FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2014205300> ?p ?o ?g. }

• W2014205300 endingPage "29920" @default.
• W2014205300 startingPage "29912" @default.
• W2014205300 abstract "Previous work has shown that the transcriptional regulator β-catenin can translocate to the nuclei when cells are stimulated with the type 1 insulin-like growth factor (IGF-1). We show by immunocoprecipitation and by confocal microscopy that β-catenin binds to and co-localizes with the insulin receptor substrate-1 (IRS-1), a docking protein for both the insulin and the IGF-1 receptors. IRS-1 is required for IGF-1-mediated nuclear translocation of β-catenin, resulting in the activation of the β-catenin target genes. IGF-1-mediated nuclear translocation of β-catenin is facilitated by the nuclear translocation of IRS-1. Both IRS-1 and β-catenin are recruited to the cyclin D1 promoter, an established target for β-catenin, but only IRS-1 is recruited to the ribosomal DNA (rDNA) promoter. UBF proteins (known to interact with both IRS-1 and β-catenin) are also detectable in the cyclin D1 and rDNA promoters. These results indicate that IRS-1 (activated by the IGF-1 receptor) is one of several proteins that regulate the subcellular localization and activity of β-catenin. The ability of IRS-1 to localize to both RNA polymerase II (with β-catenin) and RNA polymerase I-regulated promoters suggest an explanation for the effect of IRS-1 on both cell growth in size and cell proliferation. This possibility is supported by the demonstration that enforced nuclear localization of IRS-1 causes nuclear translocation of β-catenin and transformation of normal mouse embryo fibroblasts (colony formation in soft agar). Previous work has shown that the transcriptional regulator β-catenin can translocate to the nuclei when cells are stimulated with the type 1 insulin-like growth factor (IGF-1). We show by immunocoprecipitation and by confocal microscopy that β-catenin binds to and co-localizes with the insulin receptor substrate-1 (IRS-1), a docking protein for both the insulin and the IGF-1 receptors. IRS-1 is required for IGF-1-mediated nuclear translocation of β-catenin, resulting in the activation of the β-catenin target genes. IGF-1-mediated nuclear translocation of β-catenin is facilitated by the nuclear translocation of IRS-1. Both IRS-1 and β-catenin are recruited to the cyclin D1 promoter, an established target for β-catenin, but only IRS-1 is recruited to the ribosomal DNA (rDNA) promoter. UBF proteins (known to interact with both IRS-1 and β-catenin) are also detectable in the cyclin D1 and rDNA promoters. These results indicate that IRS-1 (activated by the IGF-1 receptor) is one of several proteins that regulate the subcellular localization and activity of β-catenin. The ability of IRS-1 to localize to both RNA polymerase II (with β-catenin) and RNA polymerase I-regulated promoters suggest an explanation for the effect of IRS-1 on both cell growth in size and cell proliferation. This possibility is supported by the demonstration that enforced nuclear localization of IRS-1 causes nuclear translocation of β-catenin and transformation of normal mouse embryo fibroblasts (colony formation in soft agar). The important roles played by β-catenin in adhesion, cancer, and development and its connections to Wnt and APC have been discussed in recent reviews (1Nelson W.J. Nusse R. Science. 2004; 303: 1483-1487Crossref PubMed Scopus (2242) Google Scholar, 2Polakis P. Genes Dev. 2000; 14: 1837-1851Crossref PubMed Google Scholar, 3Sharpe C. Lawrence N. Arias A.M. BioEssays. 2001; 23: 311-318Crossref PubMed Scopus (102) Google Scholar). Briefly, there is usually a large pool of β-catenin in the cytoplasm, where it is targeted for destruction by phosphorylation of the N terminus (2Polakis P. Genes Dev. 2000; 14: 1837-1851Crossref PubMed Google Scholar, 4Gao Z.H. Seeling J.M. Hill V. Jochum A. Virshup D.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1182-1187Crossref PubMed Scopus (192) Google Scholar). Under certain circumstances, for instance Wnt signaling, β-catenin is stabilized and transferred to the nuclei where it binds members of the family of T-cell factor/lymphoid enhancer factors (Tcf/Lef) and activates transcription of target genes (5Eastman Q. Grosschedl R. Curr. Opin. Cell Biol. 1999; 11: 233-240Crossref PubMed Scopus (474) Google Scholar, 6Korinek V. Barker N. Morin P.J. van Wichen D. de Weger R. Kinzler K.W. Vogelstein B. Clevers H. Science. 