FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2014659898> ?p ?o ?g. }

• W2014659898 endingPage "27779" @default.
• W2014659898 startingPage "27773" @default.
• W2014659898 abstract "Insulin increases expression of somatostatin-chloramphenicol acetyltransferase (CAT) constructs 10-fold and thymidine kinase-CAT constructs 5-fold in GH4 cells. These responses are similar to our previously reported data on insulin-increased prolactin-CAT expression. They are also observed in HeLa cells and are thus not cell type specific. The evidence suggests that the insulin responsiveness of these genes is mediated by an Ets-related transcription factor. First, linker-scanning mutations and/or deletions of the prolactin, somatostatin, and thymidine kinase promoters suggest that their insulin responsiveness is mediated by the sequence CGGA. This sequence is identical with the response element of the Ets-related transcription factors. Second, CGGA-containing sequences placed at -88 in the ΔMTV-CAT reporter plasmid conferred insulin responsiveness to the mammary tumor virus promoter. Third, expression of the DNA-binding domain of c-Ets-2, which acts by blocking effects mediated by Ets-related transcription factors, inhibits the response of these promoters to insulin. Finally, the Ets-related proteins Sap and Elk-1 bind to the prolactin, somatostatin, and thymidine kinase insulin-response elements. An Ets-like element was found in all insulin-sensitive promoters examined and may serve a similar function in those promoters. Insulin increases expression of somatostatin-chloramphenicol acetyltransferase (CAT) constructs 10-fold and thymidine kinase-CAT constructs 5-fold in GH4 cells. These responses are similar to our previously reported data on insulin-increased prolactin-CAT expression. They are also observed in HeLa cells and are thus not cell type specific. The evidence suggests that the insulin responsiveness of these genes is mediated by an Ets-related transcription factor. First, linker-scanning mutations and/or deletions of the prolactin, somatostatin, and thymidine kinase promoters suggest that their insulin responsiveness is mediated by the sequence CGGA. This sequence is identical with the response element of the Ets-related transcription factors. Second, CGGA-containing sequences placed at -88 in the ΔMTV-CAT reporter plasmid conferred insulin responsiveness to the mammary tumor virus promoter. Third, expression of the DNA-binding domain of c-Ets-2, which acts by blocking effects mediated by Ets-related transcription factors, inhibits the response of these promoters to insulin. Finally, the Ets-related proteins Sap and Elk-1 bind to the prolactin, somatostatin, and thymidine kinase insulin-response elements. An Ets-like element was found in all insulin-sensitive promoters examined and may serve a similar function in those promoters. The mechanisms involved in the regulation of gene expression by insulin are not well characterized. Insulin-induced alterations in the steady-state levels of numerous mRNAs have been documented(1Meisler M.H. Howard G. Annu. Rev. Physiol. 1989; 51: 701-714Google Scholar). For several genes including phosphoenolpyruvate carboxykinase(2Magnuson M. Quinn P. Granner D. J. Biol. Chem. 1987; 262: 14917-14920Google Scholar), glyceraldehyde 3-phosphate dehydrogenase(3Nazrin N. Ercolani L. Denaro M. Kong X. Kang I. Alexander M. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 5273-5277Google Scholar), growth hormone(4Prager D. Yamashita S. Melmed S. Endocrinology. 1988; 122: 2946-2952Google Scholar), and prolactin(5Stanley F. J. Biol. Chem. 1988; 263: 13443-13448Google Scholar), it has been established that these alterations are due to effects of insulin on the rate of transcription and not to effects on mRNA half-life or processing(1Meisler M.H. Howard G. Annu. Rev. Physiol. 1989; 51: 701-714Google Scholar). The effects of hormones on transcription are mediated through response elements in the promoters of genes. Several response elements may exist for a particular hormone that differs slightly in sequence or orientation, perhaps to allow for fine tuning of the hormonal response or for interaction with different tissue-specific factors. However, these elements are sufficiently similar to be recognized by the hormone-activated transcription factors and are thus said to form a consensus response element. The consensus hormone response element for cAMP-activated genes is the sequence TGACGTCA(6Montminy M. Sevarino K. Wagner J. Mandel G. Goodman R. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 6682-6686Google Scholar), while the thyroid-retinoid response element is a direct repeat of the sequence AGGTCA with varying numbers of intervening bases that determine hormone receptor specificity(7Umesono K. Evans R.M. Cell. 1989; 57: 1139-1146Google Scholar). A specific sequence comprising an insulin response element has been identified only for a small proportion of insulin-responsive genes. Comparison of these insulin response elements has not revealed sequence homologies that could constitute a consensus insulin response element(8Jacob K. Stanley F. J. Biol. Chem. 1994; 269: 25515-25520Google Scholar). The transcription factors that mediate responses to insulin have not been characterized. The putative insulin response element of the glyceraldehyde 3-phosphate dehydrogenase gene was identified by binding of an insulin-regulated protein to a specific sequence in the glyceraldehyde 3-phosphate dehydrogenase promoter. A protein that binds to this sequence has been cloned and is identical to the product of the testis determining gene, SRY(9Nasrin N. Buggs C. Kong X. Carnazza J. Goebl M. Alexander-Bridges M. Nature. 