FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2014639796> ?p ?o ?g. }

• W2014639796 endingPage "11228" @default.
• W2014639796 startingPage "11220" @default.
• W2014639796 abstract "Cyclin A1 is a recently cloned cyclin with high level expression in meiotic cells in the testis. However, it is also frequently expressed at high levels in acute myeloid leukemia. To elucidate the regulation of cyclin A1 gene expression, we cloned and analyzed the genomic structure of cyclin A1. It consists of 9 exons within 13 kilobase pairs. The TATA-less promoter initiates transcription from several start sites with the majority of transcripts beginning within a 4-base pair stretch. A construct containing a fragment from −190 to +145 showed the highest transcriptional activity. Transfection of cyclin A1promoter constructs into S2 Drosophila cells demonstrated that Sp1 is essential for the activity of the promoter. Sp1, as well as Sp3, bound to four GC boxes between nucleotides −130 and −80 as observed by gel shift analysis. Mutations in two or more of the four GC boxes decreased promoter activity by >80%. The promoter was found to be cell cycle-regulated with highest activities found in late S and G2/M phase. Further analyses suggested that cell cycle regulation was accomplished by periodic repression of the GC boxes in G1 phase. Taken together, our data show that cyclin A1 promoter activity critically depends on four GC boxes, and members of the Sp1 family appear to be involved in directing expression of cyclin A1 in both a tissue- and cell cycle-specific manner. Cyclin A1 is a recently cloned cyclin with high level expression in meiotic cells in the testis. However, it is also frequently expressed at high levels in acute myeloid leukemia. To elucidate the regulation of cyclin A1 gene expression, we cloned and analyzed the genomic structure of cyclin A1. It consists of 9 exons within 13 kilobase pairs. The TATA-less promoter initiates transcription from several start sites with the majority of transcripts beginning within a 4-base pair stretch. A construct containing a fragment from −190 to +145 showed the highest transcriptional activity. Transfection of cyclin A1promoter constructs into S2 Drosophila cells demonstrated that Sp1 is essential for the activity of the promoter. Sp1, as well as Sp3, bound to four GC boxes between nucleotides −130 and −80 as observed by gel shift analysis. Mutations in two or more of the four GC boxes decreased promoter activity by >80%. The promoter was found to be cell cycle-regulated with highest activities found in late S and G2/M phase. Further analyses suggested that cell cycle regulation was accomplished by periodic repression of the GC boxes in G1 phase. Taken together, our data show that cyclin A1 promoter activity critically depends on four GC boxes, and members of the Sp1 family appear to be involved in directing expression of cyclin A1 in both a tissue- and cell cycle-specific manner. A growing family of cyclin-dependent kinases (Cdk) 1The abbreviations used are: Cdk, cyclin-dependent kinases; RACE, rapid amplification of 5′ cDNA ends; kb, kilobase pair; bp, base pair; PCR, polymerase chain reaction; CDE, cycle-dependent element; CHR, cell cycle homology region. regulates a wide variety of cellular pathways (for review, see Ref. 1Morgan D.O. Annu. Rev. Cell Dev. Biol. 1997; 13: 261-291Crossref PubMed Scopus (1810) Google Scholar). Cdc 2 (Cdk 1) and Cdk 2 play a central role in the cell cycle of mammalian cells. Substrate specificity and activity of Cdks are controlled by their interaction with different cyclins that trigger the initiation of cell cycle events (2Morgan D.O. Nature. 1995; 374: 131-134Crossref PubMed Scopus (2938) Google Scholar). Cdk 2 specifically interacts with cyclin E for G1/S progression and with cyclin A during S and G2/M phases. Cyclin B3 might be another partner for Cdc 2 and Cdk 2 during the G2/M phase (3Gallant P. Nigg E.A. EMBO J. 1994; 13: 595-605Crossref PubMed Scopus (103) Google Scholar). In accordance with their central role in mammalian cell cycle regulation, the levels of cyclins A and E (among other cyclins) oscillate in most if not all proliferating mammalian cells. Disruption of the murine cyclin A2 (the homolog of human cyclin A) leads to early embryonic death suggesting an essential role for this gene in embryonic cell cycle in mammals (4Murphy M. Stinnakre M.G. Senamaud-Beaufort C. Winston N.J. Sweeney C. Kubelka M. Carrington M. Brechot C. Sobczak-Thepot J. Nat. Genet. 