1997; 275: 1784-1787Crossref PubMed Scopus (2933) Google Scholar). Among genes regulated by β-catenin are c-myc (7He T.C. Sparks A.B. Rago C. Hermeking H. Zawel L. da Costa L.T. Morin P.J. Vogelstein B. Kinzler K.W. Science. 1998; 281: 1509-1512Crossref PubMed Scopus (4084) Google Scholar) and cyclin D1 (8Rowlands T.M. Pechenkina I.V. Hatsell H.J. Pestell R.G. Cowin P. Proc. Natl. Acad. Sci. 2003; 100: 11400-11405Crossref PubMed Scopus (46) Google Scholar, 9Tetsu O. McCormick F. Nature. 1999; 398: 422-426Crossref PubMed Scopus (3258) Google Scholar), which encode critical cell-cycle progression proteins (a list of target genes can be found at www.stanford.edu/∼rnusse/pathways/targets.html). Recently, we found by our modified TAPtag technique that the insulin receptor substrate-1 (IRS-1) 1The abbreviations used are: IRS-1, insulin receptor substrate-1; UBF1, upstream binding factor 1; IGF-1, insulin-like growth factor, type 1; IGF-1R, IGF-1 receptor; rDNA, ribosomal DNA; MEF, mouse embryo fibroblast; NLS, nuclear localization signal; CMV, cytomegalovirus; IP, immunoprecipitation; GST, glutathione S-transferase; ChIP, chromosomal immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; SFM, serum-free media; PI, propidium iodide. interacts in the nuclei with β-catenin (10Drakas R. Prisco M. Baserga R. Proteomics. 2005; 5: 132-137Crossref PubMed Scopus (54) Google Scholar). IRS-1, a docking protein for both the IGF-1 and insulin receptors, sends a strong mitogenic, anti-apoptotic, and anti-differentiation signal (11Baserga R. Cell Growth: Control of Cell Size. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2004: 235-263Google Scholar, 12White M.F. Mol. Cell. Biochem. 1998; 182: 3-11Crossref PubMed Scopus (624) Google Scholar). Overexpression or ectopic expression of IRS-1 can cause cell transformation, including the ability of cells to form colonies in soft agar and tumors in mice (13Valentinis B. Navarro N. Zanocco-Marani T. Edmonds P. McCormick J. Morrione A. Sacchi A. Romano G. Reiss K. Baserga R. J. Biol. Chem. 2000; 275: 25451-25459Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Under certain circumstances, IRS-1 translocates to the nuclei (14Lassak A. DelValle L. Peruzzi F. Wang J.Y. Enam S. Croul S. Khalili K. Reiss K. J. Biol. Chem. 2002; 277: 17231-17238Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 15Sun H. Tu X. Prisco M. Wu A. Casiburi I. Baserga R. Mol. Endocrinol. 2003; 17: 472-486Crossref PubMed Scopus (87) Google Scholar, 16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) where it interacts with nuclear proteins, including viral oncoproteins (14Lassak A. DelValle L. Peruzzi F. Wang J.Y. Enam S. Croul S. Khalili K. Reiss K. J. Biol. Chem. 2002; 277: 17231-17238Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 17Prisco M. Santini F. Baffa R. Liu M. Drakas R. Wu A. Baserga R. J. Biol. Chem. 2002; 277: 32078-32085Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar), the upstream binding factor 1 (UBF1) (15Sun H. Tu X. Prisco M. Wu A. Casiburi I. Baserga R. Mol. Endocrinol. 2003; 17: 472-486Crossref PubMed Scopus (87) Google Scholar, 16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar), and the estrogen receptor (18Morelli C. Garofalo C. Sisci D. del Rincon S. Cascio S. Tu X. Vecchione A. Sauter E.R. Miller Jr., W.H. Surmacz E. Oncogene. 2004; 23: 7517-7526Crossref PubMed Scopus (76) Google Scholar). IGFs are known to cause translocation of β-catenin to the nuclei, where it activates the target genes (5Eastman Q. Grosschedl R. Curr. Opin. Cell Biol. 1999; 11: 233-240Crossref PubMed Scopus (474) Google Scholar, 19Morali O.G. Delmas V. Moore R. Jeanney C. Thiery J.P. Larne L. Oncogene. 2001; 20: 4942-4950Crossref PubMed Scopus (237) Google Scholar, 20Playford M.P. Bicknell D. Bodmer W.F. Macaulay V.