FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2014141526> ?p ?o ?g. }

• W2014141526 endingPage "11561" @default.
• W2014141526 startingPage "11553" @default.
• W2014141526 abstract "A number of cytokines that finely regulate immune response have been implicated in the pathogenesis or protection of type 1 diabetes and other autoimmune diseases. It is, therefore, of pivotal importance to examine a family of proteins that serve as signal transducers and activators of transcription (STATs), which regulate the transcription of a variety of cytokines. We report here a defective gene (Stat5b) located on chromosome 11 within a previously mapped T1D susceptibility interval (Idd4) in the nonobese diabetic (NOD) mice. Our sequencing analysis revealed a unique mutation C1462A that results in a leucine to methionine (L327M) in Stat5b of NOD mice. Leu327, the first residue in the DNA binding domain of STAT proteins, is conserved in all identified mammalian STAT proteins. Homology modeling predicted that the mutant Stat5b has a weaker DNA binding, which was confirmed by DNA-protein binding assays. The inapt transcriptional regulation ability of the mutated Stat5b is proved by decreased levels of RNA of Stat5b-regulated genes (IL-2Rβ and Pim1). Consequently, IL-2Rβ and Pim1 proteins were shown by Western blotting to have lower levels in NOD compared with normal B6 mice. These proteins have been implicated in immune regulation, apoptosis, activation-induced cell death, and control of autoimmunity. Therefore, the Stat5b pathway is a key molecular defect in NOD mice. A number of cytokines that finely regulate immune response have been implicated in the pathogenesis or protection of type 1 diabetes and other autoimmune diseases. It is, therefore, of pivotal importance to examine a family of proteins that serve as signal transducers and activators of transcription (STATs), which regulate the transcription of a variety of cytokines. We report here a defective gene (Stat5b) located on chromosome 11 within a previously mapped T1D susceptibility interval (Idd4) in the nonobese diabetic (NOD) mice. Our sequencing analysis revealed a unique mutation C1462A that results in a leucine to methionine (L327M) in Stat5b of NOD mice. Leu327, the first residue in the DNA binding domain of STAT proteins, is conserved in all identified mammalian STAT proteins. Homology modeling predicted that the mutant Stat5b has a weaker DNA binding, which was confirmed by DNA-protein binding assays. The inapt transcriptional regulation ability of the mutated Stat5b is proved by decreased levels of RNA of Stat5b-regulated genes (IL-2Rβ and Pim1). Consequently, IL-2Rβ and Pim1 proteins were shown by Western blotting to have lower levels in NOD compared with normal B6 mice. These proteins have been implicated in immune regulation, apoptosis, activation-induced cell death, and control of autoimmunity. Therefore, the Stat5b pathway is a key molecular defect in NOD mice. Studies on the NOD mouse model that spontaneously develops T1D have shown that both B and T cells are necessary for the development of the disease (1Akashi T. Nagafuchi S. Anzai K. Kondo S. Kitamura D. Wakana S. Ono J. Kikuchi M. Niho Y. Watanabe T. Int. Immunol. 1997; 9: 1159-1164Crossref PubMed Scopus (154) Google Scholar, 2Christianson S.W. Shultz L.D. Leiter E.H. Diabetes. 1993; 42: 44-55Crossref PubMed Google Scholar, 3Noorchashm H. Noorchashm N. Kern J. Rostami S.Y. Barker C.F. Naji A. Diabetes. 1997; 46: 941-946Crossref PubMed Scopus (221) Google Scholar, 4Serreze D.V. Chapman H.D. Varnum D.S. Hanson M.S. Reifsnyder P.C. Richard S.D. Fleming S.A. Leiter E.H. Shultz L.D. J. Exp. Med. 1996; 184: 2049-2053Crossref PubMed Scopus (504) Google Scholar). Other immune cells such as macrophages and dendritic cells have also been implicated in the disease process (5Yoon J.W. Jun H.S. Ann. N. Y. Acad. Sci. 2001; 928: 200-211Crossref PubMed Scopus (110) Google Scholar). Despite extensive studies on this animal model, the underlying molecular mechanisms that lead to the development and progression of T1D still remain elusive. The involvement of cytokines that finely regulate immune and hematopoietic systems in the pathogenesis of diabetes has been an area of intense research. A pathogenic role for interferon-α, interferon-γ, IL-2, 1The abbreviations used are: IL, interleukin; STAT, signal transducers and activators of transcription; GM-CSF, granulocyte-macrophage colony-stimulating factor; PBS, phosphate-buffered saline; EMSA, electrophoretic mobility shift assay; NOD, nonobese diabetic; FITC, fluorescein isothiocyanate; CREB, cAMP-response-binding protein; OB-R, obese receptor. and IL-l0 has been suggested in T1D development in contrast to a protective role for IL-4, IL-6, and tumor necrosis factor α (6Goudy K. Song S. Wasserfall C. Zhang Y.C. Kapturczak M. Muir A. Powers M. Scott-Jorgensen M. Campbell-Thompson M. Crawford J.M. Ellis T.M. Flotte T.R. Atkinson M.