1997; 15: 83-86Crossref PubMed Scopus (208) Google Scholar). The human cyclin A2 (also known as cyclin A) was initially cloned because its gene locus was the site of integration by the hepatitis B virus in a case of hepatocellular carcinoma (5Wang J. Chenivesse X. Henglein B. Brechot C. Nature. 1990; 343: 555-557Crossref PubMed Scopus (558) Google Scholar). It has also been implicated to be important in the recurrence of hepatocellular carcinoma (6Chao Y. Shih Y.L. Chiu J.H. Chau G.Y. Lui W.Y. Yang W.K. Lee S.D. Huang T.S. Cancer Res. 1998; 58: 985-990PubMed Google Scholar). Recently, we cloned a second human cyclin A-like partner for Cdk 2, termed cyclin A1, that exhibits a highly restricted pattern of expression (7Yang R. Morosetti R. Koeffler H.P. Cancer Res. 1997; 57: 913-920PubMed Google Scholar). The high level tissue-specific expression of the human and murine cyclin A1 in testis suggests a specific role in meiosis (7Yang R. Morosetti R. Koeffler H.P. Cancer Res. 1997; 57: 913-920PubMed Google Scholar, 8Sweeney C. Murphy M. Kubelka M. Ravnik S.E. Hawkins C.F. Wolgemuth D.J. Carrington M. Development. 1996; 122: 53-64Crossref PubMed Google Scholar). Very low levels are detected in other tissues by reverse transcriptase-PCR; however, high levels of human cyclin A1 were also found in acute myeloid leukemia cell lines (7Yang R. Morosetti R. Koeffler H.P. Cancer Res. 1997; 57: 913-920PubMed Google Scholar) and myeloid leukemia samples from patients (9Yang R. Nakamaki T. Lubbert M. Said J. Sakashita A. Freyaldenhove B.S. Spira S. Huynh V. Muller C. Koeffler H.P. Blood. 1999; 93: 2067-2074PubMed Google Scholar). This intriguing observation might suggest a possible role for cyclin A1 in proliferation and differentiation of hematopoietic progenitors and/or in promotion of growth of leukemic cells. Cyclin A1 shows homology to cyclin A2 and forms in vivocomplexes with Rb as well as with E2F (10Yang R. Muller C. Huynh V. Fung Y.K. Yee A.S. Koeffler H.P. Mol. Cell. Biol. 1999; 19: 2400-2407Crossref PubMed Scopus (128) Google Scholar). Cyclin A1-Cdk 2 complexes phosphorylate these substrates in vitro (10Yang R. Muller C. Huynh V. Fung Y.K. Yee A.S. Koeffler H.P. Mol. Cell. Biol. 1999; 19: 2400-2407Crossref PubMed Scopus (128) Google Scholar). Our data showing that cyclin A1 is expressed in hematopoietic progenitors (9Yang R. Nakamaki T. Lubbert M. Said J. Sakashita A. Freyaldenhove B.S. Spira S. Huynh V. Muller C. Koeffler H.P. Blood. 1999; 93: 2067-2074PubMed Google Scholar) and interacts with Rb family members and E2F, suggest that it may affect cell cycle progression in expressing cells. The pattern of cyclin A1 expression indicates that the regulation of its expression is different from that of cyclin A2. Furthermore, overexpression of cyclin A1 in myeloid leukemia originates at the transcriptional level. To elucidate the transcriptional mechanisms that underlie the tissue-specific pattern of expression, we cloned and analyzed the genomic organization of the cyclin A1 gene and its promoter region. The highest transcriptional activity was assigned to a 335-bp fragment that required intact GC boxes located between −60 and −120 bp upstream of the main transcriptional start sites. These sites are also essential for cell cycle regulation of the promoter. Thecyclin A1 gene was cloned by screening a genomic Fix II lambda library made from placenta (Stratagene) using the cyclin A1 cDNA as a probe (7Yang R. Morosetti R. Koeffler H.P. Cancer Res. 1997; 57: 913-920PubMed Google Scholar). Of the several phage clones obtained, one contained all the exons and included a 1.3-kb region upstream of the 5′ end of the cDNA. A 2.2-kb NotI-BamHI fragment from the 5′ end of the gene was subcloned into the pRS316 cloning vector. The construct was further digested using SmaI; and three fragments were subcloned into PUC19. The fragments were sequenced in both directions using cycle sequencing and an automated sequencer (ABI373) or Sequenase 2.0 (Amersham Pharmacia Biotech). The positions and lengths of the introns were determined by PCR amplification of the entire cyclin A1 coding region with different primers (detailed primer information will be provided on request). Subsequently, PCR products were either subcloned using pGEM-T-Easy (Promega) or directly sequenced