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12103-12108Crossref PubMed Scopus (242) Google Scholar, 21Satiamoorthy K. Li G. Vaidya B. Patel D. Herlyn M. Cancer Res. 2001; 61: 7318-7324PubMed Google Scholar). We have previously reported that IGF-1 stimulates the expression of both c-myc and cyclin D1 (22Reiss K. Valentinis B. Tu X. Xu S.Q. Baserga R. Exp. Cell Res. 1998; 242: 361-372Crossref PubMed Scopus (73) Google Scholar, 23Surmacz E. Reiss K. Sell C. Baserga R. Cancer Res. 1992; 52: 4522-4525PubMed Google Scholar), two targets of β-catenin. The exact molecular mechanism of this effect has not been fully explored. Our recent discovery of a direct binding between IRS-1 and β-catenin has prompted us to investigate the mechanism(s) and the functional significance of the interaction, in the context of IGF-1R signaling. Because IRS-1 is known to interact with UBF1 (a regulator of RNA polymerase I activity), whereas β-catenin has been reported to interact with UBF2 in the cyclin D1 promoter (24Grueneberg D.A. Pablo L. Hu Q. K August P. Weng Z. Papkoff J. Mol. Cell. Biol. 2003; 23: 3936-3950Crossref PubMed Scopus (21) Google Scholar), we also examined the possibility that IGF-1 stimulation may recruit IRS-1 and β-catenin together or separately to the cyclin D1 and the rDNA promoters. We report here that β-catenin and IRS-1 co-immunoprecipitate in nucleus and cytosol of mouse embryo fibroblasts (MEFs). IGF-1 promotes β-catenin translocation in R+ cells, where IRS-1 is also nuclear, but not in R12 cells, where IRS-1 is confined to the cytosol. The nuclear translocation of IRS-1 and β-catenin to the nuclei activates the Tc/Lef reporter. We find also that IRS-1 and β-catenin are both recruited to the cyclin D1 promoter with the UBF proteins, as already reported for β-catenin (24Grueneberg D.A. Pablo L. Hu Q. K August P. Weng Z. Papkoff J. Mol. Cell. Biol. 2003; 23: 3936-3950Crossref PubMed Scopus (21) Google Scholar). IRS-1, but not β-catenin, is recruited to the rDNA promoter, where it is known to bind UBF1 and stimulate the synthesis of rRNA (16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Using R12 and BT20 mammary cancer cells (25Castles G.C. Fuqua S.A. Klotz D.M. Hill S.M. Cancer Res. 1993; 53: 5934-5939PubMed Google Scholar), we show that IRS-1 is required for IGF-1-mediated nuclear translocation of β-catenin. The role of IRS-1 in the nuclear translocation of β-catenin has been confirmed by using a plasmid in which IRS-1 is expressed in fusion to a Nuclear Localization Signal (NLS). Stable expression of this plasmid in growth-regulated, contact-inhibited mouse fibroblast R12 cells (where both IRS-1 and β-catenin are normally cytoplasmic) causes both proteins to co-localize to the nuclei and induces the transformation of R12 cells into cells capable of forming colonies in soft agar (the best criteria for in vitro transformation). Although β-catenin can be translocated to the nuclei by different stimuli and pathways (see above), independently of IGF-1R signaling, these results indicate that IRS-1 can be considered one of the proteins that regulate the subcellular localization and activity of β-catenin, especially in cells responsive to the mitogenic action of IGF-1. Cells and Cell Cultures—R-cells and R–derived cells are 3T3-like cells originating from mouse embryos with a targeted disruption of the IGF-1R genes (26Liu J.-P. Baker J. Perkins A.S. Robertson E.J. Efstratiadis A. Cell. 1993; 75: 59-72Abstract Full Text PDF PubMed Scopus (2584) Google Scholar). They were described in previous reports (22Reiss K. Valentinis B. Tu X. Xu S.Q. Baserga R. Exp. Cell Res. 1998; 242: 361-372Crossref PubMed Scopus (73) Google Scholar, 27Rubini M. Hongo A. D'Ambrosio C. Baserga R. Exp. Cell Res. 1997; 230: 284-292Crossref PubMed Scopus (127) Google Scholar, 28Sell C. Rubini M. Rubin R. Liu J.-P. Efstratiadis A. Baserga R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11217-11221Crossref PubMed Scopus (541) Google Scholar) and are briefly described again under “Results.” Cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum plus l-glutamine plus the appropriate antibiotics. For stimulation with IGF-1 (20 ng/ml), cells were starved in serum-free medium for 24-48 h before addition of IGF-1. Plasmids—The UBF1 plasmid with a FLAG tag has been described by Maiorana et al. (29Maiorana A. Tu X. Cheng G. Baserga R. Oncogene. 