FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2014860274> ?p ?o ?g. }

• W2014860274 endingPage "15820" @default.
• W2014860274 startingPage "15809" @default.
• W2014860274 abstract "Nitric oxide (NO) is a multifunctional signaling molecule and a key vasculoprotective and potential osteoprotective factor. NO regulates normal bone remodeling and pathological bone loss in part through affecting the recruitment, formation, and activity of bone-resorbing osteoclasts. Using murine RAW 264.7 and primary bone marrow cells or osteoclasts formed from them by receptor activator of NF-κB ligand (RANKL) differentiation, we found that inducible nitric-oxide synthase (iNOS) expression and NO generation were stimulated by interferon (IFN)-γ or lipopolysaccharide, but not by interleukin-1 or tumor necrosis factor-α. Surprisingly, iNOS expression and NO release were also triggered by RANKL. This response was time- and dose-dependent, required NF-κB activation and new protein synthesis, and was specifically blocked by the RANKL decoy receptor osteoprotegerin. Preventing RANKL-induced NO (via iNOS-selective inhibition or use of marrow cells from iNOS–/– mice) increased osteoclast formation and bone pit resorption, indicating that such NO normally restrains RANKL-mediated osteoclastogenesis. Additional studies suggested that RANKL-induced NO inhibition of osteoclast formation does not occur via NO activation of a cGMP pathway. Because IFN-β is also a RANKL-induced autocrine negative feedback inhibitor that limits osteoclastogenesis, we investigated whether IFN-β is involved in this novel RANKL/iNOS/NO autoregulatory pathway. IFN-β was induced by RANKL and stimulated iNOS expression and NO release, and a neutralizing antibody to IFN-β inhibited iNOS/NO elevation in response to RANKL, thereby enhancing osteoclast formation. Thus, RANKL-induced IFN-β triggers iNOS/NO as an important negative feedback signal during osteoclastogenesis. Specifically targeting this novel autoregulatory pathway may provide new therapeutic approaches to combat various osteolytic bone diseases. Nitric oxide (NO) is a multifunctional signaling molecule and a key vasculoprotective and potential osteoprotective factor. NO regulates normal bone remodeling and pathological bone loss in part through affecting the recruitment, formation, and activity of bone-resorbing osteoclasts. Using murine RAW 264.7 and primary bone marrow cells or osteoclasts formed from them by receptor activator of NF-κB ligand (RANKL) differentiation, we found that inducible nitric-oxide synthase (iNOS) expression and NO generation were stimulated by interferon (IFN)-γ or lipopolysaccharide, but not by interleukin-1 or tumor necrosis factor-α. Surprisingly, iNOS expression and NO release were also triggered by RANKL. This response was time- and dose-dependent, required NF-κB activation and new protein synthesis, and was specifically blocked by the RANKL decoy receptor osteoprotegerin. Preventing RANKL-induced NO (via iNOS-selective inhibition or use of marrow cells from iNOS–/– mice) increased osteoclast formation and bone pit resorption, indicating that such NO normally restrains RANKL-mediated osteoclastogenesis. Additional studies suggested that RANKL-induced NO inhibition of osteoclast formation does not occur via NO activation of a cGMP pathway. Because IFN-β is also a RANKL-induced autocrine negative feedback inhibitor that limits osteoclastogenesis, we investigated whether IFN-β is involved in this novel RANKL/iNOS/NO autoregulatory pathway. IFN-β was induced by RANKL and stimulated iNOS expression and NO release, and a neutralizing antibody to IFN-β inhibited iNOS/NO elevation in response to RANKL, thereby enhancing osteoclast formation. Thus, RANKL-induced IFN-β triggers iNOS/NO as an important negative feedback signal during osteoclastogenesis. Specifically targeting this novel autoregulatory pathway may provide new therapeutic approaches to combat various osteolytic bone diseases. Normal bone remodeling requires a homeostatic balance between the activities of bone-forming osteoblasts and bone-resorbing osteoclasts (OCs). 