss of function studies. Although these studies have provided novel insights into neutrophil biology, the approach is costly and time-consuming. Therefore, it is imperative to develop a more efficient approach to study neutrophils. RNA interference has been shown to be a rapid and powerful tool for knocking down gene expression in a sequence-specific fashion. Compared with chemically synthesized small interfering RNA, short hairpin RNAs (shRNAs) can be stably expressed in hard-to-transfect primary cells and in whole organisms (11Paddison P.J. Caudy A.A. Sachidanandam R. Hannon G.J. Methods Mol. Biol. 2004; 265: 85-100PubMed Google Scholar). Recently, the miR30-shRNA cassette has been reported to yield a higher level of shRNA and more efficient knockdown than a simple shRNA design (12Silva J.M. Li M.Z. Chang K. Ge W. Golding M.C. Rickles R.J. Siolas D. Hu G. Paddison P.J. Schlabach M.R. Sheth N. Bradshaw J. Burchard J. Kulkarni A. Cavet G. Sachidanandam R. McCombie W.R. Cleary M.A. Elledge S.J. Hannon G.J. Nat. Genet. 2005; 37: 1281-1288Crossref PubMed Scopus (533) Google Scholar). Using the same miR30-shRNA cassette, Zhu et al. (13Zhu X. Santat L.A. Chang M.S. Liu J. Zavzavadjian J.R. Wall E.A. Kivork C. Simon M.I. Fraser I.D. BMC Mol. Biol. 2007; 8: 98Crossref PubMed Scopus (56) Google Scholar) have silenced multiple target genes simultaneously to overcome isoform redundancy issues (14Hwang J.I. Choi S. Fraser I.D. Chang M.S. Simon M.I. Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 9493-9498Crossref PubMed Scopus (38) Google Scholar), demonstrating the powerful capabilities of this microRNA-based shRNA design. Although shRNA-mediated gene silencing was successful in neutrophil-like cell lines, such as differentiated HL-60, these cells may not faithfully recapitulate the biology of primary neutrophils. In addition, these cell lines cannot be used for in vivo studies. By taking advantage of pluripotent differentiation potentials of hematopoietic stem cells, we describe the development of a novel method to silence gene expression in primary neutrophils in mice using a retrovirus expressing shRNAs. Using this new method, we demonstrated that Gβ2 is primarily involved in regulating directionality rather than motility of neutrophil chemotaxis, and Gβ1 is involved in bacterial killing by neutrophils. The initial retroviral vector MIGR1 (mouse stem cell virus-internal ribosome entry site-green fluorescent protein-retrovirus-1) and the packaging vector pCL-ECO were generous gifts from Dr. Diane Krause (Yale University). For the LTR-YFP-shGβ2 vector, we replaced GFP in MIGR1 with YFP-miR-shGβ2, which was amplified by PCR from pSLIK-miR-shGβ2 and carries a targeting sequence of TGCTCATGTATTCCCACGACAA (14Hwang J.I. Choi S. Fraser I.D. Chang M.S. Simon M.I. Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 9493-9498Crossref PubMed Scopus (38) Google Scholar, 15Shin K.J. Wall E.A. Zavzavadjian J.R. Santat L.A. Liu J. Hwang J.I. Rebres R. Roach T. Seaman W. Simon M.I. Fraser I.D. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 13759-13764Crossref PubMed Scopus (263) Google Scholar). For the CMV-YFP-shRNA vectors, the CMV promoter was amplified from the pAAV-MCS vector (Stratagene (Cedar Creek, TX)) by PCR and inserted between the LTR and YFP-miR-shRNA. miR-shRNA sequences for Gβ1 knockdown were designed by using the RNA interference Codex algorithm (available on the World Wide Web). Four targeting sequences were tested (A, GCGACTCTTTCTCAGATCACAA; B, ATCTGGGACAGTTATACCACAA; C, AACATTATCTGTGGTATCACAT; D, GGCCGAGCAACTGAAGAACCAA). The D sequence was used for the knockdown studies in neutrophils. To generate plasmid containing tandem shRNAs, miR30-shGβ2 was amplified by PCR and inserted downstream of miR-Gβ1. Td-Tomato was amplified and inserted into pGEX-3X (GE Healthcare) for the bacterial killing assay. All constructs were verified by sequencing. We used PHE (Phoenix Ecotropic) cells, which are capable of producing viral gag-pol and envelope proteins, as the packaging cell line (16Swift S. Lorens J. Achacoso P. Nolan G.P. Current