1991; 354: 317-320Google Scholar). However, its role in the activation of glyceraldehyde 3-phosphate dehydrogenase gene expression by insulin was not further established. We previously identified an insulin response element in the prolactin promoter(8Jacob K. Stanley F. J. Biol. Chem. 1994; 269: 25515-25520Google Scholar). This insulin response element overlaps the cAMP response element of the prolactin gene TGACGGAA. However, mutagenesis and deletional analysis revealed that the insulin response element was separable from the cAMP response element and consisted of a direct repeat of the sequence CGGAAA. This sequence is identical to sequences that bind the Ets family of transcription factors. These studies report the identification of insulin response elements in the somatostatin and herpes simplex virus thymidine kinase genes that, together with the previously identified insulin response element of the prolactin gene, define a consensus insulin response element. The consensus sequence is identical to known binding sites for Ets-related transcription factors, and an Ets-factor inhibitor was found to inhibit insulin activation of all three promoters. The Ets-related proteins Sap-1 and Elk-1 specifically bind to these sequences. [32P]dCTP, 3000 Ci/mmol, and [14C]chloramphenicol, 50 mCi/mmol, were obtained from ICN Biochemical Corp. Reagents and Taq polymerase for polymerase chain reaction were from Cetus. All other enzymes and linkers were obtained from either New England Biolabs or from Boehringer Mannheim and, unless otherwise indicated, were used under conditions recommended by the suppliers. Oligonucleotides were purchased from Operon. Duplex poly(dI•dC) was obtained from Pharmacia Biotech Inc. Reagents used for gel electrophoresis were purchased from Fisher. Acetyl-CoA and silica gel plates for thin layer chromatography were obtained from Sigma. Dulbecco's modified Eagle's medium containing 4.5 g/l glucose (DMEM) 1The abbreviations used are: DMEMDulbecco's modified Eagle's mediumCATchloramphenicol acetyltransferaseSRFserum response factorbpbase pair(s)TKthymidine kinaseSSsomatostatin. was from Life Technologies, Inc., and iron-supplemented calf serum was obtained from Hyclone Laboratories. Triton X-100 and BCA reagent were from Pierce. All other reagents were of the highest purity available and were obtained from Sigma, Behring Diagnostics, Bio-Rad, Eastman, Fisher, or Boehringer Mannheim. Dulbecco's modified Eagle's medium chloramphenicol acetyltransferase serum response factor base pair(s) thymidine kinase somatostatin. The construction of pPrl-CAT plasmids containing -173/+75 of prolactin 5′-flanking DNA was described(5Stanley F. J. Biol. Chem. 1988; 263: 13443-13448Google Scholar). The vector pBLCAT2 (10Luckow B. Schutz G. Nucleic Acids Res. 1987; 15: 5490Google Scholar) was obtained from G. Schutz (Institut fur Zell- und Tumorbiologie, Heidelberg, Federal Republic of Germany). A plasmid containing the 5′-region of the prolactin gene from the Sprague-Dawley rat was the generous gift of Dr. J. Gorski (University of Wisconsin) (11Weber J.L. Durrin L.K. Gorski J. Mol. Cell. Biochem. 1984; 65: 171-179Google Scholar). The plasmid (AP1)3 CAT was the gift of Dr. T. Curran (Roche Institute, Nutley, NJ)(12Sonnenberg J. Rauscher III, F. Morgan J. Curran T. Science. 1989; 246: 1622-1625Google Scholar). This plasmid contains three concatamerized AP1 sites from the human metallothionine IIA gene fused to the SV40 early promoter. The α(-846/+44)CAT was from Dr. J. L. Jameson (Case Western Reserve, Cleveland, OH)(13Drust D. Troccoli N. Jameson J. Mol. Endocrinol. 1991; 5: 1541-1551Google Scholar). This plasmid contains -846 bp of the human glycoprotein hormone α gene that contains two cAMP response elements. The plasmid Pit-1(-738/+11)CAT, containing two cAMP-responsive sequences (-210/-142), was described previously(14Jong M. Mol. Endocrinol. 1994; 8: 1320-1327Google Scholar). Deletion and linker-scanning mutants of the thymidine kinase promoter were a generous gift of Dr. S. L. McKnight (Tularik, South San Francisco)(15McKnight S. Kingsbury R. Science. 1982; 217: 316-324Google Scholar). These were recloned into pUC 8 as described (16Park H.-Y. Davidson D. Raaka B. Samuels H. Mol. Endocrinol. 