3The abbreviations used are: OCs, osteoclasts; TNF, tumor necrosis factor; RANK, receptor activator of NF-κB; RANKL, RANK ligand; M-CSF, macrophage colony-stimulating factor; OPG, osteoprotegerin; IFN, interferon; iNOS, inducible nitric-oxide synthase; IL-1, interleukin-1; RAW-OCs, RAW cell-derived osteoclasts; WT, wild-type; MA-OCs, marrow cell-derived osteoclasts; TRAP, tartrate-resistant acid phosphatase; LPS, lipopolysaccharide; PMA, phorbol 12-myristate 13-acetate; CM, conditioned medium; AG, aminoguanidine; l-NIL, l-N6-(1-iminoethyl)lysine hydrochloride; NF-κB, nuclear factor-κB; PDTC, 1-pyrrolidinecarbodithioic acid; pAb, polyclonal antibody; ODQ, 1H-[1,2,4]oxadiazolo[4,3,-a]quinoxalin-1-one; (Rp)-cGMP-S, 8-(4-chlorophenylthio)guanosine 3′:5′-monophosphorothioate (Rp isomer triethylammonium salt); 8-pCPT-cGMP, 8-(4-chlorophenylthio)guanosine 3′:5′-monophosphate; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; JNK, c-Jun N-terminal kinase.3The abbreviations used are: OCs, osteoclasts; TNF, tumor necrosis factor; RANK, receptor activator of NF-κB; RANKL, RANK ligand; M-CSF, macrophage colony-stimulating factor; OPG, osteoprotegerin; IFN, interferon; iNOS, inducible nitric-oxide synthase; IL-1, interleukin-1; RAW-OCs, RAW cell-derived osteoclasts; WT, wild-type; MA-OCs, marrow cell-derived osteoclasts; TRAP, tartrate-resistant acid phosphatase; LPS, lipopolysaccharide; PMA, phorbol 12-myristate 13-acetate; CM, conditioned medium; AG, aminoguanidine; l-NIL, l-N6-(1-iminoethyl)lysine hydrochloride; NF-κB, nuclear factor-κB; PDTC, 1-pyrrolidinecarbodithioic acid; pAb, polyclonal antibody; ODQ, 1H-[1,2,4]oxadiazolo[4,3,-a]quinoxalin-1-one; (Rp)-cGMP-S, 8-(4-chlorophenylthio)guanosine 3′:5′-monophosphorothioate (Rp isomer triethylammonium salt); 8-pCPT-cGMP, 8-(4-chlorophenylthio)guanosine 3′:5′-monophosphate; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; JNK, c-Jun N-terminal kinase. Excessive OC bone resorption leads to bone loss in many skeletal pathologies such as rheumatoid arthritis, periodontal disease, postmenopausal osteoporosis, implant osteolysis, and tumor-associated bone loss (1Heymann D. Fortun Y. Redini F. Padrines M. Drug Discovery Today. 2005; 10: 242-247Crossref PubMed Scopus (18) Google Scholar). OCs develop from hematopoietic precursors that fuse and differentiate into multinucleated bone-resorbing OCs in response to the essential tumor necrosis factor (TNF) family-related signal molecule receptor activator of NF-κB (RANK) ligand (RANKL) in the presence of permissive levels of macrophage colony-stimulating factor (M-CSF) (2Lerner U. Crit. Rev. Oral Biol. Med. 2004; 15: 64-81Crossref PubMed Scopus (114) Google Scholar, 3Hofbauer L. Heufelder A. J. Mol. Med. 2001; 79: 243-253Crossref PubMed Scopus (497) Google Scholar). RANKL expressed on the surface of osteoblasts, bone marrow stromal cells, or vascular endothelial cells or secreted by activated T cells directly engages a membrane receptor, RANK, on OC precursors and mature OCs to trigger multiple intracellular signaling cascades that stimulate OC gene expression, development, function, and survival (2Lerner U. Crit. Rev. Oral Biol. Med. 2004; 15: 64-81Crossref PubMed Scopus (114) Google Scholar, 3Hofbauer L. Heufelder A. J. Mol. Med. 2001; 79: 243-253Crossref PubMed Scopus (497) Google Scholar). RANKL/RANK interactions are specifically blocked by osteoprotegerin (OPG), a soluble decoy receptor released by osteoblast, stromal, vascular endothelial, and other cells that binds RANKL to inhibit OC formation and bone resorption in vivo and in vitro (2Lerner U. Crit. Rev. Oral Biol. Med. 2004; 15: 64-81Crossref PubMed Scopus (114) Google Scholar, 3Hofbauer L. Heufelder A. J. Mol. Med. 2001; 79: 243-253Crossref PubMed Scopus (497) Google Scholar, 4Kostenuik P. Shalhoub V. Curr. Pharm. Des. 2001; 7: 613-635Crossref PubMed Scopus (183) Google Scholar). The RANKL/OPG ratio critically determines net effects on OC formation and bone resorption, and increases in this ratio due to various inflammatory or proresorptive stimuli have been shown to significantly contribute to pathological bone loss in multiple skeletal disorders. Interestingly, although clearly essential for promoting OC formation and activity, RANKL was found recently to also trigger an autocrine negative feedback pathway in OC precursors that ultimately limits the extent of osteoclastogenesis concurrently stimulated by RANKL (5Takayanagi H. Kim S. Matsuo K. Suzuki H. Suzuki T. Sato K. Yokochi T. Oda H. Nakamura K. Ida N. Wagner E. Taniguchi T. Nature. 