Protocols in Immunology. John Wiley & Sons, Inc., New York2001: 10.17.14-10.17.29Google Scholar). PHE and NIH 3T3 cells were maintained in 90% Dulbecco’s modified Eagle’s medium, 10% fetal bovine serum, 100 units/ml penicillin, and 0.1 mg/ml streptomycin at 37 °C under 5% CO2 in humidified air. One day prior to transfection, PHE cells were seeded at a density of 3 × 106 cells/T 75 flask. Retroviral vector and pCL-ECO were co-transfected into cells using Lipofectamine Plus (Invitrogen) according to the manufacturer’s instructions. Two days later, the medium containing viruses was concentrated using Amicon Ultra columns (Millipore, Billerica, MA). For viral titer determination, serial dilutions of virus supernatants were added to NIH 3T3 cells in a 24-well plate, followed by centrifugation at room temperature to enhance the transduction efficiency. Twenty-four hours later, cells were analyzed by a flow cytometer. Allophycocyanin (APC)-CD11b, PerCP-B220, and APC-CD3ɛ antibodies were purchased from eBioscience (San Diego, CA). APC-Gr1 and Percp-Ly-6G antibodies were from BD (San Jose, CA). The single color flow analysis was done in the Guava EasyCyte Mini Base System (Millipore), and the multiple color flow analysis was performed in an LSR II fluorescence-activated cell sorting (FACS) analyzer (BD Biosciences). Cell sorting was performed by a FACS Aria sorter (BD Biosciences). Results were analyzed by FlowJo software (Treestar, Ashland, OR). Western blotting was performed with the following antibodies: anti-Ser(P)-473-Akt antibody (Cell Signaling Technology, Beverly, MA), anti-Gβ2 and anti-GFP (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), anti-β-actin (Sigma), and anti-β-tubulin antibody (collected from the supernatant of a hybridoma cell line). The proteins were detected by using the SuperSignal West Pico chemiluminescence substrate (Thermo Fisher Scientific, Rockford, IL). C57BL/6 mice, aged 8–12 weeks, were obtained from Taconic (Germantown, NY). The donor mice were treated with 5-fluorouracil (Sigma) at 150 mg/kg to enrich hematopoietic stem cells in the bone marrow. Three days later, bone marrow cells were harvested from femurs and tibias and cultured in Iscove’s modified Dulbecco’s medium containing 20% endotoxin-free fetal bovine serum (Invitrogen), 50 ng/ml recombinant murine stem cell factor, 10 ng/ml recombinant murine interleukin-3, and 10 ng/ml recombinant human interleukin-6 (PeproTech, Rocky Hill, NJ) for 2 days. Cells were then infected twice with viruses in the presence of 4 μg/ml Polybrene (Millipore). The transduced bone marrow cells were transplanted back into lethally irradiated recipient mice (9.5 grays; γ-rays) by retro-orbital injection. Eight weeks later, the transplanted mice were euthanized for the further analysis. The use and care of animals were approved by the Institutional Animal Care and Use Committee at Yale University. Neutrophils were isolated from bone marrows by using discontinuous Percoll gradient as described previously (17Dong X. Wu D. Methods Enzymol. 2006; 406: 605-613Crossref PubMed Scopus (10) Google Scholar). The purity of the preparation was verified by Ly6G staining, which is above 95% pure for neutrophils. fMLP was purchased from Sigma. The chemotaxis assay using a Dunn chamber was carried out as described previously (18Zicha D. Dunn G. Jones G. Methods Mol. Biol. 1997; 75: 449-457PubMed Google Scholar) with some modifications. To minimize inconsistency between assays, we monitored chemoattractant gradients using free fluorescein isothiocyanate dye. Only cells under certain gradient characteristics were analyzed and included in our statistical analysis (supplemental Fig. S1A). Time lapse image series acquired in the aforementioned chemotaxis experiments were analyzed using the MetaMorph image analysis software. The software calculates the x,y coordinate of the centroid of a cell that is designated for tracking in each of the images. Several parameters that reflect the chemotactic behaviors of a cell are obtained from these timed coordinate series. Because the cells in general