using cycle sequencing. Boundaries of the ∼4.5-kb intron 2 were determined by direct sequencing of the lambda phage clone. The initial luciferase constructs were generated by PCR amplification of the pRS316 plasmid containing the 2.2-kb cyclin A1 fragment. A BglII site at the 5′ end and a BamHI site at the 3′ end were introduced and the Pfu-amplified fragment was cloned into the BglII site of PGL3-Basic. The +145 fragment was generated to include the potential E2F site at +138. The ATG in the primer (the initiating codon for cyclin A1) was mutated to ATT to avoid the initiation of translation. All constructs were confirmed to have the correct sequence by DNA sequencing. The 5′ deletions were generated by exonuclease III treatment usingKpnI/SacI-digested PGL3-Basic containing the −1299 to +145 fragment and the Erase-a-base kit (Promega). The end points of the deletions were determined by sequencing. The −37 fragment was constructed by digesting the −190 to +145 containing PGL3-Basic with NaeI and HindIII and subsequent cloning of the 200-bp fragment into PGL3-Basic digested withSmaI and HindIII. HeLa cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum containing 100 units/ml penicillin and 100 μg/ml streptomycin. For transfection, 5 × 105 cells were seeded into 60-mm plates 16 h before transfection. Transfection was carried out using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's protocol. Two μg of luciferase reporter plasmid was transfected together with 300 ng of a CMV-β-gal expression vector used for standardization. Cells were harvested and assayed for luciferase and β-galactosidase activity after 48 h. All experiments were carried out in duplicate and were independently performed at least three times. Data of luciferase assays are shown as mean ± S.E. of three independent experiments unless stated otherwise. The Drosophila cell line SL2 was obtained from ATCC and grown at room temperature in Schneider's insect cell medium (Life Technologies, Inc.) supplemented with 10% fetal calf serum. Insect cells were transfected using Superfect (Qiagen). Briefly, 5 × 105 cells were seeded into 6-well plates and the Superfect/DNA mixture was added dropwise. One μg of the luciferase reporter was transfected with or without 100 ng of the Sp1 expression vector pAC-Sp1, which was a kind gift from Dr. E. Stanbridge (University of California, Irvine). Luciferase activity was analyzed after 48 h. Luciferase values could not be standardized using β-galactosidase activity because the viral promoters in the available plasmids also depended strongly on Sp1 for adequate expression. All experiments were carried out in duplicate and independently performed at least three times. HeLa cells were transfected using LipofectAMINE as described above. After transfection, cells were cultured in 0.1% fetal calf serum containing medium. After 16 h, medium was exchanged, and cells were synchronized essentially as described (11Carbonaro-Hall D. Williams R. Wu L. Warburton D. Zeichner-David M. MacDougal M. Tolo V. Hall F. Oncogene. 1993; 8: 1649-1659PubMed Google Scholar). Cells were arrested in G1 by serum starvation (0.1% fetal calf serum), in early S phase by aphidicolin (2 μg/ml), and in S phase by aphidicolin treatment and release into fresh medium 6 h before harvest. Cells were arrested in G2/M phase by nocodazole (0.1 μg/ml). Appropriate synchronization was confirmed by DNA quantitation using flow cytometry, and the experiments were performed at least three times. For the cell cycle release experiments, HeLa cells were arrested using aphidicolin as described above, and cells were harvested at the different time points after their release in fresh medium. The time course experiments were independently performed two times. To analyze cell cycle-regulated activity of different constructs, HeLa cells were arrested by serum starvation for 36 h followed by aphidicolin arrest and subsequently released for 18 h. At this time point, most cells were in late S or in G2/M phase. The longer serum starvation of the cells led to better synchronization and a higher induction after release. The release experiments were independently performed at least three times. All luciferase values were normalized using β-galactosidase activity as described above. The rapid amplification of 5′ cDNA ends (RACE) was performed using a 5′-RACE system (Life Technologies, Inc.). The procedure