2002; 416: 744-749Crossref PubMed Scopus (584) Google Scholar, 6Hayashi T. Kaneda T. Toyama Y. Kumegawa M. Hakeda Y. J. Biol. Chem. 2002; 277: 27880-27886Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). This negative feedback pathway involves RANKL induction of interferon (IFN)-β in a c-Fos-dependent manner, followed by IFN-β inhibition of RANKL-induced c-Fos expression necessary for OC formation (5Takayanagi H. Kim S. Matsuo K. Suzuki H. Suzuki T. Sato K. Yokochi T. Oda H. Nakamura K. Ida N. Wagner E. Taniguchi T. Nature. 2002; 416: 744-749Crossref PubMed Scopus (584) Google Scholar).OC formation and bone resorption are also inhibited by elevated levels of the multifunctional signal molecule nitric oxide (NO) in vivo and in vitro (7MacIntyre I. Zaidi M. Alam A. Datta H. Moonga B. Lidbury P. Hecker M. Vane J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 2936-2940Crossref PubMed Scopus (290) Google Scholar, 8Kasten T. Collin-Osdoby P. Patel N. Osdoby P. Krukowski M. Misko T. Settle S. Currie M. Nickols G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3569-3573Crossref PubMed Scopus (229) Google Scholar, 9Brandi M. Hukkanen M. Umeda T. Moradi-Bidhendi N. Bianchi S. Gross S. Polak J. MacIntyre I. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2954-2958Crossref PubMed Scopus (194) Google Scholar, 10Ralston S. Grabowski P. Bone. 1996; 19: 29-33Crossref PubMed Scopus (78) Google Scholar, 11Holliday L. Dean A. Lin R. Greenwald J. Gluck S. Am. J. Physiol. 1997; 272: F283-F291PubMed Google Scholar, 12Sunyer T. Rothe L. Kirsch D. Jiang X. Anderson F. Osdoby P. Collin-Osdoby P. Endocrinology. 1997; 138: 2148-2162Crossref PubMed Scopus (33) Google Scholar, 13Collin-Osdoby P. Rothe L. Bekker S. Anderson F. Osdoby P. J. Bone Miner. Res. 2000; 15: 474-488Crossref PubMed Scopus (61) Google Scholar). NO is produced from l-arginine in an oxidative reaction catalyzed by NO synthase isoenzymes that are either constitutively expressed and calcium-activated (endothelial and neuronal NO synthase isoforms) or transcriptionally induced (inducible NO synthase (iNOS) isoform) in response to inflammatory stimuli (14Griffith O. Stuehr D. Annu. Rev. Physiol. 1995; 57: 707-736Crossref PubMed Google Scholar). Previously, our group (8Kasten T. Collin-Osdoby P. Patel N. Osdoby P. Krukowski M. Misko T. Settle S. Currie M. Nickols G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3569-3573Crossref PubMed Scopus (229) Google Scholar, 12Sunyer T. Rothe L. Kirsch D. Jiang X. Anderson F. Osdoby P. Collin-Osdoby P. Endocrinology. 1997; 138: 2148-2162Crossref PubMed Scopus (33) Google Scholar, 15Sunyer T. Rothe L. Jiang X. Osdoby P. Collin-Osdoby P. J. Cell. Biochem. 1996; 60: 469-483Crossref PubMed Scopus (68) Google Scholar) and others (9Brandi M. Hukkanen M. Umeda T. Moradi-Bidhendi N. Bianchi S. Gross S. Polak J. MacIntyre I. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2954-2958Crossref PubMed Scopus (194) Google Scholar, 16Silverton S. Mesaros S. Markham G. Malinski T. Endocrinology. 1995; 136: 5244-5247Crossref PubMed Google Scholar) have shown that OCs and related OC-like cells (as well as other bone cells) express iNOS and release NO in a regulated manner. NO produced endogenously or supplied by NO donors exerts potent biphasic actions that profoundly affect the recruitment, proliferation, differentiation, activity, and/or survival of OCs and osteoblasts, their precursors, and other cells within bone (8Kasten T. Collin-Osdoby P. Patel N. Osdoby P. Krukowski M. Misko T. Settle S. Currie M. Nickols G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3569-3573Crossref PubMed Scopus (229) Google Scholar, 11Holliday L. Dean A. Lin R. Greenwald J. Gluck S. Am. J. Physiol. 1997; 272: F283-F291PubMed Google Scholar, 17Chae H. Park R. Chung H. Kang J. Kim M. Choi D. Bang B. Kim H. J. Pharm. Pharmacol. 1997; 49: 897-902Crossref PubMed Scopus (87) Google Scholar, 18van't Hof R. Ralston S. Immunology. 2001; 103: 255-261Crossref PubMed Scopus (432) Google Scholar). Whereas low levels of NO may support osteoblast bone formation and OC-mediated bone remodeling (both basal and cytokine-induced) (9Brandi M. Hukkanen M. Umeda T. Moradi-Bidhendi N. Bianchi S. Gross S. Polak J. MacIntyre I. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2954-2958Crossref PubMed Scopus (194) Google Scholar, 19Ralston S. Ho L. Helfrich M. Grabowski P. Johnston P. Benjamin N. J. Bone Miner. Res. 1995; 10: 1040-1049Crossref PubMed Scopus (211) Google Scholar, 20Jamal S. Browner W. Bauer D. Cummings S. J. Bone Miner. Res. 1998; 13: 1755-1759Crossref PubMed Scopus (113) Google Scholar, 21Chole R. Tinling S. Leverentz E. McGinn M. Acta Otolaryngol. 1998; 118: 705-711Crossref PubMed Scopus (18) Google Scholar, 22van't Hof R. Armour K. Smith L. Armour K. Wei X. Liew F. Ralston S. Proc. Natl. Acad. Sci. U. S. A. 2000; 14: 7993-7998Crossref Scopus (129) Google Scholar), high NO levels and NO-generating compounds inhibit OC formation and bone resorption and prevent bone loss, for example, in severe inflammation or estrogen-deficient animals (8Kasten T. Collin-Osdoby P. Patel N. Osdoby P. Krukowski M. Misko T. Settle S. Currie M. Nickols G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3569-3573Crossref PubMed Scopus (229) Google Scholar, 10Ralston S. Grabowski P. Bone. 1996; 19: 29-33Crossref PubMed Scopus (78) Google Scholar, 11Holliday L. Dean A. Lin R. Greenwald J. Gluck S. Am. J. Physiol. 1997; 272: F283-F291PubMed Google Scholar, 12Sunyer T. Rothe L. Kirsch D. Jiang X. Anderson F. Osdoby P. Collin-Osdoby P. Endocrinology. 1997; 138: 2148-2162Crossref PubMed Scopus (33) Google Scholar, 13Collin-Osdoby P. Rothe L. Bekker S. Anderson F. Osdoby P. J. Bone Miner. Res. 2000; 15: 474-488Crossref PubMed Scopus (61) Google Scholar, 17Chae H. Park R. Chung H. Kang J. Kim M. Choi D. Bang B. Kim H. J. Pharm. Pharmacol. 1997; 49: 897-902Crossref PubMed Scopus (87) Google Scholar, 18van't Hof R. Ralston S. Immunology. 2001; 103: 255-261Crossref PubMed Scopus (432) Google Scholar, 19Ralston S. Ho L. Helfrich M. Grabowski P. Johnston P. Benjamin N. J. Bone Miner. Res. 1995; 10: 1040-1049Crossref PubMed Scopus (211) Google Scholar, 20Jamal S. Browner W. Bauer D. Cummings S. J. Bone Miner. Res. 1998; 13: 1755-1759Crossref PubMed Scopus (113) Google Scholar, 21Chole R. Tinling S. Leverentz E. McGinn M. Acta Otolaryngol. 1998; 118: 705-711Crossref PubMed Scopus (18) Google Scholar, 22van't Hof R. Armour K. Smith L. Armour K. Wei X. Liew F. Ralston S. Proc. Natl. Acad. Sci. U. S. A. 2000; 14: 7993-7998Crossref Scopus (129) Google Scholar, 23Wimalawansa S. Calcif. Tissue Int. 2000; 66: 56-60Crossref PubMed Scopus (50) Google Scholar, 24van't Hof R. Ralston S. J. Bone Miner. Res. 1997; 12: 1797-1804Crossref PubMed Scopus (129) Google Scholar). Conversely, iNOS deficiency or pharmacological inhibition of NO can accelerate OC formation and bone resorption in vivo and in vitro, decrease normal bone mass, exacerbate bone destruction in arthritis or osteoporosis models, and interfere with normal fracture healing (23Wimalawansa S. Calcif. Tissue Int. 2000; 66: 56-60Crossref PubMed Scopus (50) Google Scholar, 25Tsukahara H. Miura M. Tsuchida S. Hata I. Hata K. Yamamoto K. Ishii Y. Muramatsu I. Sudo M. Am. J. Physiol. 1996; 270: E840-E845PubMed Google Scholar, 26McCartney-Francis N. Song X. Mizel D. Wahl S. J. Immunol. 2001; 166: 2734-2740Crossref PubMed Scopus (126) Google Scholar, 27Veihelmann A. Landes J. Hofbauer A. Dorger M. Refior H. Messmer K. Krombach F. Arthritis Rheum. 2001; 44: 1420-1427Crossref PubMed Scopus (42) Google Scholar, 28Diwan A. Wang M. Jang D. Zhu W. Murrell G. J. Bone Miner. Res. 2000; 15: 342-351Crossref PubMed Scopus (138) Google Scholar). On the other hand, iNOS-derived NO has been found in some studies to mediate bone loss in ovariectomized mice, interleukin-1 (IL-1)-induced OC resorption, and TNF-dependent OC survival (22van't Hof R. Armour K. Smith L. Armour K. Wei X. Liew F. Ralston S. Proc. Natl. Acad. Sci. U. S. A. 2000; 14: 7993-7998Crossref Scopus (129) Google Scholar, 29Cuzzocrea S. Mazzon E. Dugo L. Genovese T. Di Paola R. Ruggeri Z. Vegeto E. Caputi A. Van de Loo R. Puzzolo D. Maggi A. Endocrinology. 