2004; 23: 7116-7124Crossref PubMed Scopus (31) Google Scholar). The UBF2 with a FLAG tag was constructed in the same manner. The mutant plasmids of β-catenin (∂C and ∂N), a kind gift of Dr. Kamel Khalili (Temple University, Philadelphia, PA), are described in the report by Gan and Khalili (30Gan D.D. Khalili K. Oncogene. 2004; 23: 483-490Crossref PubMed Scopus (66) Google Scholar). The plasmid with a nuclear localization signal was the pCMV/myc/nuc plasmid (Invitrogen). IRS-1 was cloned in the XhoI/NotI site. Immunoprecipitation and Western Blots—Western blots and immunoprecipitations (IPs) were carried out according to standard procedures, described in detail in previous reports from this laboratory (15Sun H. Tu X. Prisco M. Wu A. Casiburi I. Baserga R. Mol. Endocrinol. 2003; 17: 472-486Crossref PubMed Scopus (87) Google Scholar, 16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Unless otherwise indicated, 20 μg of cytoplasmic or nuclear fractions was separated on a 4-14% gradient gel (Bio-Rad) and transferred to a nitrocellulose membrane. For immunoprecipitation, 100-200 μg of proteins was used, depending on the protein to be precipitated. Subcellular Fractionation—Cell lysates and subcellular fractionation have been described in detail in Wu et al. (31Wu A. Tu X. Prisco M. Baserga R. J. Biol. Chem. 2005; 280: 2863-2872Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). The purity of the subcellular fractions was routinely monitored with appropriate antibodies to either nuclear or cytoplasmic proteins. In this latter case, the Western blot was done directly on the nuclear or cytoplasmic lysates, without immunoprecipitation. Confocal Microscopy—Confocal microscopy studies followed the same procedures described in detail in previous reports from our laboratory (16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar, 17Prisco M. Santini F. Baffa R. Liu M. Drakas R. Wu A. Baserga R. J. Biol. Chem. 2002; 277: 32078-32085Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 29Maiorana A. Tu X. Cheng G. Baserga R. Oncogene. 2004; 23: 7116-7124Crossref PubMed Scopus (31) Google Scholar). The antibodies used are indicated in the appropriate figures. GST Pull-down Assays—GST fusion proteins were constructed using PCR products corresponding to different regions of IRS-1 coding for amino acids 1-300, 301-700, 701-1000, and 1001-1234. These regions were generated using specific oligonucleotide primers containing the appropriate restriction sites (all of the start primers contain XhoI restriction site and end primers contain EcoRI restriction sites in the overhangs). Purified PCR products were then digested with XhoI and EcoRI and ligated into XhoI/EcoRI cloning sites of pGEX-5X-1 vector (Amersham Biosciences). All plasmids constructs were confirmed by DNA sequencing and protein expression to guarantee accuracy and amounts of GST proteins in each reaction. The detailed cloning strategies are available upon request. Binding and elution of proteins were carried out by standard procedures. TOPFLASH Assay—The activity of β-catenin was measured using the TOPFLASH/FLOPFLASH luciferase assay (32Persad S. Troussard A.A. McPhee T.R. Mulholland D.J. Dedhar S. J. Cell Biol. 2001; 153: 1161-1173Crossref PubMed Scopus (207) Google Scholar). The plasmids used were the same as those reported by Korinek et al. (25Castles G.C. Fuqua S.A. Klotz D.M. Hill S.M. Cancer Res. 1993; 53: 5934-5939PubMed Google Scholar). The activity is usually determined after transient expression. We followed the procedure given in detail by Playford et al. (20Playford M.P. Bicknell D. Bodmer W.F. Macaulay V.