was performed as suggested in the manufacturer's protocol using RNA of the myeloid leukemia cell lines ML1 and U937. RNA was reversed-transcribed using the primer 5′-CCCTCTCAGAACAGACATACA (positions +981 to +961 of the cDNA) and Superscript II reverse transcriptase (Life Technologies, Inc.). Gene-specific cDNA was PCR-amplified using the gene-specific primer 5′-CTGATCCAGAATAACACCTGA (positions +460 to +440 of the cDNA) and the universal 5′-RACE Abridged Anchor Primer 5′-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG. PCR amplifications from both RNA samples yielded a single band of ∼450 bp. The entire PCR product was phenol/chloroform-extracted, precipitated using NH4+ acetate, and finally cloned into pGEM-T-Easy and sequenced. The primer extension assay was carried out by reverse transcription of 10 μg of RNA (U937) using a 32P-labeled primer 5′-CTCCTCCCACCAGACAGGA corresponding to +97 to +79 on the cDNA. Hybridization was carried out overnight at 58 °C. Superscript II was used for reverse transcription at 42 °C for 50 min. Extension products were resolved on a 8% sequencing gel with a sequencing reaction being run in parallel. As negative controls, we used tRNA and a sample without RNA. Nuclear extracts from HeLa cells were prepared as described (12Chumakov A.M. Miller C.W. Chen D.L. Koeffler H.P. Oncogene. 1993; 8: 3005-3011PubMed Google Scholar). For gel retardation experiments, 1 ng of 32P-labeled double-stranded oligonucleotides containing either GC boxes 1 + 2 (5′-CCTGCCCCGCCCTGCCCCGCCCAGCC) or GC boxes 3 + 4 (5′-CCTTCCCCGCCCTGCCCCGCCCGGCCC) were incubated for 20 min at room temperature with 5 μg of HeLa nuclear extract. The final reaction contained 10 mm Tris-HCl, pH 7.5, 5% glycerol, 1 mm MgCl2, 0.5 mm EDTA, 0.5 mm dithiothreitol, 100 mm NaCl, and 1 μg of poly(dI-dC)·poly(dI-dC). For competition experiments, 100 ng of double-stranded oligonucleotide containing either a Sp1 consensus site (5′-ATTCGATCGGGGCGGGGCGAGC), the oligonucleotide used for gel retardation (see above), or a nonspecific oligonucleotide (5′-GAGACCGGCTCGAACGCAATCATGT) was preincubated for 15 min at room temperature with the nuclear extracts before the addition of the labeled oligonucleotide. For supershift experiments, 2–3 μg of polyclonal antibody against Sp1 (Pep2, Santa Cruz Biotechnology) or Sp3 (D20, Santa Cruz Biotechnology) was preincubated with the nuclear extracts. Reactions were loaded on a 0.5× TBE, 4% nondenaturing polyacrylamide gel and run for 2–3 h at 10 V/cm. Gels were dried and autoradiographed. Site-directed mutagenesis was performed according to the method from Deng and Nickoloff (13Deng W.P. Nickoloff J.A. Anal. Biochem. 1992; 200: 81-88Crossref PubMed Scopus (1079) Google Scholar) using the Transformer site-directed mutagenesis kit (CLONTECH). In brief, phosphorylated oligonucleotides containing the desired mutation were annealed on the single-stranded PGL3-Basic plasmid (containing the fragment −190 to +145) together with the oligonucleotide 5′-AATCGATAAGAATTCGTCGACCGA that changes the unique BamHI site to an EcoRI site. The complementary strand was extended and completed from the annealed oligonucleotides using T4 polymerase and T4 ligase. Selection for the mutant plasmid was performed by two rounds of digestion withBamHI and subsequent transformations first into the repair-deficient strain BMH 71-18 mutS and finally into DH5α. The entire promoter fragment was sequenced to verify desired mutations and to exclude second site mutations. Because of the short distances between GC boxes 1 + 2 and 3 + 4, oligonucleotides were designed to mutate both GC boxes simultaneously. Mutations in all four GC boxes were introduced by simultaneously adding oligonucleotides 1 + 2 and 3 + 4. All oligonucleotides used in these experiments were 5′-phosphorylated. The following oligonucleotides were used (mutated bases underlined): GC box 1, CCCCGCCCTGCCCCTTACAGCCGGCCACC; GC box 2, CCAACCCTGCCCTTACCTGCCCCG; GC box 3, CCCTGCCCCTTCCGGCCCGGCC; GC box 4, CTGCCCTTCCCTTCCCTGCCCC; GC boxes 1 + 2, GCCCAACCCTGCCCTTACCTGCCCCTTACAGCCGGCCACCTC; GC boxes 3 + 4, CTTCCCTGCCCTTCCCTTACCT GCCCCTTACGGCCCGGCCCGGCC. The suspected CDE in the cyclin A1 promoter was mutated using the following oligonucleotide, CCACCTCTTAACAAGCTTCCTCCAGTGCA. A human genomic lambda phage library was screened using the cDNA of cyclin A1 as a probe. Several clones containing pieces of the gene were