2003; 144: 1098-1107Crossref PubMed Scopus (68) Google Scholar, 30Lee S. Huang H. Lee S. Kim K. Kim K. Kim H. Lee Z. Kim H. Exp. Cell Res. 2004; 298: 359-368Crossref PubMed Scopus (42) Google Scholar). A deeper understanding of NO regulation and actions in bone is needed, especially as NO modulators are currently being evaluated in clinical trials as osteoprotective agents. Here, we report our unexpected discovery that OC precursor cells developing in response to RANKL up-regulate iNOS expression and NO release in a persistent manner. This RANKL-induced iNOS-derived NO functions as a negative feedback signal to limit osteoclastogenesis concurrently stimulated by RANKL. On the basis of such findings, we therefore further investigated whether RANKL-induced IFN-β might somehow interface with RANKL-induced NO in this novel autocrine inhibitory feedback pathway.EXPERIMENTAL PROCEDURESCell Culture and OC Differentiation—Murine RAW 264.7 cells (3.5 × 105 cells/well in 24-well plates) were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, passaged, and differentiated into bone pit-resorbing OCs (RAW-OCs) by treatment with soluble recombinant murine RANKL (35 ng/ml, prepared in house, given daily with refeeding) for 4 days, similar to previous reports (31Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2003; 18: 1404-1418Crossref PubMed Scopus (198) Google Scholar, 32Collin-Osdoby P. Yu X. Zheng H. Osdoby P. Helfrich M.H. Ralston S.H. Methods in Molecular Medicine: Bone Research Protocols. Vol. 80. Humana Press Inc., Totowa, NJ2003: 153Google Scholar, 33Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2004; 19: 2065-2077Crossref PubMed Google Scholar). In some cases, large well differentiated RAW-OCs were selectively enriched by fetal bovine serum gradient separation (31Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2003; 18: 1404-1418Crossref PubMed Scopus (198) Google Scholar, 32Collin-Osdoby P. Yu X. Zheng H. Osdoby P. Helfrich M.H. Ralston S.H. Methods in Molecular Medicine: Bone Research Protocols. Vol. 80. Humana Press Inc., Totowa, NJ2003: 153Google Scholar). Primary bone marrow mononuclear cells were isolated from the long bones of 6–8-week-old female C57BL/6J wild-type (WT) or iNOS–/– mice (stock no. 002609, The Jackson Laboratory), and the marrow cells from one mouse were placed into a 75-cm2 flask and cultured in phenol red-free α-minimal essential medium and 10% fetal bovine serum with recombinant human M-CSF (25 ng/ml; R & D Systems, Minneapolis, MN) for 24 h. Nonadherent stroma-depleted cells were replated at 1.2 × 106 cells/well in 24-well plates and differentiated into bone pit-resorbing OCs (MA-OCs) by further treatment with M-CSF (25 ng/ml) and RANKL (50 ng/ml) given every other day with refeeding until day 7 or later when OCs had formed (31Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2003; 18: 1404-1418Crossref PubMed Scopus (198) Google Scholar, 32Collin-Osdoby P. Yu X. Zheng H. Osdoby P. Helfrich M.H. Ralston S.H. Methods in Molecular Medicine: Bone Research Protocols. Vol. 80. Humana Press Inc., Totowa, NJ2003: 153Google Scholar, 33Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2004; 19: 2065-2077Crossref PubMed Google Scholar). Cells were fixed, stained for tartrate-resistant acid phosphatase (TRAP) activity as a marker of OC development, and co-stained with 4′,6-diamidino-2-phenylindole dihydrochloride (Molecular Probes, Eugene, OR) to label nuclei, and the number of TRAP+ mononuclear and multinucleated cells (three or more nuclei/cell) and the number of nuclei/TRAP+ cell were counted across a constant number of sequential random fields using an Olympus light fluorescence microscope (33Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2004; 19: 2065-2077Crossref PubMed Google Scholar, 34Wright L. Maloney W. Yu X. Kindle L. Collin-Osdoby P. Osdoby P. Bone. 2005; 36: 840-853Crossref PubMed Scopus (174) Google Scholar). RANKL preparations were screened for negligible levels of bacterial endotoxin contamination using a commercial LAL kit (Cambrex Corp., Walkersville, MD).Modulator Treatments—Recombinant murine IFN-γ, TNF-α, or IL-1α (all from R & D Systems); Escherichia coli lipopolysaccharide (LPS) or phorbol 12-myristate 13-acetate (PMA) (both from Sigma); or the calcium ionophore A23187 (Calbiochem) was given to RAW cells or RAW-OCs formed by 4 days of RANKL treatment (as described above), and the cells and conditioned medium (CM) were harvested after 24 h for analysis of iNOS mRNA expression and NO release. To inhibit iNOS-derived NO generation during RANKL-induced OC development, RAW or marrow cells were cultured with