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12103-12108Crossref PubMed Scopus (242) Google Scholar). We used for transient expression the Nucleofector (Amaxa Biosystem at www.amaxa.com), with which we have been obtaining high levels of transfection (70% with difficult cells like 32D cells, even higher in MEFs). Both R+ and other R- and R–derived cells were used for these experiments. ChIP Assays—Chromatin immunoprecipitation (ChIP) assays were carried out by standard methods (33Shang Y. Hu X. DiRenzo J. Lazar M.A. Brown M. Cell. 2000; 103: 843-852Abstract Full Text Full Text PDF PubMed Scopus (1451) Google Scholar). Subconfluent cultures were made quiescent and then stimulated with IGF-1 (see “Materials and Methods”). Following treatment, the cells were cross-linked with 1% formaldehyde at 37 °C for 10 min. The cells were collected and resuspended in 200 μl of lysis buffer (1% SDS, 10 mm EDTA, 50 mm Tris-HCl, pH 8.1) and left on ice for 10 min. They were sonicated 4× for 10 s at 30% of maximal power (Fisher Sonic Dismembrator) and collected by centrifugation at 4 °C for 10 min at 14,000 rpm. The supernatants were collected and diluted in 1.3 ml of IP buffer (0.01% SDS, 1.1% Triton, 1.2 mm EDTA, 16.7 mm Tris-HCl, pH 8.1, 16.7 mm NaCl) followed by immunoclearing with 80 μl of sonicated salmon sperm DNA/protein A-agarose (Upstate Biotechnology Inc.) for 1 h at 41 °C. The pre-cleared chromatin was immunoprecipitated for 12 h with specific antibodies (see below). After IP, 60 μl of salmon sperm/protein A-agarose was added and precipitation continued for 2 h at 41 °C. After pelletting, precipitates were washed sequentially for 5 min with the following buffers: wash A (0.1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris HCl, pH 8.1, 150 mm NaCl), wash B (same as wash A but with 500 mm NaCl), wash C (0.25 m LiCl, 1% Nonidet P-40, 1% sodium deoxycholate, 1 mm EDTA, 10 mm Tris-HCl, pH 8.1), and then twice with TE buffer (10 mm Tris, 1 mm EDTA). The immune complexes were eluted with elution buffer (1% SDS, 0.1 m NaCO3). The eluates were reverse cross-linked by heating at 65 °C for 12 h and digested with proteinase K (0.5 μg/ml) for 1 h. DNA was obtained by phenol and phenol/chloroform extraction, precipitated with ethanol at 4 °C for 12 h, and then re-suspended in 20 μl of TE buffer. For PCR, 5 μl of each sample was used with specific primers. For the cyclin D1 promoter, chromatin was immunoprecipitated first with an antibody to β-catenin, which served as the positive control, because β-catenin is known to bind to the cyclin D1 promoter. Enrichment was detected with the primers for the Tcf sequence of the cyclin D1 promoter. The primers were the following: left, cggactacaggggagttttgttg; right, tccagcatccaggtggcgacgat (34Kirmizis A. Bartley S.M. Farnham P.J. Mol. Cancer Ther. 2003; 2: 113-121PubMed Google Scholar). For ChIP assays with the rDNA promoter, we used the methodology of James and Zanerdijk (35James M.J. Zomerdijk J.C.B.M. J. Biol. Chem. 2004; 279: 8911-8918Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) but different primers, because we were dealing with a mouse rDNA promoter. The primers we used were as follows: forward P1, 5′-CCC TGT ACG TCT GAG GCC GAG-3′ (-250); rDNA promoter reverse P2, 5′-GTT AAT AGG GAA AGG ACA GCG TG-3′ (+26). We also used two other primers of the rDNA gene, located in a transcribed spacer (see text). These primers were as follows: left, gtgggtgctgcgcggctgggagt; right, accagtctttctcggtcccgtgcc. For the mouse GAPDH promoter, the primers were forward P1 (5′-AGTGCCAGCCTCGTCCCGTAGACAAAATG-3) and promoter reverse P2 (5′-AAGTGGGCCCCGGCCTTCTCCAT-3′). By trial and error, we established that the best number of cycles during the PCR reaction should not be above 29 cycles. At 30-32 cycles, one could get a weak false-positive. All the data presented in this report are based on 29 cycles. The amplification products were analyzed in a 2% agarose gel and visualized by ethidium bromide staining. Colony Formation in Soft Agar—The methodology previously described was followed (29Maiorana A. Tu X. Cheng G. Baserga R. Oncogene. 2004; 23: 7116-7124Crossref PubMed Scopus (31) Google Scholar). Briefly, to compare anchorage-independent growth of different cell lines, cells were plated at 2 × 103 in essential modified Eagle's medium containing 10% fetal bovine serum (plus or minus IGF-1) and 0.2% agarose (with 0.4% agarose underlay). The number of colonies larger than 125 μm in diameter was determined at 3 weeks following plating. Antibodies—The antibodies used were the following: β-catenin antibody (catalog no. MAB13291, R&D Systems Inc, Minneapolis, MN); IRS-1 rabbit polyclonal IgG (catalog no. G3003, Santa Cruz Biotechnology, Santa Cruz, CA); UBF, mouse monoclonal IgG1 (catalog no. SC-13125 Santa Cruz