do not move with a constant velocity, they often move a distance that is less than the noise level of the cell tracking algorithm in the short time interval between two consecutive frames. To exclude those meaningless tracking results from the data analysis, we set a cut-off of 7.5 μm, which represents one-half of an average body length of a polarized neutrophil, as the minimal distance that a cell has to travel in order for the coordinate to be included in the following analyses. We computed the following parameters to quantify the chemotactic behaviors of a cell (supplemental Fig. S1B). Assuming that a cell migration trace consists of n points (p1, p2, … pn) in that order so that they have coordinates (xi,yi)i= 1,2… .n, respectively, let Δxi = xi+ 1 − xi,Δyi = yi+ 1 − yi. Then the distances between consecutive points are as follows. The directionality error angle (αi) was calculated as follows, αi = (180/π)arccos(Δxi/Di), where i = 1, 2, … n. This measures the angle between the cell migration direction and the gradient direction. We take the average directionality angle for all pi values. A smaller value indicates that the cell is more closely following the gradient. Motility is calculated as follows, motility = |pn − p0|/elapsed time. This measures the overall cell migration speed. λ-Carrageenan was purchased from Sigma. Air pouches were generated by subcutaneously injecting 3 ml of sterile-filtered air on day 0 and day 3. At day 6, carrageenan suspension (5 mg in 0.5 ml of sterile, pyrogen-free saline) was injected into the air pouch. 4 h later, pouch exudates were recovered with 1 ml of cold phosphate-buffered saline containing 3 mm EDTA (19Di Lorenzo A. Fernández-Hernando C. Cirino G. Sessa W.C. Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 14552-14557Crossref PubMed Scopus (115) Google Scholar). The total cell count was measured using the Guava EasyCyte Mini Base System (Millipore). Cells were then stained with APC-CD11b and Percp-Ly-6G and subjected for flow cytometric analysis using an LSR II FACS analyzer. Neutrophils were defined as Ly-6G+CD11b+ cells. Escherichia coli (DH10B) transformed with pGEX-Td-Tomato plasmid was induced by isopropyl 1-thio-β-d-galactopyranoside to express Td-Tomato, the red fluorescence protein. Bone marrow was isolated from mouse tibia and femur of hind legs and then incubated at 37 °C in the presence of bacteria expressing red fluorescence at a ratio of 1:10 for 15 min. Non-internalized bacteria were then removed by washing three times by centrifugation at 100 × g for 5 min in Hanks’ buffer with 1% bovine serum albumin, and fluorescence intensity at this time point was used as a measurement of phagocytosis. Following this initial bacterial loading, cells were incubated at 37 °C for the time periods indicated prior to fixation with 2% paraformaldehyde. Bone marrow cells were then labeled with APC-conjugated anti-mouse Gr1 in order to identify the neutrophil population, and fluorescence was then assessed by flow cytometry using a BD LSRII FACS analyzer. To develop an efficient method for loss-of-function study of mouse primary neutrophils, we tested whether the lentiviral miR30-embedded shRNA production system developed by Simon and colleagues (15Shin K.J. Wall E.A. Zavzavadjian J.R. Santat L.A. Liu J. Hwang J.I. Rebres R. Roach T. Seaman W. Simon M.I. Fraser I.D. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 13759-13764Crossref PubMed Scopus (263) Google Scholar, 20Stegmeier F. Hu G. Rickles R.J. Hannon G.J. Elledge S.J. Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 13212-13217Crossref PubMed Scopus (447) Google Scholar) would be able to silence gene expression in neutrophils in a scheme outlined in supplemental Fig. S2. Briefly, lentiviruses expressing GFP were used to infect mouse bone marrow cells, which were subsequently used to generate neutrophils after transplantation into lethally irradiated recipient mice. We found that this lentivirus-based system did not infect mouse bone marrow cells at a high efficiency (data not shown). We decided to switch to a mouse stem cell virus-based system because mouse stem cell virus infects hematopoietic stem/progenitor cells at high efficiencies (21Leimig T. Mann L. Martin Mdel P. Bonten E. Persons D. Knowles J. Allay J.A. Cunningham J. Nienhuis A.W. Smeyne R. d'Azzo A. Blood. 