1993; 7: 319-330Google Scholar). The plasmid TK(-95/+56ΔBamHI)CAT was made by digesting TK(-95/+56)CAT with BamHI to linearize the plasmid at the 5′-end of the thymidine kinase promoter. This was then treated with mung bean nuclease to create flush ends, and the plasmid was recircularized by blunt end ligation. The plasmids TK(-385/+56)CAT, TK(-218/+56)CAT, and TK(-128/+56)CAT were constructed from TK(ls+5/+15ΔBamHI)CAT. First, TK(ls+5/+15)CAT was digested with BamHI, blunt ended with mung bean nuclease, and religated to form TK(ls+5/+15ΔBamHI)CAT. HindIII-AccI (TK(-385/+56)CAT), HindIII-PstI (TK(-218/+56)CAT), and HindIII-NspI (TK(-128/+56)CAT) deletions were made from this plasmid. The plasmids SS(-71/+80)CAT and SS(-48/+80)CAT were gifts of Dr. R. H. Goodman (Oregon Health Sciences University, Portland, OR)(6Montminy M. Sevarino K. Wagner J. Mandel G. Goodman R. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 6682-6686Google Scholar). SS(-71/-1)CAT and SS(-48/-1)CAT were prepared by polymerase chain reaction using the SS(-71/+80)CAT as a template. The universal primer served as the sense primer. The antisense primer used was (5′-GCTCTCGAGCTCTCCACGGTCTCC-3′). This adds an XhoI restriction site at -1 of the somatostatin promoter. The polymerase chain reaction product was digested with XbaI (there is an XbaI site in SS(-71/+80)CAT in the polylinker) and XhoI and then ligated into XbaI-XhoI digested and dephosphorylated pBLCAT3. The plasmid SS(-71/+80Etsmut)CAT was prepared by ligating an 82-bp duplex oligonucleotide with G→C point mutations of each of the three potential Ets-response elements in the 5′-untranslated region of the somatostatin gene into the XhoI site of SS(-71/-1)CAT. These mutations converted three GGA motifs into GCA sequences that are not Ets binding sites. The plasmid SS(-71/-1,+23/+80)CAT was made by deleting +1/+22 of SS(-71/+80Etsmut)CAT with XhoI/PstI. This results in a plasmid in which the first two potential Ets-binding sites have been deleted and the third (+43/+46) has a G→C mutation at +45. The plasmid SS(-71/-1,+7/+47)CAT was prepared by ligating a duplex oligonucleotide to the sequence +7/+47 (containing the putative insulin response element) into the XhoI site of SS(-71/-1)CAT. All plasmid constructs were verified by sequencing. A human insulin receptor expression plasmid, pRT3HIR-2 was generously provided by Dr. J. Whittaker (State University of New York at Stony Brook) (17Whittaker J. Okamoto A.K. Thys R. Bell G.I. Steiner D.F. Hoffman A.R. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5237-5241Google Scholar). Electroporation experiments and CAT assays were performed as described(18Stanley F. J. Biol. Chem. 1992; 267: 16719-16726Google Scholar). GH4 cells were plated in DMEM, which contained 10% hormone-depleted, iron-supplemented calf serum(5Stanley F. J. Biol. Chem. 1988; 263: 13443-13448Google Scholar), for 24 h and harvested with an EDTA solution, and 20-40 × 106 cells were used for each electroporation. All electroporations contained 5 μg of the plasmid pRT3HIR-2, which expresses high levels of the human insulin receptor(18Stanley F. J. Biol. Chem. 1992; 267: 16719-16726Google Scholar). This is necessary to achieve the high levels of insulin stimulation seen in these studies and is consistent with numerous other systems where cotransfection of receptors has been necessary to achieve physiological regulation of transfected genes(18Stanley F. J. Biol. Chem. 1992; 267: 16719-16726Google Scholar). Trypan blue exclusion before electroporation ranged from 95 to 99%. The voltage of the electroporation was 1550 volts. This gives trypan blue exclusion of 70-80% after electroporation. The transfected cells were then plated in multiwell dishes (Falcon Plastics) at 5 × 106 cells per 9 cm2 tissue culture well in DMEM with 10% hormone-depleted serum. Insulin was added at 1 μg/ml to the appropriate flasks. Cells were refed with DMEM with 10% hormone-depleted serum ± insulin at 24 h. After 48 h, the flasks were washed three times with normal saline and frozen. The cells were harvested in hypotonic lysis buffer using a rubber policeman. CAT enzyme activity was assayed as described(19Flug F. Copp R.P. Casanova J. Horowitz Z.D. Janocko L. Plotnick M. Samuels H.H. J. Biol. Chem. 1987; 262: 6373-6382Google Scholar). Nuclear extracts used for gel mobility shift experiments were prepared from GH4 cells as described(20Stanley F.M. Mol. Endocrinol. 1989; 3: 1627-1633Google Scholar). Nuclei were disrupted with 400 mM KCl in a buffer containing 20% glycerol, 25 mM Tris, pH 8, 10 mM β-mercaptoethanol, 0.5 mM EDTA, and 0.05% Triton X-100. It was then dialyzed and stored at -70 in the same buffer containing 100 mM KCl. Sap-1, Elk-1, and SRF proteins were produced using an in vitro transcription/translation system (Promega). The plasmids T7 SAP1A(21Dalton S. Treisman R. Cell. 1992; 68: 597-612Google Scholar), T7 ELK 1-428(22Marais R. Wynne J. Treisman R. Cell. 1993; 73: 381-393Google Scholar), and T7 SRF ATG (23Norman C. Runswick M. Pollock R. Treisman R. Cell. 1988; 55: 989-1003Google Scholar) were used in the reactions, which were performed as recommended by the manufacturer. The oligonucleotides used for these studies showing the putative Ets-binding sites (underlined) and mutations (lower case) include 1) an oligonucleotide containing the insulin response element of the prolactin promoter (-106/-87) 5′-TCTTAATGACGGAAATAGATG-3′, 2) the putative insulin-responsive area of the somatostatin promoter (-7/-47) 5′-GAAGGAGACGCTACTGGAGTCGTCTCTAGAGCCTGCGGACG-3′, 3) an 82-bp mutant of this sequence (+1/+80 mutated) 5′-GGCGGCTGAAGcAGACGCTACTGcAGTCGTCTCTGCCGCCTGCGcACCTGCGTCTAGACTGACCCACCGCGCTCAAG-3′, 4) the sequence of the wild type thymidine kinase promoter from -22/-2 5′-AAGGTGACGCGTGTGGCCTCG-3′, and 5) the corresponding mutant sequence from the insulin-responsive linker-scanning mutant of the thymidine kinase promoter TK(ls-21/-12)CAT and ΔMTV(TKb)CAT (5′-ccGGatcCGCGTGTGGCCTCG-3′). These were purified on polyacrylamide gels, annealed, and either end labeled with [32P]dCTP or filled in with unlabeled deoxyribonucleotides using the Klenow reaction. These labeled oligonucleotides were then used in gel mobility shift experiments performed as described(20Stanley F.M. Mol. Endocrinol. 1989; 3: 1627-1633Google Scholar). 2 μg of nuclear extract or 2 μl of in vitro transcribed and translated Sap-1 or Elk-1 were incubated at 25°C for 30 min with 10,000 cpm (10-20 fmol) of the 32P-labeled oligonucleotide. The protein-DNA complexes were then analyzed by electrophoresis on a 5% polyacrylamide gel in Tris-acetate-EDTA buffer. The observation that the insulin and cAMP response elements of the prolactin gene were composed of overlapping sequences (8Jacob K. Stanley F. J. Biol. Chem. 1994; 269: 25515-25520Google Scholar) suggested that other cAMP-responsive genes might be insulin responsive. A comparison of such sequences might suggest a consensus insulin response element. We therefore tested a number of cAMP-responsive promoter-CAT constructs in GH4 cells to determine if these were also insulin responsive (Fig. 1). The Pit-1(-738/+11)CAT, α(-846/+44)CAT, and (AP1)3CAT are not significantly affected by insulin incubation (Fig. 1). However, somatostatin(-71/+80)CAT expression increased 8-fold in response to insulin, and TK(-95/+56)CAT expression increased 6-fold in response to insulin. Insulin also activates expression of Prl(-173/+75)CAT, SS(-71/+80)CAT, and TK(-95/+56)CAT in HeLa cells (Fig. 2). Low levels of Prl(-173/+75)CAT expression are increased 16-fold in HeLa cells in response to insulin. SS(-71/+80)CAT is increased 10-fold and TK(-95/+56)CAT is increased 4-fold in HeLa cells in response to insulin. As in GH4 cells, the expression of CAT is not increased by insulin using plasmids containing the Pit-1 promoter, glycoprotein hormone α-subunit promoter, or the repeated AP1 element. These data indicate that the effects of insulin to increase transcription of these three genes is not unique to the GH cells. A panel of deletion and linker-scanning mutants was used in GH4 cells to identify the insulin response element of the thymidine kinase promoter. Deletion of 5′ sequences to -46 (TK(-46/+56)CAT, Fig. 3) reduced the insulin-increased expression of CAT to 3-fold but did not eliminate it. The 3′-deletion plasmid TK(-725/-7)CAT (Fig. 3) was stimulated 6-fold by insulin, but the plasmid TK(-725/-16)CAT was not stimulated by insulin. Thus, it appeared that the insulin-responsive sequences were likely located between -46 and -7. However, linker-scanning mutants to this region (TK(ls-46/-36)CAT, TK(ls-42/-32)CAT, TK(ls-28/-18)CAT, TK(ls-21/-12)CAT, and TK(ls-16/-6)CAT) (Fig. 3) showed a loss of insulin-increased CAT expression only with the plasmid TK(ls-28/-18)CAT. This mutation deletes the TATA element and was reported to reduce basal expression from this promoter(15McKnight S. Kingsbury R. Science. 1982; 217: 316-324Google Scholar). Further, this deletion also eliminates the cAMP-mediated increase in thymidine kinase-CAT expression despite the absence of a cAMP response element. For example, the construct TK(ls-7/+3)CAT is stimulated 9.9 ± 2.3-fold by cAMP, while cAMP increases expression only 1.4 ± 0.29-fold using TK(ls-28/-18)CAT. Thus, this sequence does not likely represent the insulin-responsive element of the thymidine kinase gene. Comparison of the thymidine kinase gene with the insulin response element of the prolactin gene identified a sequence at -151/-146 that contained the sequence CCGGAA. This sequence is present in all of the 3′-deletion mutants. The 5′-deletion mutants lack the putative wild type insulin response element, but they all have a BamHI restriction site containing the sequence CGGA at their 5′-ends. The linker used to generate the linker-scanning mutants is also a BamHI restriction sequence that has been shown to act as a response element for the Ets-related transcription factors(24Treisman R. Marais R. Wynne J. EMBO J. 1992; 11: 4631-4640Google Scholar). If the BamHI site confers insulin responsiveness to the 5′-thymidine kinase-CAT deletion plasmids, then mutation of the BamHI site upstream of -95 in the plasmid TK(-95/+56)CAT should eliminate the insulin responsiveness of this plasmid. This BamHI site (CGGA) is removed in the plasmid TK(-95/+56ΔBamHI)CAT, and CAT expression is not increased by insulin using this reporter (Fig. 3). Thus, the insulin response element of the 5′-deletion mutants is the BamHI linker. To further confirm that the BamHI linker sequence used to make the linker-scanning plasmids was sufficient to mediate the effects of insulin on thymidine