obtained, and one clone with a 14.5-kb insert contained the entire gene. A 2.2-kb fragment at the 5′ end of the gene was subcloned and sequenced (see “Materials and Methods”). The 2.2-kb fragment contained the first intron and parts of exon 2. The other exon-intron boundaries were analyzed by PCR amplification and sequencing using sets of primers that span the entire coding region. The human cyclin A1 gene consists of 9 exons and 8 introns that extend over ∼13 kb (Fig. 1). All the exon-intron boundaries adhere to the consensus sequence. The translation initiation codon is located in the first exon. A second in-frame ATG that resembles the starting codon of the murinecyclin A1 is found in exon 2, 50 nucleotides downstream of intron 1 of the human cyclin A1 gene. Transcription start sites were determined using primer extension analysis and 5′-RACE (Fig.2). Both methods demonstrated the existence of several transcription start sites. The PCR product from the RACE reaction consisted of a single band of ∼450 bp. Sequencing of the inserts after cloning revealed that 80% of the RACE products (20/25) started from a 4-base pair stretch, and thus the predominant start site was assigned +1 (Fig. 2 A). This site is 130 bp upstream of the translation initiating ATG codon. Primer extension analysis identified the same start sites, but minor products were also seen further upstream (Fig. 2 B). The major start site coincides with the RACE results of the 5′ end of the initially described cDNA clone (7Yang R. Morosetti R. Koeffler H.P. Cancer Res. 1997; 57: 913-920PubMed Google Scholar). We also looked for transcription start sites upstream of the second ATG in intron 1. However, neither RACE clones nor primer extension assays showed evidence for a second transcript in myeloid leukemia cells (data not shown). Genomic sequences 1299 bp upstream of the transcription start site were cloned and sequenced. No TATA box was found in proximity to the putative transcription start site. The main transcriptional start site is likely to function as an initiator region (Inr) since the sequence “CCAGTT” is very similar to the consensus Inr sequence “TCA (G/T) T (T/C)” (14Burke T.W. Kadonaga J.T. Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (400) Google Scholar). No DPE element was found downstream of the main transcriptional start site (14Burke T.W. Kadonaga J.T. Genes Dev. 1997; 11: 3020-3031Crossref PubMed Scopus (400) Google Scholar). Several potential binding sites for transcription factors occur within the sequence (Fig. 3). An E2F site is located at +140 and another possible site at +68. A site that resembles the cycle-dependent element (CDE) of the cyclin A2promoter was found at −28 (15Zwicker J. Lucibello F.C. Wolfraim L.A. Gross C. Truss M. Engeland K. Muller R. EMBO J. 1995; 14: 4514-4522Crossref PubMed Scopus (281) Google Scholar). However, this element was located on the antisense strand. No cell cycle genes homology region (CHR) was found. Potential Myb sites are predicted at positions +2, −30, and −90. The nucleotide sequence contains two CpG islands of up to 90% GC content reaching from −1000 to −700 and from −550 to −50. Multiple GC boxes are found in this region, and six GC boxes grouped as three double sites are located between nucleotides −150 and −45. Portions of the cyclin A1 promoter werePfu PCR-amplified and cloned into the promoterless PGL3-Basic Luciferase vector. Promoter activity was analyzed after transient transfection into HeLa cells. The construct containing nucleotides from −1299 to +145 from the 5′ cyclin A1upstream region showed significant promoter activity when cloned in the sense direction (Fig. 4). The same fragment cloned in the opposite direction or a construct containing solely exon 1 and intron 1 did not show promoter activity (data not shown). Deletions from the 5′ end were made for the −1299 to +145 fragment using exonuclease III treatment (Fig. 4). Transient transfection and subsequent luciferase assays revealed the strongest activity occurred in the construct containing the fragment from −190 to +145 bp (Fig.4). Both the −1299 and the −190 constructs exhibited promoter activity in a variety of cell lines including Cos-7, MCF-7, U937, KCL22, and Jurkat (data not shown). In all of these mammalian cell lines, luciferase activities generated by the −190 construct were higher than those by the −1299 construct. Constructs with