2002; 99: 3169-3178Crossref PubMed Scopus (57) Google Scholar). The insert encoding Venus fluorescence protein (a variant of YFP) and an shRNA targeting the β2 subunit of G protein embedded within the miR30 sequence was subcloned from the lentiviral system into MIGR1, a mouse stem cell virus-based retroviral vector (Fig. 1A). We refer to this vector as LTR-YFP-shGβ2. The reasons for choosing the Gβ2 shRNA in this study were as follows: 1) the shRNA was shown to be effective and specific (15Shin K.J. Wall E.A. Zavzavadjian J.R. Santat L.A. Liu J. Hwang J.I. Rebres R. Roach T. Seaman W. Simon M.I. Fraser I.D. Proc. Natl. Acad. Sci. U.S.A. 2006; 103: 13759-13764Crossref PubMed Scopus (263) Google Scholar); 2) Gβ2 is one of the two Gβs abundantly expressed in mouse neutrophils based on our expression microarray analysis (Fig. 1B); and 3) the role of Gβ in neutrophil chemotaxis has not been investigated. We infected bone marrow cells isolated from C57BL/6 mice with LTR-YFP-shGβ2 virus and transplanted them into lethally irradiated C57BL/6 recipients. After 8 weeks of recovery and repopulation, neutrophils were isolated from the transplanted mice and analyzed for YFP expression. As shown in Fig. 1C, 44.92% of isolated neutrophils were YFP-positive, suggesting that this retroviral vector provides reasonable infection efficiency. We subsequently sorted the YFP-positive neutrophils (Fig. 1D) and analyzed them for shRNA-mediated knockdown efficiency. Because YFP and the shRNA were expressed from the same transcript, we expected the YFP-positive cells to express the shRNA. We observed about a 50% reduction in Gβ2 expression in neutrophils expressing YFP (Fig. 1E). However, little effect on chemoattractant (fMLP)-induced phosphorylation of Akt at Ser-473 was observed. This phosphorylation event is known to depend on Gβγ (14Hwang J.I. Choi S. Fraser I.D. Chang M.S. Simon M.I. Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 9493-9498Crossref PubMed Scopus (38) Google Scholar, 22Bommakanti R.K. Vinayak S. Simonds W.F. J. Biol. Chem. 2000; 275: 38870-38876Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). Therefore, we hypothesized that the LTR promoter-based vector may not produce sufficient shRNA to allow effective knockdown of Gβ2 and result in the expected functional defects. To improve the shRNA production, we decided to add a strong transcriptional promoter/enhancer by inserting a cytomegalovirus (CMV) promoter with a β-globin intron between the 5′-LTR and the YFP-miR30-shRNA expression cassette (Fig. 2A). The β-globin intron enhances transcriptional activities as an enhancer-like element (23Komiya E. Kondoh M. Mizuguchi H. Fujii M. Utoguchi N. Nakanishi T. Watanabe Y. Placenta. 2006; 27: 934-938Crossref PubMed Scopus (2) Google Scholar). A second construct with the luciferase shRNA embedded in the miR30 backbone in place of the Gβ2 shRNA was made as a control for our studies described below. These two new constructs are referred to as CMV-YFP-shGβ2 and CMV-YFP-shLuc. We first tested these new constructs by infecting NIH 3T3 cells and found that cells infected with viruses generated from the new constructs (CMV-YFP-shLuc or -Gβ2) expressed higher levels of YFP than those generated from LTR-YFP-shGβ2 at the same multiplicity of infection (Fig. 2, B and C). Importantly, despite the same Gβ2 shRNA sequence in both LTR- and CMV-driven vectors, CMV-YFP-shGβ2 yielded much more efficient knockdown of Gβ2 expression than LTR-YFP-shGβ2 (Fig. 2D). These results suggest that the CMV promoter coupled with the β-globin intron sequence leads to higher expression levels than the viral LTR and that higher shRNA expression translates into more effective gene expression knockdown. Next, we tested whether the modified vector would be more efficient in silencing gene expression in mouse neutrophils. The