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13913-13918Crossref PubMed Scopus (121) Google Scholar, 7Rabinovitch A. Suarez-Pinzon W.L. Biochem. Pharmacol. 1998; 55: 1139-1149Crossref PubMed Scopus (425) Google Scholar, 8Rabinovitch A. Diabetes Metab. Rev. 1998; 14: 129-151Crossref PubMed Scopus (421) Google Scholar, 9Zhang Y.C. Pileggi A. Agarwal A. Molano R.D. Powers M. Brusko T. Wasserfall C. Goudy K. Zahr E. Poggioli R. Scott-Jorgensen M. Campbell-Thompson M. Crawford J.M. Nick H. Flotte T. Ellis T.M. Ricordi C. Inverardi L. Atkinson M.A. Diabetes. 2003; 52: 708-716Crossref PubMed Scopus (89) Google Scholar). Since the link between cytokines and T1D is indisputable, it becomes obligatory to examine the cytokine signaling pathways in relation to the disease. Studies of transcriptional activation by interferons and a variety of cytokines have led to the identification of a family of proteins that serve as signal transducers and activators of transcription (STATs). There are seven identified members in this important family of proteins (Statl to Stat4, Stat5a, Stat5b, and Stat6). Upon activation by a large number of cytokines, growth factors, and hormones, STAT proteins are phosphorylated via the Janus kinases, dimerize, translocate to the nucleus, and bind to the promoters of specific target genes (10Chatterjee-Kishore M. van den A.F. Stark G.R. Trends Cell Biol. 2000; 10: 106-111Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 11Hoey T. Schindler U. Curr. Opin. Genet. Dev. 1998; 8: 582-587Crossref PubMed Scopus (86) Google Scholar, 12Horvath C.M. Trends Biochem. Sci. 2000; 25: 496-502Abstract Full Text Full Text PDF PubMed Scopus (409) Google Scholar, 13Imada K. Leonard W.J. Mol. Immunol. 2000; 37: 1-11Crossref PubMed Scopus (486) Google Scholar). STAT proteins regulate the expression of a large number of cytokines and their receptors as well as other important molecules involved in immune regulation. In mice, the genes encoding Stat3, Stat5a, and Stat5b map to chromosome 11 (14Copeland N.G. Gilbert D.J. Schindler C. Zhong Z. Wen Z. Darnell Jr., J.E. Mui A.L. Miyajima A. Quelle F.W. Ihle J.N. Jenkins N.A. Genomics. 1995; 29: 225-228Crossref PubMed Scopus (168) Google Scholar) within a previously defined Idd4 interval (15McDuffie M. Clin. Immunol. 2000; 96: 119-130Crossref PubMed Scopus (28) Google Scholar). All of the correlative pieces of information led us to explore a plausible connection between T1D and Stat genes on chromosome 11. This study attempted to use the positional candidate gene approach to test the hypothesis whether functionally chosen candidate genes in the proximity of previously mapped T1D susceptibility intervals are implicated in the disease. We report the identification of a mutation within the DNA binding domain of Stat5b in NOD, which results in diminished DNA binding affinity of Stat5b and reduced expression of downstream genes bearing the Stat5b consensus in their promoter regions. Ten-week-old female mice of six strains including C57B1/6J (B6) and NOD/LtJ (NOD), C3H, NZW, BALB/c, and CBA were obtained from our mouse colony at the University of Florida. Total RNA samples were prepared from spleen cells using standard methods. A subset of mice was induced with 0.5 μg (1 μg/ml) of GM-CSF in PBS with 0.1% bovine serum albumin through intraperitoneal injection. After 20 min of induction, the animals were sacrificed, and tissues were immediately snap-frozen in liquid nitrogen and then stored at -80 °C. Sham-treated controls were injected with 500 μl of 0.1% bovine serum albumin in 0.2-μm filtered PBS (Invitrogen) and sacrificed after 20 min as above. Nuclear and cytoplasmic extracts from spleens were prepared using the method described by Galsgaard et al. (16Galsgaard E.D. Gouilleux F. Groner B. Serup P. Nielsen J.H. Billestrup N. Mol. Endocrinol. 