kinase-CAT expression, the linker sequence from the plasmid TK(ls-21/-12)CAT between -22 and -2, containing the CCGGAA motif, was cloned into ΔMTV-CAT in both the normal and inverted orientation to create ΔMTV(TKb)CAT and ΔMTV(TKbi)CAT (Fig. 4, top). Insulin did not affect CAT expression from ΔMTV(TKa)CAT and ΔMTV(TKai)CAT that contain the -22/-2 sequence from the wild type thymidine kinase gene in both the normal and inverted orientation (Fig. 4, bottom). In contrast, insulin increases CAT expression 6-fold in ΔMTV(TKb)CAT and ΔMTV(TKbi)CAT that contain the CGGA sequence. The deletion mutants shown in Fig. 5 address the possibility that the insulin response element of the native thymidine kinase promoter is the CCGGAA sequence located at -151/-146. The linker-scanning plasmid TK(ls+5/+15)CAT was used to make 5′-deletions of the thymidine kinase promoter since the 3′-deletion plasmids all have a 3′-CGGA sequence as a result of their construction. First, the BamHI site in the linker was removed with mung bean nuclease to create the plasmid TK(ls+5/+15ΔBamHI)CAT. The remaining plasmid contains the thymidine kinase promoter between -725 and +56. Insulin increases CAT expression 5-fold using this plasmid. Deletion to -385 (TK(-385/+56)CAT, Fig. 5) did not reduce the increase in CAT expression due to insulin. A further deletion to -218 (TK(-218/+15)CAT, Fig. 5) eliminates 5 potential Ets-binding sites including 2 CGGA sequences between -385 and -250, but this did not reduce the insulin-mediated increase in CAT production with this construct. Finally, a deletion to -128 (TK(-128/+56)CAT, Fig. 5), which eliminates the CCGGAA at -151/-147, renders the thymidine kinase promoter insensitive to insulin. Analysis of several deletion constructs suggests that the insulin response element of the somatostatin gene may be located in the 5′-untranslated region (Fig. 6A). Deletion of 5′ sequences to -48 were previously shown to reduce the cAMP responsiveness of this promoter by eliminating part of the cAMP response element(6Montminy M. Sevarino K. Wagner J. Mandel G. Goodman R. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 6682-6686Google Scholar). However, this deletion had no effect on insulin-increased CAT activity (Fig. 6A, SS(-48/+80)CAT). The 5′-untranslated region of the somatostatin gene is a GA-rich area that contains a CGGA sequence at +43/+46 that was similar to the insulin response element of the prolactin gene and of the insulin-responsive 5′-deletion of the thymidine kinase promoter. A somatostatin-CAT construct lacking this region SS(-71/-1)CAT was not stimulated by insulin (Fig. 6A). When the three potential Ets-binding sites were mutated in the plasmid SS(-71/+80Etsmut)CAT, the increase in CAT expression mediated by insulin was reduced by 75% (Fig. 6B). Deletion of the first two potential Ets-binding sites in the plasmid SS(-71/-1,+23/+80)CAT did not further reduce the effect of insulin (Fig. 6B). This implies that the effect of insulin is predominantly mediated by the CGGA sequence at +43/+46. Finally, the putative insulin response region (+7/+47) of the somatostatin gene was added back to the non-insulin-responsive plasmid SS(-71/-1)CAT to produce the plasmid SS(-71/-1,+7/+47)CAT. This plasmid exhibits a 7-fold increase in response to insulin (Fig. 6B). The DNA-binding domain of the Ets-related transcription factors is highly conserved, and the Ets-related transcription factors bind to each other's recognition sequences with only slightly different affinities. Thus, overexpression of the DNA-binding domain of any Ets-related protein will function as a dominant negative inhibitor of all related transcription factors. The overexpression of the DNA binding domain of c-Ets-2 has been adapted to this purpose(25Langer S.J. Bortner D.M. Roussel M.F. Sherr Jr., C. Ostrowski M.C. Mol. Cell. Biol. 1992; 12: 5355-5362Google Scholar). Fig. 7 shows the effect of expression of the c-Ets-2 DNA-binding domain on insulin and cAMP stimulation of CAT expression from the prolactin, somatostatin, and thymidine kinase promoters. The insulin stimulation of each of these promoters is reduced by 60-75% in cells overexpressing the c-Ets-2 DNA-binding domain, while cAMP-mediated increases are not significantly different. To determine if Ets-related proteins could bind to putative insulin response elements of the prolactin, somatostatin, and thymidine kinase genes, the Ets-related proteins Sap-1 and Elk-1 were used in gel mobility shift experiments with Ets-binding site-containing oligonucleotides from the insulin-responsive promoter constructs used in these experiments. The insulin response element of the prolactin gene is the Ets-binding sequence-related CGGAAA at -97/-92. Fig. 8A shows that both Elk-1 (lane 2) and Sap-1 (lane 3) but not SRF (not an Ets-related protein) (lane 4), bind to the insulin response element of the prolactin promoter. Control lysates (lane 9) demonstrate no binding in the region of the shifted band seen with Sap-1 or Elk-1. An excess of non-radiolabeled prolactin -106/-87 inhibits the formation of this complex (data not shown). Nuclear extract (lane 1), run as a control, produced