a 5′ end containing less than 190 bp upstream of the transcription start site showed a progressive loss of promoter activity. A construct containing bp −37 to +145 showed only 2-fold higher activity than the promoterless vector PGL3-Basic. TATA-less promoters frequently depend on GC boxes to activate transcription (16Lu J. Lee W. Jiang C. Keller E.B. J. Biol. Chem. 1994; 269: 5391-5402Abstract Full Text PDF PubMed Google Scholar, 17Blake M.C. Jambou R.C. Swick A.G. Kahn J.W. Azizkhan J.C. Mol. Cell. Biol. 1990; 10: 6632-6641Crossref PubMed Scopus (233) Google Scholar). One of the main factors binding to these sites are Sp1 family proteins (18Courey A.J. Tjian R. Cell. 1988; 55: 887-898Abstract Full Text PDF PubMed Scopus (1079) Google Scholar, 19Kumar A.P. Butler A.P. Nucleic Acids Res. 1997; 25: 2012-2019Crossref PubMed Scopus (81) Google Scholar, 20Hagen G. Dennig J. Preiss A. Beato M. Suske G. J. Biol. Chem. 1995; 270: 24989-24994Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). The cyclin A1promoter contains at least six potential GC boxes between 190 and 37 bp upstream of the transcription start site. To analyze the importance of Sp1 for the activity of the cyclin A1 promoter, various promoter constructs were transfected into the Drosophilacell line S2 which lacks endogenous Sp1 and Sp3 (Fig.5). When transfected alone, the activity of all cyclin A1 promoter fragments was not significantly different from the control (Fig. 6,dotted bars). The addition of an Sp1 expression plasmid strongly activated transcription by 15–25-fold from the cyclin A1 promoter (Fig. 5, solid bars). Interestingly, increased transcriptional activity was observed only for constructs containing sequences starting between −1299 and −112 bp upstream of the transcription start site. The construct containing the nucleotide sequences between −37 and +145 did not show any increase in activity, suggesting that Sp1-binding sites between −112 and −37 are essential for Sp1-mediated transcriptional activity of the cyclin A1promoter in Drosophila cells. This region contains four GC boxes that are grouped in two pairs (Fig. 3). To test whether Sp1 and other Sp1 family members could bind to these sites, gel-shift experiments were performed (Fig. 6). Several specific complexes in HeLa cell nuclear extract bound to these sites (lanes 1 and7). These complexes were competed away by an excess of cold oligonucleotides containing either the original site (lanes 2 and 8) or an Sp1 consensus site (lanes 3and 9). A 100-fold excess of a nonspecific oligonucleotide did not alter complex binding (lanes 4 and 10). Supershift experiments with antibody against either Sp1 or Sp3 demonstrated the presence of Sp1 in one complex (lanes 5 and11) and the presence of Sp3 (lanes 6 and12) in two other complexes. The composition of the fastest migrating complex is unknown.Figure 6Gel shift analysis of GC box binding proteins in HeLa nuclear extract. Lanes 1–6 show complexes binding to a 32P-end-labeled oligonucleotide containing GC boxes 1 and 2, and the labeled oligonucleotide in lanes 7–12 contains GC boxes 3 and 4. Lanes 1 and7 show binding of 5 μg of HeLa nuclear extract to the respective oligonucleotide. Binding is competed away in lanes 2 and 8 with a 100-fold excess of cold Sp1 consensus oligonucleotide and in lanes 3 and 9 by a 100-fold excess of cold oligonucleotides using either GC boxes 1 + 2 (lane 3) or GC boxes 3 + 4 (lane 9). A 100-fold excess of a nonspecific oligonucleotide did not compete the specific complexes away (lanes 4 and 10). Antibodies against Sp1 were added to samples in lanes 5 and11 and antibodies against Sp3 were present in reactions forlanes 6 and 12. Identified complexes are marked with an arrow, and the respective protein is named on theleft-hand side of the figure.View Large Image Figure ViewerDownload (PPT) The relevance of these GC boxes for promoter activity was further studied by mutational analysis. Point mutations were made in each GC box. Each mutant was tested either alone with the remaining sites unaltered or in combination with the other mutant sites. Luciferase analyses demonstrated that a mutation in either GC box 1 or 2 reduced promoter activity by about 40 and 75%, respectively, whereas a single mutation of either GC box 3 or 4 did not have a major effect on promoter activity (Fig. 7). Mutation of GC box 1 and 2 together decreased promoter activity by 85%. The presence of at least one of the two upstream GC boxes (boxes 3 and 4) being intact was essential for cyclin A1 promoter activity as mutations in both reduced promoter activity by about 80%. Mutations of all four GC boxes reduced activity of the cyclin A1 promoter by 95%. The concentration of cyclins varies during the cell cycle, and one mechanism of their regulation occurs at the transcriptional level (21Muller R. Trends Genet. 