1996; 10: 652-660Crossref PubMed Scopus (91) Google Scholar) with minor modifications. Briefly, tissues were homogenized on ice in hypotonic buffer A (20 mm HEPES, pH 7.9, 10 mm KCl, 1 mm MgCl2, 1 mm EDTA, 1 mm dithiothreitol, 1 mm Na3VO4, 20% glycerol, 1% Triton X-100, 200 μm phenylmethylsulfonyl fluoride, 1 ml/100 ml of phosphatase/inhibitor mixture I, complete Mini protease inhibitor mixture tablet (2 tablets/100 ml). Homogenate was kept for 30 min on ice, and then nuclei were collected by centrifugation at 16,000 rpm at 4 °C for 30 min. Supernatants containing cytosolic protein were transferred to clean tubes and stored at -80 °C for further use. Nuclear protein was extracted from pellets by adding hypertonic buffer B (buffer A with 400 mm NaCl). Each tube was vigorously vortexed for 2 min and then sonicated for 3 s at 18 watts. After centrifugation, 50-μl aliquots of the supernatant (nuclear extract) were made and stored at -80 °C. Protein concentration was measured using the Bio-Rad protein assay. The entire coding sequence of the Stat5b gene was amplified by PCR in two rounds. The first PCR amplification for Stat5b was carried out with two outside primers: Mstat5b-453F (CACGCGATTCGGGCTCTG) and Mstat5b-2900R (GAAGCGATTCATGGAATTAAAA). The amplified PCR products were then used as templates for nested PCR amplifications. Two overlapping fragments were amplified using two primer pairs: Mstat5b-472F (AGGTGGTGAACCATGGCTAT) and Mstat5b-1746R (CAGACCTCTTGATTCGTTTC) for the 5′ fragment and Mstat5b-1591F (AAGGCGACCATCATCAGC) and Mstat5b-2875R (AGGAAGTTCCTCCACGAG) for the 3′ fragment. The entire coding region of the Stat3 gene was amplified by reverse transcription-PCR in two rounds. In the first round of PCR amplification, 2 μl of cDNA was used as a template using primers Mstat3-9-F (5′-TGG ACA CAC GCT ACC TGA AG-3′) and Mstat3-1261-R (CAG GCT GCC GTT GTT AGA CT). The amplified PCR products were then used for the second round of PCR amplifications using the following primer pair: Mstat3-1020-F (AAG AGT GCC TTC GTG GTG GA) and Mstat3–25l0-R (GCC CAA AGA TAG CAG AAG TAG). The primers used for amplifying Stat5a in the first round are mStat5A-13F (5′-GTC AAG AGC CGT CAG GAG-3′) and mStat5A-2556R (GAA ACG TGC AAA GCC ATT GTT). The second round of PCR amplification was done with mStat5A-43F (CCG GCC TGG AGC GAC AAG) and mStat5A-1328R (TTT CTG AAG TGG GCG CTG A) and also mStat5A-1200F (GAA GGC GAC CAT CAT CAG C) and mStat5A-25l2R (GAC GTG GGC TCC TCA CAC TG). The nested PCR products were subjected to direct DNA sequencing using a PerkinElmer 377 automated DNA sequencer. Stat5b consensus sequence (5′-TTTCTAGGAATT-3′) was used for EMSAs, whereas the mutant oligonucleotide 5′-TTTAGTTTAATT-3′ was used as a competitor. Complementary oligonucleotides were used to make double strand DNA, which was end-labeled using 170 μCi of [γ-32P]ATP and T4 polynucleotide kinase. Unincorporated isotope was removed using the QIAquick nucleotide removal kit. Labeled oligonucleotides with a count of ∼30,000 cpm were used for EMSA. An equal amount of nuclear protein extract (5 μg) was incubated with double strand oligonucleotides (consensus/mutant) at room temperature for 20 min in a binding buffer (13 mm HEPES, pH 7.9, 80 mm NaCl, 8% glycerol, 0.15 mm EDTA, 1 mm dithiothreitol) (17Storz P. Doppler H. Pfizenmaier K. Muller G. FEBS Lett. 1999; 464: 159-163Crossref PubMed Scopus (33) Google Scholar) and in the presence of poly(dI-dC) (2.5 μg/μl). For competition studies, 10-fold of unlabeled double-stranded oligonucleotide was added in the preincubation step. For supershift assay, the protein extract was first incubated with 0.8 μg of antibody for 20 min at room temperature. Oligonucleotide was then added, and the reaction continued for another 30 min at room temperature. The anti-Stat3 (SC-482X), anti-Stat5a (SC-1081X), anti-Stat5b (SC-835X), and anti-Nmi (sc-9484X) antibodies are rabbit polyclonal antibodies from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). DNA-protein complexes were resolved on a 5% nondenaturing gel containing 5% glycerol and 0.5× TBE. The gels were prerun in 0.5× TBE for 30 min at 150 V. 2 μl of loading mix (40% sucrose, 0.25% bromphenol blue, 0.25% xylene cyanol) was added to each sample before loading. The gels were run at 250 mV for the first 15 min and then