a characteristic pattern of specific binding(18Stanley F. J. Biol. Chem. 1992; 267: 16719-16726Google Scholar). However, no bands equal in migration to the Sap-1 and Elk-1 retarded species were seen in nuclear extract even with longer exposures. Sap-1 appears to have higher affinity since it shifts more label to a more slowly migrating form. However, this might result from differential efficiencies of Sap-1 and Elk-1 production in the reticulocyte lysates. The shifts produced by Sap-1 and Elk-1 are indistinguishable from one another. SRF added with Elk-1 (lane 5) or Sap-1 (lane 6) slightly decreases the binding of the Ets-related member of the ternary complex. This may result from slight inhibition of binding by factors in the reticulocyte lysate. Addition of Sap-1 and Elk-1 together results in no enhancement of the shift produced by Sap-1 alone nor does it produce additional migrating forms. Sap-1 incubation with an oligonucleotide to the somatostatin promoter (Fig. 8B) produces a more slowly migrating protein-DNA complex similar to that formed with Prl-106/-87 (Fig. 8B, lane 2). An excess of non-radioactive somatostatin +7/+47 inhibits the formation of this complex (Fig. 8B, lane 8). Nuclear extract proteins also bind to the somatostatin promoter (Fig. 8B, lanes 1 and 7), but no specific interactions of comparable migration with the Sap-1-DNA complex were seen even on longer exposure (Fig. 8B, lane 1 versus lane 2). No specific binding of Sap-1 was seen using an oligonucleotide whose Ets-binding sites were mutated by a G→C conversion (compare lane 5, Sap-1, with lane 6, unprogrammed lysate) (Fig. 8B). Sap-1 binds to the thymidine kinase promoter only when it has been mutated to contain an Ets-binding site (Fig. 8C). The wild type thymidine kinase promoter (-22/-2) shows no retarded bands when labeled DNA is incubated with Sap-1 (Fig. 8C, lane 2) that are not also present with unprogrammed lysate (Fig. 8C, lane 3). The oligonucleotide TKb corresponds to the this sequence (-22/-2) that is found in the insulin-sensitive TK(ls-21/-12)CAT and MTVTKb-CAT. Incubation of Sap-1 with 32P-labeled TKb results in two retarded complexes (Fig. 8C, lane 5). These bands are not seen with unprogrammed lysate (Fig. 8C, lane 6), and they are inhibited by an excess of unlabeled TKb (Fig. 8C, lane 8). Again, no specific bands corresponding to the Sap-1 shifted DNA are seen using nuclear extract (Fig. 8C, lane 4). Multiple lines of evidence presented here and previously (8Jacob K. Stanley F. J. Biol. Chem. 1994; 269: 25515-25520Google Scholar) indicate that the sequence CGGA is a consensus response element for insulin effects in GH and HeLa cells. First, deletion and linker-scanning mutants of the prolactin promoter identified the sequence CGGAAA as essential for the insulin effect on the prolactin promoter, and this sequence could confer insulin responsiveness to ΔMTV-CAT(8Jacob K. Stanley F. J. Biol. Chem. 1994; 269: 25515-25520Google Scholar). Second, the expression of CAT from several CGGA containing linker-scanning and deletion mutants of the thymidine kinase promoter is increased by insulin. When this linker sequence is inactivated, as in the plasmid TK(-95/+56ΔBamHI)CAT, insulin responsiveness is lost. The CGGA-containing sequence from one of the linker-scanning mutants was shown to confer insulin sensitivity when inserted into ΔMTV-CAT. Finally, CAT expression from a somatostatin promoter construct is also increased by insulin. Deletions that inactivate the cAMP response element of this gene have no effect on insulin regulation. However, deletion of sequences in the 5′-untranslated region of the gene, containing three Ets-binding motifs, eliminates the increased expression mediated by insulin. Point mutation of these motifs reduces the effect of insulin 75%, and a 24-bp deletion that removes the first 2 of these motifs completely eliminates the effect of insulin. When the three motifs are added back to the insulin-insensitive plasmid SS(-71/-1)CAT, the effect of insulin is restored. These effects are seen both in GH cells and in HeLa cells. Thus, the presence of one or more CGGA sites in the proximal promoter region confers insulin responsiveness in these cell lines. The effect of insulin to increase gene expression can be mediated by one copy of the insulin response element. The constructs ΔMTV(Prl-106/-77)CAT and ΔMTV(TKb)CAT are stimulated 4- and 6-fold by insulin, and they have only one copy of this sequence. The 5′-deletion mutants of the thymidine kinase promoter are also insulin responsive with only one copy of this sequence. However, the prolactin promoter has two Ets-related binding sequences, and the response of the prolactin promoter is approximately twice that of the thymidine kinase promoter constructs. Thus, multiple Ets motifs may mediate an increased response. This is not true of all cell lines. Chinese hamster ovary cells transfected with the prolactin-CAT constructs and an expression vector for Pit-1 show low levels of prolactin-CAT expression. However, this activity is not inducible either by insulin or cAMP. 2F. M. Stanley, unpublished observation. Thus, it appears