1995; 11: 173-178Abstract Full Text PDF PubMed Scopus (136) Google Scholar). To analyze cell cycle regulation of promoter activity, transiently transfected cells were arrested in different phases of the cell cycle and were subsequently analyzed for luciferase activity. Cell cycle-regulated activity was found for the full-length promoter as well as for the construct containing the −190 to +145 fragment. The cyclin A1 promoter activity was relatively low during the G0/G1 phase. It increased after the cell cycle progressed beyond the G1/S boundary (Fig.8 A). The highest levels of activity were observed in the S and G2/M phases. Recently, we showed that RNA levels of cyclin A1 accumulated during S phase with the highest levels present at the S and G2/M phases (10Yang R. Muller C. Huynh V. Fung Y.K. Yee A.S. Koeffler H.P. Mol. Cell. Biol. 1999; 19: 2400-2407Crossref PubMed Scopus (128) Google Scholar). When transiently transfected HeLa cells were released from an aphidicolin block, luciferase values started to increase after 6 h and reached a maximum after 12–16 h (Fig. 8 B). The maximum promoter activity corresponded to the percentage of cells present in the S and G2/M phases (Fig. 8 C). To define the regions that are relevant for cell cycle regulation of the cyclin A1 promoter, we generated mutations in the presumed E2F sites and the suspected CDE. We also generated by PCR a 3′ deletion construct (−190 + 13) that deleted the two presumed E2F sites downstream of the transcriptional start site. Mutations in these two presumed E2F sites, the mutation in the inverted presumed CDE and the 3′ deletion, showed an indistinguishable pattern of cell cycle regulation when compared with the wild type (Fig.9 and data not shown). Hence, these E2F sites and the inverted CDE are unlikely to play a role in cell cycle regulation of the promoter. Analysis of 5′ deletions and the constructs containing the mutated GC boxes revealed that the four GC boxes are essential for cell cycle regulation (Fig. 9). Interestingly, the activity of the construct containing the mutated GC boxes showed 60% of the activity of the wild type reporter construct in G1 phase. However, the activity of the construct failed to increase when cells entered S phase and showed only 4% of the wild type cyclin A1 promoter activity. Similar data were obtained for the 5′ deletion lacking the four GC boxes (Fig. 9). Cyclin A2 (formerly cyclin A) is ubiquitously expressed in proliferating cells and is required for cell cycle progression (11Carbonaro-Hall D. Williams R. Wu L. Warburton D. Zeichner-David M. MacDougal M. Tolo V. Hall F. Oncogene. 1993; 8: 1649-1659PubMed Google Scholar, 22Rosenberg A.R. Zindy F. Le Deist F. Mouly H. Metaneau P. Brechot C. Lamas E. Oncogene. 1995; 10: 1501-1509PubMed Google Scholar,23Resnitzky D. Hengst L. Reed S.I. Mol. Cell. Biol. 1995; 15: 4347-4352Crossref PubMed Scopus (231) Google Scholar). A second cyclin A-like protein, cyclin A1, shows a highly restricted pattern of expression suggestive not only of specific functional activities but also of" @default.
• W2014639796 created "2016-06-24" @default.
• W2014639796 creator A5036495900 @default.
• W2014639796 creator A5050087404 @default.
• W2014639796 creator A5070083610 @default.
• W2014639796 creator A5072472914 @default.
• W2014639796 creator A5077076703 @default.
• W2014639796 creator A5082903377 @default.
• W2014639796 date "1999-04-01" @default.
• W2014639796 modified "2023-09-27" @default.
• W2014639796 title "Cloning of the cyclin A1 Genomic Structure and Characterization of the Promoter Region" @default.
• W2014639796 cites W1541937812 @default.
• W2014639796 cites W1667331074 @default.
• W2014639796 cites W1896727857 @default.
• W2014639796 cites W1972683654 @default.
• W2014639796 cites W1979933285 @default.
• W2014639796 cites W2010499718 @default.
• W2014639796 cites W2014074020 @default.
• W2014639796 cites W2030618323 @default.
• W2014639796 cites W2037653294 @default.