various doses of the iNOS-selective inhibitor aminoguanidine (AG; Sigma) or l-N 6-(1-iminoethyl)lysine hydrochloride (l-NIL; ALEXIS Biochemicals Corp., San Diego, CA), each of which was freshly dissolved in warm medium just prior to administration on day 1 and given daily thereafter with refeeding until the harvest day noted in the figure legends. Similarly, RANKL-differentiating RAW or marrow cells were incubated with the NF-κB inhibitor 1-pyrrolidinecarbodithioic acid (PDTC; Sigma), IFN-β (PBL Biomedical Laboratories, Piscataway, NJ), neutralizing rabbit polyclonal antibody (pAb) to IFN-β (PBL Biomedical Laboratories), control non-immune rabbit IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), the RANKL inhibitor OPG (OPG-Fc fusion peptide; ALEXIS Biochemicals Corp.), the cGMP inhibitor 1H-[1,2,4]oxadiazolo[4,3,-a]quinoxalin-1-one (ODQ; Sigma), the cGMP-dependent G-protein kinase inhibitor (Rp)-cGMP-S (Sigma), or the cGMP analog 8-pCPT-cGMP (Sigma) for the times and conditions given in the figure legends. Thereafter, NO production, gene expression, OC development, and/or OC bone pit resorption activity was analyzed in harvested cell and CM samples.Nitrite Assay—CM was harvested from cultured cells, briefly centrifuged, and stored at –20 °C prior to assay. NO production was evaluated based on measuring nitrite as a stable end product of NO using the Griess reagent in a microplate assay (13Collin-Osdoby P. Rothe L. Bekker S. Anderson F. Osdoby P. J. Bone Miner. Res. 2000; 15: 474-488Crossref PubMed Scopus (61) Google Scholar). Results were normalized for cell protein using the BCA assay (Pierce), and data are expressed as μm nitrite accumulated in CM/mg of cell protein for the times noted in the figure legends.RNA Isolation and Reverse Transcription (RT)-PCR—Total RNA was isolated from cells using RNA STAT-60 (Tel-Test, Inc., Friendswood, TX) and quantified by spectrophotometry. Semiquantitative RT-PCR amplifications for murine iNOS, TRAP, matrix metalloproteinase-9, cathepsin K, calcitonin receptor, IFN-α, IFN-β, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were performed using gene-specific oligonucleotide forward and reverse primers (Table 1), 5–200 ng of total RNA, and Ready-To-Go RT-PCR beads (Amersham Biosciences) as described previously (31Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2003; 18: 1404-1418Crossref PubMed Scopus (198) Google Scholar). Optimal cycling conditions, linear amplification ranges, lack of genomic DNA contamination, and the sizes and sequences of amplified products were determined (31Yu X. Huang Y. Collin-Osdoby P. Osdoby P. J. Bone Miner. Res. 2003; 18: 1404-1418Crossref PubMed Scopus (198) Google Scholar). PCRs were conducted by initial denaturation at 94 °C for 1 min (TRAP, matrix metalloproteinase-9, cathepsin K, calcitonin receptor), 94 °C for 2 min (IFN-α, IFN-β), or 95 °C for 2 min (iNOS, GAPDH), followed by cycling as detailed in Table 1. Products were separated by 1% agarose gel electrophoresis, stained with ethidium bromide, photographed using Gel-Doc (Bio-Rad), and quantified by density determination using Quantity One image analysis software (Bio-Rad). Results were normalized to GAPDH signals determined in parallel for each sample, and data are expressed as a ratio of gene to GAPDH expression. All amplicons were of the expected size (Table 1), and products were directly sequenced using an ABI PRISM cycle sequencing kit (PerkinElmer Life Sciences) to confirm identities by comparison with published sequences using computation performed at NCBI and the BLAST network service.TABLE 1Primers and conditions used for RT-PCR amplification of murine genesGeneForward and reverse primer sequences (5′-3′)Temperature cycling/final extension (cycle no.)Product sizeGenBank™ accession no.bpiNOSACGGAGAAGCTTAGATCTGGAGCAGAAGTG95 °C, 60 s; 55 °C, 90 s;654NM_010927CTGCAGGTTGGACCACTGGATCCTGCCGAT72 °C, 3 min/72 °C, 5 min (38)TRAPAAATCACTCTTTAAGACCAG94 °C, 60 s; 51 °C, 60 s;317BC019160TTATTGAATAGCAGTGACAG72 °C, 2 min/72 °C, 2 min (26)MMP-9aMMP-9, matrix metalloproteinase-9; Cath-K, cathepsin K; CTR, calcitonin receptor.CTGTCCAGACCAAGGGTACAGCCT94 °C, 60 s; 51 °C, 60 s;383NM_013599GTGGTATAGTGGGACACATAGTGG72 °C, 2 min/72 °C, 2 min (27)Cath-KCCTCTCTTGGTGTCCATACA94 °C, 60 s; 51 °C, 60 s;490NM_007802ATCTCTCTGTACCCTCTGCA72 °C, 2 min/72 °C, 2 min (27)CTRACCGACGAGCAACGCCTACGC94 °C, 60 s; 51 °C, 60 s;272NM_007588GCCTTCACAGCCTTCAGGTAC72 °C, 2 min/72 °C, 2 min (38)IFN-αCTCATAACCTCAGGAACAAGAGAGCCT94 °C, 30 s; 58 °C, 30 s;288AY220462.1GCATCAGACAGGCTTGCAGGTCATT72 °C, 60 s/72 °C, 5 min (34)IFN-βCTTCTCCACCACAGCCCTCTC94 °C, 30 s; 58 °C, 30 s;346AY414518.1CCCACGTCAATCTTTCCTCTT72 °C, 60 s/72 °C, 5 min (34)GAPDHCACCACCATGGAGAAGGCTG95 °C, 60 s; 55 °C, 90 s;315BC020407ATGATGTTCTGGGCAGCCCC72 °C, 3 min/72 °C, 5 min (22)a MMP-9, matrix metalloproteinase-9; Cath-K, cathepsin K; CTR, calcitonin receptor. Open table in a new tab Electrophoretic Mobility Shift Assays—Nuclear extracts were prepared from RAW cells stimulated with RANKL (35 ng/ml, 10–40 min) using an NE-PER nuclear and cytoplasmic extraction reagent kit (Pierce) as recommended by the supplier. A double-stranded consensus NF-κB-binding site oligonucleotide probe (5′-AGTTGAGGGGACTTTCCCAGGC-3′) was radiolabeled with [γ-32P]ATP using a gel shift assay system kit (Promega Corp., Madison, WI) and incubated with nuclear extracts (5 μg) as recommended by the manufacturer. Protein-DNA complexes were resolved by electrophoresis on 4% nondenaturing acrylamide gels, and dried gels were exposed to Kodak film (at –80 °C). Signal specificity was confirmed by competition in parallel reactions with a 50-fold excess of unlabeled probe.Western Blot Analysis—All extraction steps were performed at 4 °C or on ice. RAW cells (107 cells/100-mm dish) were cultured with 35 ng/ml RANKL for various times and washed with ice-cold phosphate-buffered saline, and extracts were prepared by addition of a lysis solution containing 20 mm Tris-HCl (pH 7.4), 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1% Triton X-100, and a 1:100 dilution of protease inhibitor mixture set III (Calbiochem) and freezing (–80 °C) overnight. Extracts were centrifuged at 18,000 × g for 15 min; protein concentrations were determined using the BCA assay; and equal amounts (50 μg) of protein were loaded per lane on 4–12% BisTris gels (Invitrogen). Following electrophoresis, proteins were transferred using a semidry apparatus to polyvinylidene fluoride membranes (Millipore Corp., Bedford, MA), blocked, probed overnight with rabbit pAb to iNOS (1:5000 dilution; BD Biosciences), reacted for 1 h with alkaline phosphatase-coupled goat anti-rabbit secondary pAb (1:1000 dilution; Santa Cruz Biotechnology, Inc.), and bands were immunodetected by chemiluminescence using CDP-Star (Roche Applied Science) and exposure to Kodak film (34Wright L. Maloney W. Yu X. Kindle L. Collin-Osdoby P. Osdoby P. Bone. 2005; 36: 840-853Crossref PubMed Scopus (174) Google Scholar). Band densities on films were quantified using Quantity One software.Bone Pit Resorption Analysis—RAW cells or primary bone marrow mononuclear cells of WT or iNOS–/– origin were plated in 24-well dishes containing small circular ivory discs (5-mm diameter, 0.4-mm thick) and induced to form OCs via RANKL treatment as described above. Cells on the ivory discs were rinsed, fixed, stained for TRAP activity, and analyzed for TRAP+ cell formation and bone pit resorption as described previously (13Collin-Osdoby P. Rothe L. Bekker S. Anderson F. Osdoby P. J. Bone Miner. Res. 2000; 15: 474-488Crossref PubMed Scopus (61) Google Scholar, 35Collin-Osdoby P. Rothe L. Anderson F. Nelson M. Maloney W. Osdoby P. J. Biol. Chem. 2001; 276: 20659-20672Abstract Full Text Full Text PDF PubMed Scopus (346) Google Scholar). The number of TRAP+ cells was determined by light microscopy in 12 random fields/ivory slice; cells were removed; and resorption pit numbers and areas were quantified in the same fields using a computer-linked dark-field reflective light microscopic image analysis system (13Collin-Osdoby P. Rothe L. Bekker S. Anderson F. Osdoby P. J. Bone Miner. Res. 2000; 15: 474-488Crossref PubMed Scopus (61) Google Scholar, 35Collin-Osdoby P. Rothe L. Anderson F. Nelson M. Maloney W. Osdoby P. J. Biol. Chem. 2001" @default.
• W2014860274 created "2016-06-24" @default.
• W2014860274 creator A5024516865 @default.
• W2014860274 creator A5038619291 @default.
• W2014860274 creator A5064369996 @default.
• W2014860274 creator A5070026560 @default.
• W2014860274 date "2006-06-01" @default.
• W2014860274 modified "2023-09-30" @default.