that Chinese hamster ovary cells lack transcription factors that are both important for high basal expression of this construct and its regulated expression. The sequence CGGA is able to confer insulin sensitivity only in cells with a necessary complement of transcription factors. The involvement of Ets-related proteins in insulin-increased gene transcription is suggested by the experiment with the dominant negative Ets plasmid and by the gel shift experiments. Cotransfection of cells with a plasmid that expresses the DNA-binding domain of c-Ets-2 causes a 75% reduction in the insulin sensitivity of the prolactin, somatostatin, and thymidine kinase promoters. The Ets-related proteins Elk-1 and Sap-1 were shown to bind sequences from these promoters that are insulin sensitive but not sequences that are insulin insensitive. The location of this sequence may also be important for its ability to mediate responses to insulin. The three insulin-sensitive promoters that we have described have the insulin response element inserted close to the transcription start site, the farthest away being the putative insulin response element of the wild type thymidine kinase gene at -150. Since this sequence is not uncommon in the genome, it is likely that this sequence is only effective within the first few hundred base pairs of the transcription start site. These data allowed us to establish several criteria for screening insulin-responsive genes for potential response elements. First, the sequence GGA is key to the insulin response element. Second, preference was given to sequences containing CGGA as in the prolactin and thymidine kinase promoters, but (A/T)GGA sequences were also considered (especially as a dimer with CGGA). Third, the limits -250/+50 were established since the IRE in the somatostatin gene is in the region +1/+50, and the upstream limit was established in accord with other Ets-responsive promoters that contain Ets-binding sites in the -200/-300 region. Finally, inverse sequences were also considered since the insulin response is transferred to ΔMTV-CAT by both the normal and inverse prolactin and thymidine kinase insulin response elements. These criteria allowed us to identify potential insulin response elements in 22 genes previously reported to be insulin sensitive. The utility of this type of analysis is clear for promoters where extensive deletional analysis has defined a region that contains the insulin response sequence. For example, the insulin response element of gene 33 likely resides in the first 100 base pairs (26Cadilla C. Isham K. Lee K. Ch'ang L. Johnson A. Kenney F. Gene (Amst.). 1992; 118: 223-229Google Scholar) of the promoter. Comparison of this region of the gene 33 sequence with the consensus insulin response element identifies the sequence -93 CCGGATTGGCTGCGCGGAGG -74 that contains a direct repeat of the insulin responsive sequence (underlined). The insulin response of the c-fos promoter was mapped to the serum response element(27Stumpo D. Stewart T. Gilman M. Blackshear P. J. Biol. Chem. 1988; 263: 1611-1614Google Scholar). This sequence contains the sequence -225 GCGGAAGGTCTAGGAGA -209 that binds Elk-1. Elk-1 is an Ets-related protein that was shown to be phosphorylated by insulin. These studies do not rule out other insulin response elements, and it seems likely that there are other insulin-responsive sequences. Although all of the insulin-responsive promoters examined have sequences that are similar to the insulin response element of the prolactin promoter, the region of homology between our consensus insulin response element and the area of the gene known to be insulin sensitive does not correspond in all cases. For example, the negative insulin response element in the glucagon gene is apparently located at -268/-238, and this region does not contain a CGGAA sequence(28Philippe J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7224-7227Google Scholar). Similarly, AGGA sequences reside outside of the insulin-responsive region of the amylase gene -167/-137(29Johnson T. Rosenberg M. Meisler M. J. Biol. Chem. 1993; 268: 464-468Google Scholar). In summary, we have defined a consensus insulin response element, CGGA, that can act in several different promoter contexts and in different cell types. The activity of this response element is most likely dependent on the presence of the proper insulin response pathway and insulin-responsive transcription factors in the cells. We thank Dr. Bruce M. Raaka for critical reading of the manuscript. We thank Drs. Michele Jong, Hae-Yung Park, Richard Goodman, Steven L. McKnight, Richard Treisman, and Jonathan Whittaker for plasmids used in these studies. Computing was supported by National Science Foundation Grant DIR 8900095." @default.
• W2014659898 created "2016-06-24" @default.
• W2014659898 creator A5004153391 @default.
• W2014659898 creator A5006192791 @default.
• W2014659898 creator A5040369305 @default.
• W2014659898 date "1995-11-01" @default.
• W2014659898 modified "2023-10-13" @default.
• W2014659898 title "A Consensus Insulin Response Element Is Activated by an ETS-related Transcription Factor" @default.