• W2014639796 cites W2040198458 @default.
• W2014639796 cites W2051159649 @default.
• W2014639796 cites W2052015497 @default.
• W2014639796 cites W2055774593 @default.
• W2014639796 cites W2064502982 @default.
• W2014639796 cites W2069540105 @default.
• W2014639796 cites W2070743354 @default.
• W2014639796 cites W2075793367 @default.
• W2014639796 cites W2085593164 @default.
• W2014639796 cites W2086026340 @default.
• W2014639796 cites W2089648262 @default.
• W2014639796 cites W2097366729 @default.
• W2014639796 cites W2104577465 @default.
• W2014639796 cites W2124220434 @default.
• W2014639796 cites W2125185555 @default.
• W2014639796 cites W2136570275 @default.
• W2014639796 cites W2137479592 @default.
• W2014639796 cites W2144955716 @default.
• W2014639796 cites W2150796809 @default.
• W2014639796 cites W2168892058 @default.
• W2014639796 cites W2169927110 @default.
• W2014639796 cites W2331805935 @default.
• W2014639796 cites W247232261 @default.
• W2014639796 cites W314786035 @default.
• W2014639796 cites W97469372 @default.
• W2014639796 doi "https://doi.org/10.1074/jbc.274.16.11220" @default.
• W2014639796 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10196209" @default.
• W2014639796 hasPublicationYear "1999" @default.
• W2014639796 type Work @default.
• W2014639796 sameAs 2014639796 @default.
• W2014639796 citedByCount "39" @default.
• W2014639796 countsByYear W20146397962012 @default.
• W2014639796 countsByYear W20146397962015 @default.
• W2014639796 crossrefType "journal-article" @default.
• W2014639796 hasAuthorship W2014639796A5036495900 @default.
• W2014639796 hasAuthorship W2014639796A5050087404 @default.
• W2014639796 hasAuthorship W2014639796A5070083610 @default.
• W2014639796 hasAuthorship W2014639796A5072472914 @default.
• W2014639796 hasAuthorship W2014639796A5077076703 @default.
• W2014639796 hasAuthorship W2014639796A5082903377 @default.
• W2014639796 hasBestOaLocation W20146397961 @default.
• W2014639796 hasConcept C104317684 @default.
• W2014639796 hasConcept C121050878 @default.
• W2014639796 hasConcept C153911025 @default.
• W2014639796 hasConcept C187882448 @default.
• W2014639796 hasConcept C19924922 @default.
• W2014639796 hasConcept C199360897 @default.
• W2014639796 hasConcept C41008148 @default.
• W2014639796 hasConcept C54355233 @default.
• W2014639796 hasConcept C70721500 @default.
• W2014639796 hasConcept C86803240 @default.
• W2014639796 hasConcept C95444343 @default.
• W2014639796 hasConceptScore W2014639796C104317684 @default.
• W2014639796 hasConceptScore W2014639796C121050878 @default.
• W2014639796 hasConceptScore W2014639796C153911025 @default.
• W2014639796 hasConceptScore W2014639796C187882448 @default.
• W2014639796 hasConceptScore W2014639796C19924922 @default.
• W2014639796 hasConceptScore W2014639796C199360897 @default.
• W2014639796 hasConceptScore W2014639796C41008148 @default.
• W2014639796 hasConceptScore W2014639796C54355233 @default.
• W2014639796 hasConceptScore W2014639796C70721500 @default.
• W2014639796 hasConceptScore W2014639796C86803240 @default.
• W2014639796 hasConceptScore W2014639796C95444343 @default.
• W2014639796 hasIssue "16" @default.
• W2014639796 hasLocation W20146397961 @default.
• W2014639796 hasOpenAccess W2014639796 @default.
• W2014639796 hasPrimaryLocation W20146397961 @default.
• W2014639796 hasRelatedWork W2040703702 @default.
• W2014639796 hasRelatedWork W2044797713 @default.
• W2014639796 hasRelatedWork W2327056875 @default.
• W2014639796 hasRelatedWork W2352038341 @default.
• W2014639796 hasRelatedWork W2379068255 @default.
• W2014639796 hasRelatedWork W2896567360 @default.
• W2014639796 hasRelatedWork W3096554622 @default.
• W2014639796 hasRelatedWork W3200415547 @default.
• W2014639796 hasRelatedWork W629843366 @default.
• W2014639796 hasRelatedWork W3097729625 @default.
• W2014639796 hasVolume "274" @default.

• next