Biotechnology); anti-flag.M2-peroxidase conjugate (catalog no. a8592, Sigma); the phospho-β-catenin (Ser-33/47/Thr-41) antibody (Cell Signaling, www.cellsignal.com); anti-Grb2 monoclonal antibody (catalog no. 610111BD, BD Transduction Laboratory); c-Jun Sc4, rabbit polyclonal IgG (catalog no. F9, Santa Cruz Biotechnology); second antibody anti-IgG, mouse (SC-45, Oncogene, San Diego, CA); Second Antibody Peroxidase-conjugated AffiniPure Rabbit-mouse IgG (Jackson ImmunoResearch); goat anti-mouse IgG2a-FITC,(SC2079, Santa Cruz Biotechnology); and donkey anti-rabbit IgG-R (SC-2095, Santa Cruz Biotechnology). IRS-1 and β-Catenin Co-immunoprecipitate in the Nuclei and Cytoplasm of R--derived Cells—Our first step was to confirm by co-immunoprecipitation the IRS-1-/β-catenin interaction we originally detected by our modified TAPtag technique (10Drakas R. Prisco M. Baserga R. Proteomics. 2005; 5: 132-137Crossref PubMed Scopus (54) Google Scholar). We used cell lines derived from R-cells, the original MEFs obtained from mouse embryos with a targeted disruption of the IGF-1R genes (26Liu J.-P. Baker J. Perkins A.S. Robertson E.J. Efstratiadis A. Cell. 1993; 75: 59-72Abstract Full Text PDF PubMed Scopus (2584) Google Scholar). R12 cells are derived from R-cells and express 7 × 103 IGF-R/cell (27Rubini M. Hongo A. D'Ambrosio C. Baserga R. Exp. Cell Res. 1997; 230: 284-292Crossref PubMed Scopus (127) Google Scholar), whereas R+ cells are R-cells stably transfected with a cDNA plasmid expressing the human IGF-R at high levels (28Sell C. Rubini M. Rubin R. Liu J.-P. Efstratiadis A. Baserga R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11217-11221Crossref PubMed Scopus (541) Google Scholar). R12 cells are not transformed, do not grow in serum-free medium (SFM), and do not respond to IGF-1 (22Reiss K. Valentinis B. Tu X. Xu S.Q. Baserga R. Exp. Cell Res. 1998; 242: 361-372Crossref PubMed Scopus (73) Google Scholar, 27Rubini M. Hongo A. D'Ambrosio C. Baserga R. Exp. Cell Res. 1997; 230: 284-292Crossref PubMed Scopus (127) Google Scholar). However, IGF-1 induces in R12 cells tyrosine phosphorylation of IRS-1 and an increase in c-myc expression (22Reiss K. Valentinis B. Tu X. Xu S.Q. Baserga R. Exp. Cell Res. 1998; 242: 361-372Crossref PubMed Scopus (73) Google Scholar, 27Rubini M. Hongo A. D'Ambrosio C. Baserga R. Exp. Cell Res. 1997; 230: 284-292Crossref PubMed Scopus (127) Google Scholar). R+ cells respond to IGF-1 with cell proliferation and form colonies in soft agar (28Sell C. Rubini M. Rubin R. Liu J.-P. Efstratiadis A. Baserga R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11217-11221Crossref PubMed Scopus (541) Google Scholar). We first determined in whole cell lysates of these cells the levels of expression of IRS-1, β-catenin, UBF1, and Grb2. We chose the latter two proteins because UBF1 interacts with IRS-1 and is an exclusively nuclear/nucleolar protein (36Voit R. Kuhn A. Sander E.E. Grummt I. Nucleic Acids Res. 1995; 23: 2593-2599Crossref PubMed Scopus (97) Google Scholar), whereas Grb2 is an exclusively cytoplasmic protein that can be used to monitor protein amounts in each lane of a Western blot. All four proteins are well expressed in both cell lines, regardless of whether the cells are stimulated or not with IGF-1 (data not shown). We then tested the interaction between IRS-1 and β-catenin in nuclear and cytoplasmic fractions. Fig. 1A shows a Western blot from nuclear extracts immunoprecipitated with an antibody to β-catenin, and stained with antibodies to IRS-1 and β-catenin. The purity of the fractions was monitored with antibodies to c-Jun (a nuclear marker) and Grb2 (a cytoplasmic marker), directly on the lysates, without previous immunoprecipitation. There is interaction between the two proteins only in R+ cells, where IRS-1 is nuclear (15Sun H. Tu X. Prisco M. Wu A. Casiburi I. Baserga R. Mol. Endocrinol. 