at constant 150 mV for about 4 h. The gels were exposed to x-ray films and then kept at -80 °C for at least 48 h. A new microbeads-based assay was developed with the Luminex system (Luminex Corp.) to study DNA-protein interaction. Briefly, oligonucleotides with a biotin group at the 5′-end were immobilized on Lumavidin 6 microspheres (20 nm/250,000 beads) using a standard conjugation protocol recommended by the manufacturer. The assays were conducted by employing 10,000 oligonucleotide-conjugated beads in a 100-μl reaction containing 13 mm HEPES, 80 mm NaCl, 8% glycerol, 0.15 mm EDTA, 1 mm dithiothreitol, pH 7.9, and 5 μg of protein extracts (or peptide). The reaction was incubated for 1 h at room temperature. The microspheres were pelleted down by centrifugation at 14000 × g for 2 min, washed, and reconstituted in 100 μl of fresh reaction buffer. The reaction was incubated for 1 h with anti-Stat5b antibody (4 μl/100-μl reaction). Once again, the microspheres were pelleted, washed, and resuspended as above. The bound Stat5b antibody was probed with Cy3-labeled anti-rabbit IgG and was detected on a Luminex 100 Flowmetrics system (excitation wavelength 532 nm). The signals originating from the Cy3-labeled secondary antibody reflect the amount of Stat5b protein captured by the oligonucleotides on the beads. We scored 5000 beads for each assay, and the mean fluorescence intensities were computed. The experiment was repeated three times, and the results were averaged. Two peptides were also used in the DNA protein binding assay. These peptides correspond to the DNA binding region (including the mutation L327M) of wild type Stat5b (DIISALVTSTFIIEKQPPQVLK) and mutant (NOD) Stat5b (DIISAMVTSTFIIEKQPPQVLK) and were purchased from New England Peptide, Inc. Cytosolic or nuclear proteins were diluted 1:4 with Laemmli sample buffer, and an equal amount of protein (10 μg) from each sample was loaded onto a running gel (pH 8.3) of various concentrations with a 4% stacking gel (pH 6.8). Gels were run on a MiniProtean III vertical electrophoresis system (Bio-Rad) at 100 V for 3 h. The separated proteins were processed for transfer onto Sequiblot polyvinylidene difluoride (0.2 μm; Bio-Rad). For this, the gels were assembled in a transfer module, and the proteins were transferred onto a polyvinylidene difluoride membrane prewet in methanol and equilibrated in transfer buffer (25 mm Tris, 190 mm glycine (pH 8.2), 40% methanol (v/v)) using a Mini Transblot cell (Bio-Rad). The transfer was performed at 15-mA constant current for each membrane for 12–16 h. The blots were developed by the ECL method. For this, the polyvinylidene difluoride membranes were prewet in methanol, washed two times for 5 min into 1× phosphate-buffered saline with 0.1% Tween, followed by blocking (Super Block; Pierce) for 60 min at room temperature with gentle shaking. The membranes were washed five times in PBS-T and incubated for 1 h with optimal concentrations of primary antibodies. After incubation, the membranes were extensively washed five times (5 min each) in PBS-T and then incubated for 60 min with horseradish peroxidase-conjugated secondary antibodies. Visualization was performed using the ECL kit as per the manufacturer's protocol (Amersham Biosciences). Antibodies used in immunoblotting studies were as follows: anti-Stat5b (sc-835), Jak2 (sc-294), Erk-2 (sc-154), IL-2R-β (sc-672), Pim1 (sc-13513), Bag-1 (sc-940), Mcl-1 (sc-958), Bcl-2 (sc-492), and phosphatidylinositol 3-kinase p85α (sc-423) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), phosphorylated Stat5b antibody from Upstate Biotechnology (05-495), and Tyk-2 from BIOSOURCE (catalog no. 44-418). Spleen Smear Preparation—Experimental and sham-treated control subsets were prepared as detailed above. Spleen was excised, detached of adhering fat, washed in Hanks' balanced salt solution (Invitrogen), and ground between two frosted glass plates in 10 ml of Hanks' balanced salt solution buffer and collected in 15-ml sterile tubes. 