• W2014860274 title "RANKL Stimulates Inducible Nitric-oxide Synthase Expression and Nitric Oxide Production in Developing Osteoclasts" @default.
• W2014860274 cites W1581327518 @default.
• W2014860274 cites W1587566573 @default.
• W2014860274 cites W1965497022 @default.
• W2014860274 cites W1966198985 @default.
• W2014860274 cites W1979821211 @default.
• W2014860274 cites W1980946438 @default.
• W2014860274 cites W1986835831 @default.
• W2014860274 cites W2000011999 @default.
• W2014860274 cites W2008584099 @default.
• W2014860274 cites W2009330030 @default.
• W2014860274 cites W2014969331 @default.
• W2014860274 cites W2022596794 @default.
• W2014860274 cites W2026262585 @default.
• W2014860274 cites W2029051823 @default.
• W2014860274 cites W2031157573 @default.
• W2014860274 cites W2035304177 @default.
• W2014860274 cites W2036165258 @default.
• W2014860274 cites W2038466746 @default.
• W2014860274 cites W2038590180 @default.
• W2014860274 cites W2040856583 @default.
• W2014860274 cites W2040873162 @default.
• W2014860274 cites W2053490208 @default.
• W2014860274 cites W2060482009 @default.
• W2014860274 cites W2067150234 @default.
• W2014860274 cites W2067631076 @default.
• W2014860274 cites W2071433712 @default.
• W2014860274 cites W2071823872 @default.
• W2014860274 cites W2074298033 @default.
• W2014860274 cites W2077920773 @default.
• W2014860274 cites W2088186552 @default.
• W2014860274 cites W2121778907 @default.
• W2014860274 cites W2134457900 @default.
• W2014860274 cites W2137853875 @default.
• W2014860274 cites W2137928341 @default.
• W2014860274 cites W2148946525 @default.
• W2014860274 cites W2149282006 @default.
• W2014860274 cites W2150835033 @default.
• W2014860274 cites W2152098493 @default.
• W2014860274 cites W2153163382 @default.
• W2014860274 cites W2160085830 @default.
• W2014860274 cites W2163247322 @default.
• W2014860274 cites W2173833672 @default.
• W2014860274 cites W2273005347 @default.
• W2014860274 cites W36502835 @default.
• W2014860274 doi "https://doi.org/10.1074/jbc.m513225200" @default.
• W2014860274 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16613848" @default.
• W2014860274 hasPublicationYear "2006" @default.
• W2014860274 type Work @default.
• W2014860274 sameAs 2014860274 @default.
• W2014860274 citedByCount "122" @default.
• W2014860274 countsByYear W20148602742012 @default.
• W2014860274 countsByYear W20148602742013 @default.
• W2014860274 countsByYear W20148602742014 @default.
• W2014860274 countsByYear W20148602742015 @default.
• W2014860274 countsByYear W20148602742016 @default.
• W2014860274 countsByYear W20148602742017 @default.
• W2014860274 countsByYear W20148602742018 @default.
• W2014860274 countsByYear W20148602742019 @default.
• W2014860274 countsByYear W20148602742020 @default.
• W2014860274 countsByYear W20148602742021 @default.
• W2014860274 countsByYear W20148602742022 @default.
• W2014860274 countsByYear W20148602742023 @default.
• W2014860274 crossrefType "journal-article" @default.
• W2014860274 hasAuthorship W2014860274A5024516865 @default.
• W2014860274 hasAuthorship W2014860274A5038619291 @default.
• W2014860274 hasAuthorship W2014860274A5064369996 @default.
• W2014860274 hasAuthorship W2014860274A5070026560 @default.
• W2014860274 hasBestOaLocation W20148602741 @default.
• W2014860274 hasConcept C170493617 @default.
• W2014860274 hasConcept C178790620 @default.
• W2014860274 hasConcept C185592680 @default.
• W2014860274 hasConcept C2777622882 @default.
• W2014860274 hasConcept C2779428903 @default.
• W2014860274 hasConcept C519581460 @default.
• W2014860274 hasConcept C55493867 @default.
• W2014860274 hasConcept C86803240 @default.
• W2014860274 hasConcept C88045685 @default.
• W2014860274 hasConcept C95444343 @default.
• W2014860274 hasConceptScore W2014860274C170493617 @default.
• W2014860274 hasConceptScore W2014860274C178790620 @default.
• W2014860274 hasConceptScore W2014860274C185592680 @default.
• W2014860274 hasConceptScore W2014860274C2777622882 @default.
• W2014860274 hasConceptScore W2014860274C2779428903 @default.
• W2014860274 hasConceptScore W2014860274C519581460 @default.
• W2014860274 hasConceptScore W2014860274C55493867 @default.
• W2014860274 hasConceptScore W2014860274C86803240 @default.
• W2014860274 hasConceptScore W2014860274C88045685 @default.
• W2014860274 hasConceptScore W2014860274C95444343 @default.
• W2014860274 hasIssue "23" @default.

• next