2003; 17: 472-486Crossref PubMed Scopus (87) Google Scholar, 16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). There is some nuclear IRS-1 in unstimulated R+ cells. We reported before (16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) that R+ cells secrete some IGF-1, which allows them to grow, albeit slowly, in SFM. The reverse immunoprecipitation experiment (with an antibody to IRS-1) is shown in Fig. 1B. Again, both proteins are detectable only in R+ cells. There is no apparent interaction between IRS-1 and β-catenin in R- and R12 cells, where IRS-1 is cytoplasmic (Ref. 16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar and see below). However, Fig. 1C shows that β-catenin and IRS-1 interact in the cytoplasm of all cell lines. The same result was obtained in the reverse experiment, where cytoplasmic extracts were immunoprecipitated with an antibody to IRS-1 and stained with antibodies to β-catenin and IRS-1 (not shown). These results confirm an interaction between IRS-1 and β-catenin, both in the cytoplasm and in the nuclei of R+ cells. In R- and R12 cells, stimulated with IGF-1, the interaction is limited to the cytoplasm, in agreement with the finding that IRS-1 is not found in the nuclei of these cells. Confocal Microscopy of R--derived Cells—To confirm the IRS-1/β-catenin interaction, we studied it by confocal microscopy on R-, R12, and R+ cells. The cells were stained with antibodies to IRS-1 (red) and β-catenin (green) as shown in Fig. 2, where the merged pictures are also presented. In R-cells (here stimulated with IGF-1, to which they do not respond), both IRS-1 and β-catenin are largely cytoplasmic (panel A), although there is a little β-catenin in the nuclei. In R+ cells, before stimulation with IGF-1, most of the IRS-1 is cytoplasmic, and in fact so is most of β-catenin (panel B), although the nuclei are partially stained. After stimulation of R+ cells by IGF-1, both IRS-1 and β-catenin are much more localized to the nuclei (panel C). We show in panel C a representative field for R+ cells after stimulation with IGF-1 for 24 h (panel C), but the results were the same at 16 h. In R+ cells, nuclear localization of IRS-1 after IGF-1 stimulation reaches a peak at 16-24 h (16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). In R12 cells, unresponsive to mitogenic stimulation by IGF-1, both IRS-1 and β-catenin are cytoplasmic before (panel D) or after 24 h stimulation with IGF-1 (panel E). The merged pictures clearly show the co-localization of the two proteins. It could be objected that Fig. 2 does not show a nuclear staining of the cells, to validate the subcellular localization of either IRS-1 or β-catenin. This is shown in Fig. 3, where R12 cells were stained with antibodies to IRS-1 (upper panels) or β-catenin (lower panels) and counterstained with propidium iodide (PI). Whether in SFM or after IGF-1, in R12 cells, both IRS-1 and β-catenin are essentially localized to the cytoplasm. We repeated the PI experiment with R+ and R-cells (not shown, but see Tu et al. (16Tu X. Batta P. Innocent N. Prisco M. Casaburi I. Belletti B. Baserga R. J. Biol. Chem. 2002; 277: 44357-44365Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) and Sun et al. (15Sun H. Tu X. Prisco M. Wu A. Casiburi I. Baserga R. Mol. Endocrinol. 2003; 17: 472-486Crossref PubMed Scopus (87) Google Scholar)). IRS-1 Is Required for IGF-1-mediated Nuclear Translocation of β-Catenin—The next question is whether the IGF-1-mediated nuclear translocation of β-catenin requires IRS-1. For this purpose, we used BT20 cells, a breast cancer cell line that does not express IRS-1 (Castles et al. (25Castles G.C. Fuqua S.A. Klotz D.M. Hill S.M. Cancer Res. 1993; 53: 5934-5939PubMed Google Scholar)). Fig. 4B shows a confocal microscopy of BT20 cells, either in SFM (upper panels) or after IGF-1 stimulation. The cells were again stained with an antibody" @default.
• W2014205300 created "2016-06-24" @default.
• W2014205300 creator A5024007741 @default.
• W2014205300 creator A5024798204 @default.
• W2014205300 creator A5044100185 @default.
• W2014205300 creator A5053145771 @default.
• W2014205300 creator A5072555015 @default.
• W2014205300 creator A5072885632 @default.
• W2014205300 creator A5087771423 @default.
• W2014205300 creator A5077497848 @default.
• W2014205300 date "2005-08-01" @default.
• W2014205300 modified "2023-09-30" @default.
• W2014205300 title "Functional Significance of Type 1 Insulin-like Growth Factor-mediated Nuclear Translocation of the Insulin Receptor Substrate-1 and β-Catenin" @default.