1 ml of RBC lysis buffer (Sigma) was added, and the cells were shaken gently on a rocker for 1 min. The cells were transferred in a centrifuge tube and sedimented by gravity for 10 min. The supernatant was aspirated and centrifuged for 7 min at 2000 rpm. The pellet was reconstituted in 1 ml of Hanks' balanced salt solution. The cell density was adjusted to 1 × 106 cells/ml. 50 μl of cells were smeared on polylysine-coated slides. The spleen smear slides were fixed in 4% paraformaldehyde by incubation for 30 min. They were air-dried in a hood and store at 4 °C in a slide box. Immunohistochemistry of Spleen Cells—Immunocytochemistry of spleen smears was done as previously described (18Saxena D. Purohit S.B. Kumer G.P. Laloraya M. Nitric Oxide. 2000; 4: 384-391Crossref PubMed Scopus (45) Google Scholar). The fixed spleen smears were washed with PBS-T (0.1% Tween 20) (three washings, 10 min each), neutralized in 50 mm NH4Cl, and permeabilized in 0.25% Triton X-100 followed by blocking in 5% normal goat serum for 2 h. The smears were then incubated with primary antibody, viz. anti-Stat5b rabbit polyclonal (sc-835) from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) (1:200 dilution for 12–18 h). The smears were washed three times for 10 min each and subsequently treated with the relevant secondary antibody, viz. goat anti-rabbit IgG FITC (BG FITC-2) from Bangalore Genei, India (1:200 dilution) for 60 min. The smears were washed three times for 10 min each and processed for nuclear staining by incubating in a 1:1000 dilution of a 1 mg/ml solution of 4′,6-diamidino-2-phenylindole-dihydrochloride hydrate for 15 min. The fluorescence was observed using an excitation wavelength of 450–490 nm with a Nikon B-2A filter for FITC conjugates and a 355–375-nm excitation wavelength with a Nikon UV-1A filter for 4′,6-diamidino-2-phenylindole. The results were observed under a Nikon epifluorescence microscope, and the images were captured and documented by the COOL SNAP camera and the Documentation System from Alpha Innotech Corp. Northern blot was carried out as described previously (19Wilson K.H. Eckenrode S.E. Li Q.Z. Ruan Q.G. Yang P. Shi J.D. Davoodi-Semiromi A. McIndoe R.A. Croker B.P. She J.X. Diabetes. 2003; 52: 2151-2159Crossref PubMed Scopus (55) Google Scholar). In brief, 15 μg of total RNA was loaded onto 1.5% agarose gel containing 20% formaldehyde. Electrophoresis was carried out at 150 V for 3 h, and then the gel was blotted to the BrightStar membrane (Ambion) in 20× SSC buffer for overnight. The RNA was cross-linked to the membrane using Crosslinker (Stratagene) according to the manufacturer's instructions. Prehybridization and hybridization were carried out at 42 °C using UltraHyb buffer (Ambion). 3 μg of total RNA was converted to the cDNA by reverse transcriptase and diluted 1:1 by TE buffer. 2 μl of diluted cDNA was used for PCR amplification of the Il-2Rβ and Pim1 genes. The primers for IL-2Rβ are a forward primer (5′-GGATGCCGGAAGGTGATG) and a reverse primer (5′-AGGCAGGTACAGGAAGCTA). The primers for PIM1 are a forward primer (5′-GTGAGCTCGGACTTCTCG) and a reverse primer (5′-GATGGTAGCGAATCCACTCT). The PCR products were loaded onto 2% agarose gel, and then the DNA was recovered from the gel using the Qiaquick gel extraction kit (Qiagen). The purified PCR products were labeled with 32P with a random labeling kit (Stratagene), and unincorporated isotope was purified by a SigmaSpin postreaction purification column (Sigma). An initial search for templates for homology modeling of Stat5b was carried out using FASTA-CHECK. The search produced two closely similar templates: 1 BF5 (the crystal structure of Statl) and 1BGF (the N terminus of Stat4). A model for the Stat5b-DNA complex was generated by threading the murine Stat5b protein sequence into the crystal coordinates of these two model templates using LOOK II (Molecular Applications Group). The model was energy-minimized using the DISCOVER module of INSIGHT-II (Molecular Simulations Group). The fit was verified by WHAT-IF and PROCHECK 2.0. A mutation of L327M was introduced by the MUTATE function of SWISS-MODEL, and the model was once again energy-minimized. The local field energy around the amino acid at position 327 was mapped before and after the introduction of the mutation. Sequencing of Stat Genes on Chromosome 11—Three candidate genes within the Idd4 interval on chromosome 11 (Stat3, Stat5a, and Stat5b) were sequenced in NOD and C57BL/6 (B6). Three nucleotide positions in Stat3 and two in Stat5a of both B6 and NOD mice differ from the published sequences (Table I). Since there is no difference between NOD and B6, they are unlikely candidates for diabetes susceptibility factors. Three alterations in Stat5b