CMV-YFP-shLuc and CMV-YFP-shGβ2 viruses were used to infect mouse bone marrow cells, which were subsequently transplanted into lethally irradiated recipient mice. Fig. 3A shows a representative set of flow cytometric analyses of neutrophils isolated from these transplanted mice. In this experiment, 30% of CMV-YFP-shGβ2 neutrophils were YFP-positive, whereas close to 60% of CMV-YFP-shLuc neutrophils were YFP-positive. The YFP-positive neutrophils were isolated by FACS, and their purity is shown in Fig. 3B. The sorted YFP-positive neutrophils were then subjected to Western analysis. As shown in Fig. 3C, the level of Gβ2 was markedly reduced in sorted YFP-positive neutrophils expressing shGβ2 compared with neutrophils from non-transplanted mice or neutrophils expressing shLuc. In all of the experiments performed, there was 70–85% reduction in Gβ2 expression levels in cells expressing shGβ2 compared with the controls. Importantly, there was a clear reduction in fMLP-induced Akt phosphorylation in cells expressing YFP-shGβ2 compared with the controls (Fig. 3C). Of note, silencing Gβ2 expression in neutrophil did not affect the expression of Gβ1 or Gαi2 (Fig. 3C). Because Gβ1 is also highly expressed in murine neutrophils (Fig. 1B) and it may have a redundancy function as Gβ2, we also tried to silence Gβ1 expression using our new vector. Four different shRNAs targeting Gβ1 were designed, and the most potent shRNA (shGβ1-D) was identified by significantly suppressing endogenous Gβ1 expression in NIH 3T3 cells (supplemental Fig. S3). This shRNA was used in the following study. After bone marrow transplantation, we sorted out the YFP-positive neutrophils transduced with Gβ1 shRNA or control luciferase shRNA (Fig. 4A) and performed Western analysis. As shown in Fig. 4B, the level of Gβ1 was significantly reduced in sorted YFP-positive neutrophils expressing shGβ1 compared with control neutrophils from non-transplanted mice or neutrophils expressing shLuc. One of the main powers of the miR30-shRNA system is to simultaneously knock down multiple different gene targets (13Zhu X. Santat L.A. Chang M.S. Liu J. Zavzavadjian J.R. Wall E.A. Kivork C. Simon M.I. Fraser I.D. BMC Mol. Biol. 2007; 8: 98Crossref PubMed Scopus (56) Google Scholar). To exploit this possibility in our system, we tried a double knockdown of Gβ1 and Gβ2 in neutrophils. The second miR-shRNA was inserted downstream of the first miR-shRNA, and both shRNAs were driven by the enhanced CMV promoter (Fig. 4C). Similarly, we sorted out the YFP-positive neutrophils transduced with Gβ1 shRNA and Gβ2 shRNA (double knockdown) or control luciferase shRNA (Fig. 4D), and we observed the efficient suppression of Gβ1 and Gβ2 expression in neutrophils (Fig. 4E), suggesting the successful knockdown of multiple gene targets in vivo. Next, we performed three functional assays for transduced neutrophils. First, we tested the effect of Gβ knockdown on in vitro neutrophil chemotaxis using a Dunn chamber, in which a shallow fMLP gradient was established and cell migration was tracked using time lapse videomicroscopy. Two key parameters were obtained from analysis of the time lapse image series: directionality error (reflecting how well a cell follows the chemoattractant gradient) and motility (see “Materials and Methods” for details). Significant portions of the neutrophils isolated from transplanted mice were YFP-negative. Supplemental Fig. S4A shows bright field and fluorescence images of neutrophils in Dunn chambers, in which YFP-positive and -negative neutrophils can be readily recognized and tracked. These YFP-negative cells have little or no shGβ2 expression and therefore normal levels of Gβ2 protein (supplemental Fig. S4, B and C). Thus, these YFP-negative cells served as excellent internal controls for the Dunn chamber chemotaxis assay, which are known to be variable. In addition, paired statistical analyses were used to identify small differences in chemotaxis parameters caused by gene silencing. Analysis of chemotactic parameters of YFP-positive cells and negative cells revealed that