• W2014205300 cites W1554815317 @default.
• W2014205300 cites W1607339340 @default.
• W2014205300 cites W1976468253 @default.
• W2014205300 cites W1977508482 @default.
• W2014205300 cites W1987162584 @default.
• W2014205300 cites W1989077543 @default.
• W2014205300 cites W1994242450 @default.
• W2014205300 cites W1996861744 @default.
• W2014205300 cites W1997490037 @default.
• W2014205300 cites W1998626432 @default.
• W2014205300 cites W2000278598 @default.
• W2014205300 cites W2002404925 @default.
• W2014205300 cites W2012940389 @default.
• W2014205300 cites W2014460650 @default.
• W2014205300 cites W2015974087 @default.
• W2014205300 cites W2019366492 @default.
• W2014205300 cites W2024754812 @default.
• W2014205300 cites W2030656376 @default.
• W2014205300 cites W2038431178 @default.
• W2014205300 cites W2039576757 @default.
• W2014205300 cites W2042473840 @default.
• W2014205300 cites W2042940542 @default.
• W2014205300 cites W2046839434 @default.
• W2014205300 cites W2051140365 @default.
• W2014205300 cites W2052459095 @default.
• W2014205300 cites W2056950301 @default.
• W2014205300 cites W2064801081 @default.
• W2014205300 cites W2067400935 @default.
• W2014205300 cites W2069349104 @default.
• W2014205300 cites W2079263525 @default.
• W2014205300 cites W2081985759 @default.
• W2014205300 cites W2088639594 @default.
• W2014205300 cites W2090851532 @default.
• W2014205300 cites W2093338950 @default.
• W2014205300 cites W2094936136 @default.
• W2014205300 cites W2098387982 @default.
• W2014205300 cites W2104155139 @default.
• W2014205300 cites W2119477283 @default.
• W2014205300 cites W2125262485 @default.
• W2014205300 cites W2133180947 @default.
• W2014205300 cites W2135821923 @default.
• W2014205300 cites W2146167376 @default.
• W2014205300 cites W2148294117 @default.
• W2014205300 cites W2149062070 @default.
• W2014205300 cites W2158603579 @default.
• W2014205300 cites W2239090104 @default.
• W2014205300 cites W4253418569 @default.
• W2014205300 doi "https://doi.org/10.1074/jbc.m504516200" @default.
• W2014205300 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15967802" @default.
• W2014205300 hasPublicationYear "2005" @default.
• W2014205300 type Work @default.
• W2014205300 sameAs 2014205300 @default.
• W2014205300 citedByCount "94" @default.
• W2014205300 countsByYear W20142053002012 @default.
• W2014205300 countsByYear W20142053002013 @default.
• W2014205300 countsByYear W20142053002014 @default.
• W2014205300 countsByYear W20142053002015 @default.
• W2014205300 countsByYear W20142053002016 @default.
• W2014205300 countsByYear W20142053002017 @default.
• W2014205300 countsByYear W20142053002018 @default.
• W2014205300 countsByYear W20142053002019 @default.
• W2014205300 countsByYear W20142053002020 @default.
• W2014205300 countsByYear W20142053002021 @default.
• W2014205300 countsByYear W20142053002022 @default.
• W2014205300 countsByYear W20142053002023 @default.
• W2014205300 crossrefType "journal-article" @default.
• W2014205300 hasAuthorship W2014205300A5024007741 @default.
• W2014205300 hasAuthorship W2014205300A5024798204 @default.
• W2014205300 hasAuthorship W2014205300A5044100185 @default.
• W2014205300 hasAuthorship W2014205300A5053145771 @default.
• W2014205300 hasAuthorship W2014205300A5072555015 @default.
• W2014205300 hasAuthorship W2014205300A5072885632 @default.
• W2014205300 hasAuthorship W2014205300A5077497848 @default.
• W2014205300 hasAuthorship W2014205300A5087771423 @default.
• W2014205300 hasBestOaLocation W20142053001 @default.
• W2014205300 hasConcept C104317684 @default.
• W2014205300 hasConcept C112446052 @default.
• W2014205300 hasConcept C126322002 @default.
• W2014205300 hasConcept C134018914 @default.
• W2014205300 hasConcept C137620995 @default.
• W2014205300 hasConcept C138626823 @default.
• W2014205300 hasConcept C170493617 @default.
• W2014205300 hasConcept C185592680 @default.
• W2014205300 hasConcept C185967709 @default.
• W2014205300 hasConcept C18903297 @default.

• next