at positions 433 (G→ A), 767 (G→ C) and 768 (C→ G) are considered as polymorphisms, since they are present in both B6 and NOD animals. Two of the three nucleotide changes are silent mutations. A point mutation (C1462A) in the NOD leads to a substitution of leucine to methionine at position 327 (L327M), the first amino acid of the DNA binding domain of the STAT proteins (Fig. 1, A and B). This mutation was not found in the five control strains (B6, C3H, NZW, BALB/c, and CBA). The Leu327 residue is conserved in all STAT proteins sequenced to date.Table IMutations found in the Stat3, Stat5a, and Stat5b genes Mutations are shown in boldface type.GeneCodonPublishedNODB6EffectStat316AAG/LysGAG/GluGAG/GluAmino acid change25ACG/ThrAGC/GluAGC/GluAmino acid change518CGA/ArgCGG/ArgCGG/ArgSilentStat5a190GGA/GlyGGC/GlyGGC/GlySilent527AAG/LysAAA/LysAAA/LysSilentStat5b327CTG/LeuATG/MetCTG/LeuChange in NOD433GGG/GlyGAG/GluGAG/GluAmino acid change767CGG/ArgCGC/ArgCGC/ArgSilent768GTC/ValGTG/ValGTG/ValSilent Open table in a new tab The potential impact of the L327M mutation on the DNA binding ability of Stat5b was assessed by homology modeling for the wild type and mutant Stat5b. As shown in Fig. 1C, leucine 327 (yellow residue) of the wild type Stat5b establishes contacts with the palindromic DNA binding sequence (TTCN3GAA) at the TT positions. The replacement of leucine with methionine (green residue in Fig. 1D) increases the side chain volume and the bulk hydrophobicity around the critical contact point. The local energy values drift from +185 kJ/mol to -33 kJ/mol when methionine replaces leucine. This change would abolish the side chain interdigitation between Leu327 and the thymidine. This introduces a spatial barrier between the Met327 side chain and the thymidine residue (Fig. 1D), which would reduce the ability of methionine to interact with the DNA sequence. Therefore, the mutant Stat5b is predicted to exhibit a weaker DNA binding affinity. DNA Binding Affinity of Stat5b—The DNA binding ability was compared between the wild type (B6) and mutant (NOD) Stat5b using an EMSA. Protein extracts from the cytosolic and nuclear fractions were prepared from splenocytes with and without in vivo stimulation with GM-CSF. Western blot with anti-Stat5b antibody showed that the levels of cytosolic fraction, phosphorylated cytosolic fraction, and nuclear Stat5b are comparable in NOD and B6 (Fig. 2A). These results are complemented with immunocytochemical analysis showing similar cytosolic and nuclear Stat5b levels in spleen cells from B6 and NOD mice (Fig. 2B). Consistently, similar levels of proteins were found in NOD and B6 for the upstream mediators for the activation of Stat5b including the Jak2, tyrosine kinase 2 (Tyk2), and extracellular signal-regulated kinases (Erkl and Erk2) involved in phosphorylation of STATs (Fig. 2C). Nuclear extracts were used in EMSA with the consensus DNA sequence recognized by Stat5 proteins (20Gouilleux F. Pallard C. Dusanter-Fourt I. Wakao H. Haldosen L.A. Norstedt G. Levy D. Groner B. EMBO J. 1995; 14: 2005-2013Crossref PubMed Scopus (333) Google Scholar). Both B6 and NOD animals showed strong gel shift with the Stat5 consensus sequence in the samples stimulated with GM-CSF as compared with a negligible shift in the unstimulated preparations (Fig. 3A). A supershift assay using polyclonal anti-Stat5b antibody showed that the Stat5b-specific DNA-protein complexes are about 5-fold higher in B6 than NOD mice (Fig. 3A, lane 5 versus lane 9). It is important to note that NOD nuclear extracts bound the Stat consensus represented by the shift position in Fig. 3A, lane 8. The Stat5b-specific DNA binding is attributable only to the supershifted band. An explanation for the weaker supershifted band could simply be that the antibody does not recognize the NOD form of Stat5b with the same affinity as the B6 form. This does not appear to hold any validity, since in all Western blots the same antibody recognized Stat5b in cytosolic and nuclear extracts with the same affinity, and no differences in the quantities of Stat5b were detectable (Fig. 2A), thus indicating that antigen-antibody binding is not affected by the mutation. Our immunofluorescence data in spleen cells for Stat5b levels show similar quantities in the cytosol and in the nucleus in both B6 and NOD. Once again, this suggests that the antigen-antibody