• W2014659898 cites W1426173733 @default.
• W2014659898 cites W1483832727 @default.
• W2014659898 cites W1515773723 @default.
• W2014659898 cites W1550056485 @default.
• W2014659898 cites W1564906738 @default.
• W2014659898 cites W1603838026 @default.
• W2014659898 cites W1967862004 @default.
• W2014659898 cites W1982598173 @default.
• W2014659898 cites W1984700086 @default.
• W2014659898 cites W1988568219 @default.
• W2014659898 cites W2000082154 @default.
• W2014659898 cites W2012804965 @default.
• W2014659898 cites W2020672093 @default.
• W2014659898 cites W2022478055 @default.
• W2014659898 cites W2042560173 @default.
• W2014659898 cites W2042976701 @default.
• W2014659898 cites W2044907714 @default.
• W2014659898 cites W2051628416 @default.
• W2014659898 cites W2058331480 @default.
• W2014659898 cites W2063110155 @default.
• W2014659898 cites W2080021855 @default.
• W2014659898 cites W2142755108 @default.
• W2014659898 cites W2150342440 @default.
• W2014659898 cites W2151196709 @default.
• W2014659898 cites W2157589212 @default.
• W2014659898 doi "https://doi.org/10.1074/jbc.270.46.27773" @default.
• W2014659898 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7499246" @default.
• W2014659898 hasPublicationYear "1995" @default.
• W2014659898 type Work @default.
• W2014659898 sameAs 2014659898 @default.
• W2014659898 citedByCount "36" @default.
• W2014659898 countsByYear W20146598982014 @default.
• W2014659898 countsByYear W20146598982018 @default.
• W2014659898 crossrefType "journal-article" @default.
• W2014659898 hasAuthorship W2014659898A5004153391 @default.
• W2014659898 hasAuthorship W2014659898A5006192791 @default.
• W2014659898 hasAuthorship W2014659898A5040369305 @default.
• W2014659898 hasBestOaLocation W20146598981 @default.
• W2014659898 hasConcept C101762097 @default.
• W2014659898 hasConcept C104317684 @default.
• W2014659898 hasConcept C112446052 @default.
• W2014659898 hasConcept C121608353 @default.
• W2014659898 hasConcept C132376346 @default.
• W2014659898 hasConcept C134018914 @default.
• W2014659898 hasConcept C138885662 @default.
• W2014659898 hasConcept C150194340 @default.
• W2014659898 hasConcept C153911025 @default.
• W2014659898 hasConcept C167625842 @default.
• W2014659898 hasConcept C179926584 @default.
• W2014659898 hasConcept C185967709 @default.
• W2014659898 hasConcept C2522874641 @default.
• W2014659898 hasConcept C2776147627 @default.
• W2014659898 hasConcept C2777391703 @default.
• W2014659898 hasConcept C2779306644 @default.
• W2014659898 hasConcept C2780730277 @default.
• W2014659898 hasConcept C2781196997 @default.
• W2014659898 hasConcept C41895202 @default.
• W2014659898 hasConcept C51445715 @default.
• W2014659898 hasConcept C530470458 @default.
• W2014659898 hasConcept C54355233 @default.
• W2014659898 hasConcept C54985914 @default.
• W2014659898 hasConcept C69053785 @default.
• W2014659898 hasConcept C84606932 @default.
• W2014659898 hasConcept C86339819 @default.
• W2014659898 hasConcept C86803240 @default.
• W2014659898 hasConceptScore W2014659898C101762097 @default.
• W2014659898 hasConceptScore W2014659898C104317684 @default.
• W2014659898 hasConceptScore W2014659898C112446052 @default.
• W2014659898 hasConceptScore W2014659898C121608353 @default.
• W2014659898 hasConceptScore W2014659898C132376346 @default.
• W2014659898 hasConceptScore W2014659898C134018914 @default.
• W2014659898 hasConceptScore W2014659898C138885662 @default.
• W2014659898 hasConceptScore W2014659898C150194340 @default.
• W2014659898 hasConceptScore W2014659898C153911025 @default.
• W2014659898 hasConceptScore W2014659898C167625842 @default.
• W2014659898 hasConceptScore W2014659898C179926584 @default.
• W2014659898 hasConceptScore W2014659898C185967709 @default.
• W2014659898 hasConceptScore W2014659898C2522874641 @default.
• W2014659898 hasConceptScore W2014659898C2776147627 @default.
• W2014659898 hasConceptScore W2014659898C2777391703 @default.
• W2014659898 hasConceptScore W2014659898C2779306644 @default.
• W2014659898 hasConceptScore W2014659898C2780730277 @default.
• W2014659898 hasConceptScore W2014659898C2781196997 @default.
• W2014659898 hasConceptScore W2014659898C41895202 @default.
• W2014659898 hasConceptScore W2014659898C51445715 @default.
• W2014659898 hasConceptScore W2014659898C530470458 @default.
• W2014659898 hasConceptScore W2014659898C54355233 @default.
• W2014659898 hasConceptScore W2014659898C54985914 @default.
• W2014659898 hasConceptScore W2014659898C69053785 @default.
• W2014659898 hasConceptScore W2014659898C84606932 @default.

• next