YFP-positive neutrophils isolated from CMV-YFP-shGβ2 virus-infected mice showed impaired directionality compared with YFP-negative cells (Fig. 5A). Interestingly, no significant directionality defect was detected in Gβ1-silenced neutrophils compared with control cells (Fig. 5A), and no further directionality defect was observed in Gβ1 and Gβ2 double knockdown neutrophils as compared with Gβ2-silenced cells (Fig. 5A), suggesting that Gβ2 is the major isoform responsible for neutrophil directionality. The effect of Gβ1 knockdown or Gβ2 knockdown on motility appeared to be insignificant (Fig. 5B). Neutrophils suppressing both Gβ1 and Gβ2 expression (Fig. 5B) showed a modest but significant reduction in motility. In addition, ∼30% of Gβ1/Gβ2 double knockdown neutrophils failed to respond to fMLP and were immobile, whereas knockdown of either Gβ subunit had no significant effects on the number of responding cells (Fig. 5C). As important controls, there were no differences between YFP-positive and -negative neutrophils isolated from mice transplanted with CMV-YFP-shLuc virus-infected bone marrow cells (Fig. 5, A and B). Therefore, these results together indicate that Gβ2, but not Gβ1, has an important role in neutrophil directionality regulation, whereas both Gβ subunits are involved in motility regulation. To examine neutrophil recruitment in vivo, we used the air pouch model (24Colville-Nash P. Lawrence T. Methods Mol. Biol. 2003; 225: 181-189PubMed Google Scholar). In this model, subcutaneous injection of air into dorsal surface of mice results in the formation of an air pouch, which has a lining morphologically similar to the synovium. Carrageenan, polysaccharide extracted from red seaweeds, was injected into the pouch to induce robust inflammation, as indicated by an increase in total neutrophil number and higher neutrophil percentage in the pouch exudates compared with those in mice injected with saline (data not shown). Among these neutrophils recruited into the pouch, two or three populations (YFP-low, YFP-medium, and YFP-high) were observed based on their YFP expression (Fig. 6A). In our analysis, we refer to YFP-high cells as YFP-positive cells and YFP-low cells as YFP-negative cells. As indicated in supplemental Fig. S4, YFP-negative cells also served as internal controls for YFP-positive cells in this assay. For each animal, the ratio between YFP-positive neutrophils and YFP-negative neutrophils in the pouch exudates (Fig. 6A, bottom), which reflects the migration ability of transduced neutrophils, was normalized based on the same ratio in the blood (Fig. 6A, top). As expected, neutrophils expressing luciferase shRNA (shLuc) migrate normally in vivo (the ratio of YFP+/YFP− is 0.97 ± 0.05; Fig. 6B). However, the infiltration of Gβ2-silenced neutrophils was markedly inhibited (the ratio of YFP+/YFP−" @default.
• W2013853691 created "2016-06-24" @default.
• W2013853691 creator A5015266968 @default.
• W2013853691 creator A5018440631 @default.
• W2013853691 creator A5046442858 @default.
• W2013853691 creator A5048221568 @default.
• W2013853691 creator A5054557581 @default.
• W2013853691 creator A5090438506 @default.
• W2013853691 date "2010-08-01" @default.
• W2013853691 modified "2023-10-06" @default.
• W2013853691 title "Different Roles of G Protein Subunits β1 and β2 in Neutrophil Function Revealed by Gene Expression Silencing in Primary Mouse Neutrophils" @default.
• W2013853691 cites W1578383688 @default.
• W2013853691 cites W1584766640 @default.
• W2013853691 cites W1965881928 @default.
• W2013853691 cites W1967008325 @default.
• W2013853691 cites W1967818875 @default.
• W2013853691 cites W1967991961 @default.
• W2013853691 cites W1968599777 @default.
• W2013853691 cites W1986045329 @default.
• W2013853691 cites W1999124123 @default.
• W2013853691 cites W2009528216 @default.
• W2013853691 cites W2011502022 @default.
• W2013853691 cites W2013997965 @default.
• W2013853691 cites W2014172202 @default.
• W2013853691 cites W2038593831 @default.
• W2013853691 cites W2047404721 @default.
• W2013853691 cites W2058861059 @default.