binding is more or less unaffected by the mutation. Additionally, our combined Western and immunofluorescence data suggest similar nuclear export of the protein in both of these models. The antibody sc-835 (Santa Cruz Biotechnology) has been extensively used by others in analyzing Stat5b-specific supershifts (21Zhou Y.C. Waxman D.J. J. Biol. Chem. 1999; 274: 29874-29882Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 22Zhou Y.C. Waxman D.J. J. Biol. Chem. 1999; 274: 2672-2681Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). The specificity of the gel shift assay was confirmed using competition with mutated DNA and cold consensus oligonucleotide. The addition of a 10-fold molar excess of cold consensus oligonucleotide caused a complete disruption of the Stat5-DNA complex in extracts from both B6 and NOD mice, signifying the specificity of the interaction (Fig. 3B, lanes 3 and 6). Further, the use of a hot mutant Stat5b consensus with base replacements at underlined positions 5′-TTAGTTTAA-3′ also showed the inability of the mutant oligonucleotide to bind to the Stat5b protein from B6 and NOD nuclear extracts (Fig. 3B, lanes 4 and 7), confirming the specificity of the binding. Supershift assays with antibodies against Stat5a and Stat3, which may be associated with Stat5b (23Al Shami A. Mahanna W. Naccache P.H. J. Biol. Chem. 1998; 273: 1058-1063Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), indicated that the Stat5b complexes do not contain Stat5a (Fig. 3C, lanes 2 and 4) or Stat3 (Fig. 3C, lanes 6 and 8). Together, these results indicate that the weaker Stat5b-specific supershifted complexes in NOD mice were attributable to the impaired DNA binding of the mutant protein. These data are consistent with previous observations that mutations within the DNA-binding region result in Stat proteins that are activated normally but have greatly reduced DNA binding (24Boucheron C. Dumon S. Santos S.C. Moriggl R. Hennighausen L. Gisselbrecht S. Gouilleux F. J. Biol. Chem. 1998; 273: 33936-33941Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar, 25Horvath C.M. Wen Z. Darnell Jr., J.E. Genes Dev. 1995; 9: 984-994Crossref PubMed Scopus (452) Google Scholar, 26Imada K. Bloom E.T. Nakajima H. Horvath-Arcidiacono J.A. Udy G.B. Davey H.W. Leonard W.J. J. Exp. Med. 1998; 188: 2067-2074Crossref PubMed Scopus (279) Google Scholar, 27Schindler U. Wu P. Rothe M. Brasseur M. McKnight S.L. Immunity. 1995; 2: 689-697Abstract Full Text PDF PubMed Scopus (233) Google Scholar). The coexistence of other proteins along with Stat5b-DNA complex has been reported. N-Myc interactor (Nmi) is identified as a Stat-interacting partner using a yeast two-hybrid assay. It also enhances the association of CREB-binding protein/p300 coactivator proteins with Stat1 and Stat5 and, together with CREB-binding protein/p300, augments IL-2 and interferon γ-dependent transcription. Thus, Nmi potentiates STAT-dependent transcription and can also augment coactivator protein recruitment to at least some members of a group of sequence-specific transcription factors (28Zhu M. John S. Berg M. Leonard W.J. Cell. 1999; 96: 121-130Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar). In order to understand the nature of the nonsupershifted band, we checked whether it can be supershifted using Nmi. The lack of coexistence of Nmi in the protein-DNA complex is also evident from the inability of anti-Nmi to supershift the shifted complex (Fig. 3C, lanes 10 and 12). Thus, we excluded the presence of Stat5a, Stat3, and Nmi in the protein-DNA complex. Centrosomal P4.1-associated protein has recently been shown to specifically interact with Stat5a and Stat5b but not with Stat1 or Stat3 using yeast two-hybrid screen of HBL" @default.
• W2014141526 created "2016-06-24" @default.
• W2014141526 creator A5023382152 @default.
• W2014141526 creator A5034338275 @default.
• W2014141526 creator A5039836803 @default.
• W2014141526 creator A5043626724 @default.
• W2014141526 creator A5079422661 @default.
• W2014141526 creator A5081821452 @default.
• W2014141526 date "2004-03-01" @default.
• W2014141526 modified "2023-09-27" @default.
• W2014141526 title "A Mutant Stat5b with Weaker DNA Binding Affinity Defines a Key Defective Pathway in Nonobese Diabetic Mice" @default.
• W2014141526 cites W1578727637 @default.
• W2014141526 cites W1975989506 @default.
• W2014141526 cites W1981962083 @default.
• W2014141526 cites W1990487773 @default.
• W2014141526 cites W1990503476 @default.
• W2014141526 cites W2000208875 @default.
• W2014141526 cites W2002220979 @default.
• W2014141526 cites W2003126387 @default.
• W2014141526 cites W2004068229 @default.
• W2014141526 cites W2019075331 @default.
• W2014141526 cites W2020077884 @default.
• W2014141526 cites W2021741673 @default.
• W2014141526 cites W2024591653 @default.
• W2014141526 cites W2029999922 @default.
• W2014141526 cites W2031156245 @default.
• W2014141526 cites W2032770280 @default.
• W2014141526 cites W2036767096 @default.
• W2014141526 cites W2037729255 @default.
• W2014141526 cites W2039975110 @default.
• W2014141526 cites W2040243535 @default.
• W2014141526 cites W2058857909 @default.
• W2014141526 cites W2059660229 @default.
• W2014141526 cites W2060105709 @default.
• W2014141526 cites W2064399596 @default.
• W2014141526 cites W2072992083 @default.
• W2014141526 cites W2073634236 @default.
• W2014141526 cites W2075612934 @default.
• W2014141526 cites W2077193261 @default.
• W2014141526 cites W2083162753 @default.
• W2014141526 cites W2087862745 @default.
• W2014141526 cites W2094899168 @default.
• W2014141526 cites W2095246256 @default.
• W2014141526 cites W2100599721 @default.
• W2014141526 cites W2101569271 @default.
• W2014141526 cites W2105410633 @default.
• W2014141526 cites W2112604002 @default.
• W2014141526 cites W2114449856 @default.
• W2014141526 cites W2114829414 @default.
• W2014141526 cites W2124870236 @default.
• W2014141526 cites W2129185311 @default.
• W2014141526 cites W2134837643 @default.
• W2014141526 cites W2155742277 @default.
• W2014141526 cites W2173560213 @default.
• W2014141526 cites W2320732213 @default.
• W2014141526 cites W63837087 @default.
• W2014141526 doi "https://doi.org/10.1074/jbc.m312110200" @default.
• W2014141526 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14701862" @default.
• W2014141526 hasPublicationYear "2004" @default.
• W2014141526 type Work @default.
• W2014141526 sameAs 2014141526 @default.
• W2014141526 citedByCount "38" @default.
• W2014141526 countsByYear W20141415262012 @default.
• W2014141526 countsByYear W20141415262013 @default.
• W2014141526 countsByYear W20141415262014 @default.
• W2014141526 countsByYear W20141415262015 @default.
• W2014141526 countsByYear W20141415262017 @default.
• W2014141526 countsByYear W20141415262018 @default.
• W2014141526 countsByYear W20141415262020 @default.
• W2014141526 countsByYear W20141415262021 @default.
• W2014141526 countsByYear W20141415262023 @default.
• W2014141526 crossrefType "journal-article" @default.
• W2014141526 hasAuthorship W2014141526A5023382152 @default.
• W2014141526 hasAuthorship W2014141526A5034338275 @default.
• W2014141526 hasAuthorship W2014141526A5039836803 @default.
• W2014141526 hasAuthorship W2014141526A5043626724 @default.
• W2014141526 hasAuthorship W2014141526A5079422661 @default.
• W2014141526 hasAuthorship W2014141526A5081821452 @default.
• W2014141526 hasBestOaLocation W20141415261 @default.
• W2014141526 hasConcept C104317684 @default.
• W2014141526 hasConcept C143065580 @default.
• W2014141526 hasConcept C153911025 @default.
• W2014141526 hasConcept C185592680 @default.
• W2014141526 hasConcept C18903297 @default.
• W2014141526 hasConcept C26517878 @default.
• W2014141526 hasConcept C501734568 @default.
• W2014141526 hasConcept C54355233 @default.
• W2014141526 hasConcept C552990157 @default.
• W2014141526 hasConcept C86803240 @default.
• W2014141526 hasConceptScore W2014141526C104317684 @default.
• W2014141526 hasConceptScore W2014141526C143065580 @default.
• W2014141526 hasConceptScore W2014141526C153911025 @default.
• W2014141526 hasConceptScore W2014141526C185592680 @default.
• W2014141526 hasConceptScore W2014141526C18903297 @default.
• W2014141526 hasConceptScore W2014141526C26517878 @default.
• W2014141526 hasConceptScore W2014141526C501734568 @default.
• W2014141526 hasConceptScore W2014141526C54355233 @default.
• W2014141526 hasConceptScore W2014141526C552990157 @default.

• next