• W2013853691 cites W2069375519 @default.
• W2013853691 cites W2070102480 @default.
• W2013853691 cites W2103108718 @default.
• W2013853691 cites W2113752602 @default.
• W2013853691 cites W2133891056 @default.
• W2013853691 cites W2133898735 @default.
• W2013853691 cites W2141080862 @default.
• W2013853691 cites W2143094150 @default.
• W2013853691 cites W2151514508 @default.
• W2013853691 cites W2507092497 @default.
• W2013853691 cites W32944084 @default.
• W2013853691 doi "https://doi.org/10.1074/jbc.m110.142885" @default.
• W2013853691 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2915716" @default.
• W2013853691 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/20525682" @default.
• W2013853691 hasPublicationYear "2010" @default.
• W2013853691 type Work @default.
• W2013853691 sameAs 2013853691 @default.
• W2013853691 citedByCount "24" @default.
• W2013853691 countsByYear W20138536912012 @default.
• W2013853691 countsByYear W20138536912013 @default.
• W2013853691 countsByYear W20138536912014 @default.
• W2013853691 countsByYear W20138536912015 @default.
• W2013853691 countsByYear W20138536912016 @default.
• W2013853691 countsByYear W20138536912017 @default.
• W2013853691 countsByYear W20138536912019 @default.
• W2013853691 countsByYear W20138536912020 @default.
• W2013853691 countsByYear W20138536912021 @default.
• W2013853691 countsByYear W20138536912023 @default.
• W2013853691 crossrefType "journal-article" @default.
• W2013853691 hasAuthorship W2013853691A5015266968 @default.
• W2013853691 hasAuthorship W2013853691A5018440631 @default.
• W2013853691 hasAuthorship W2013853691A5046442858 @default.
• W2013853691 hasAuthorship W2013853691A5048221568 @default.
• W2013853691 hasAuthorship W2013853691A5054557581 @default.
• W2013853691 hasAuthorship W2013853691A5090438506 @default.
• W2013853691 hasBestOaLocation W20138536911 @default.
• W2013853691 hasConcept C104317684 @default.
• W2013853691 hasConcept C119056186 @default.
• W2013853691 hasConcept C14036430 @default.
• W2013853691 hasConcept C150194340 @default.
• W2013853691 hasConcept C153911025 @default.
• W2013853691 hasConcept C185592680 @default.
• W2013853691 hasConcept C54355233 @default.
• W2013853691 hasConcept C6856738 @default.
• W2013853691 hasConcept C86803240 @default.
• W2013853691 hasConcept C95444343 @default.
• W2013853691 hasConceptScore W2013853691C104317684 @default.
• W2013853691 hasConceptScore W2013853691C119056186 @default.
• W2013853691 hasConceptScore W2013853691C14036430 @default.
• W2013853691 hasConceptScore W2013853691C150194340 @default.
• W2013853691 hasConceptScore W2013853691C153911025 @default.
• W2013853691 hasConceptScore W2013853691C185592680 @default.
• W2013853691 hasConceptScore W2013853691C54355233 @default.
• W2013853691 hasConceptScore W2013853691C6856738 @default.
• W2013853691 hasConceptScore W2013853691C86803240 @default.
• W2013853691 hasConceptScore W2013853691C95444343 @default.
• W2013853691 hasIssue "32" @default.
• W2013853691 hasLocation W20138536911 @default.
• W2013853691 hasLocation W20138536912 @default.
• W2013853691 hasLocation W20138536913 @default.
• W2013853691 hasLocation W20138536914 @default.
• W2013853691 hasOpenAccess W2013853691 @default.
• W2013853691 hasPrimaryLocation W20138536911 @default.
• W2013853691 hasRelatedWork W2009966535 @default.
• W2013853691 hasRelatedWork W2056172754 @default.
• W2013853691 hasRelatedWork W2358664065 @default.
• W2013853691 hasRelatedWork W2373539659 @default.
• W2013853691 hasRelatedWork W2393232383 @default.
• W2013853691 hasRelatedWork W2508597590 @default.
• W2013853691 hasRelatedWork W2567019417 @default.
• W2013853691 hasRelatedWork W2632572137 @default.

• next