FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2014873573> ?p ?o ?g. }

• W2014873573 endingPage "5177" @default.
• W2014873573 startingPage "5169" @default.
• W2014873573 abstract "Sin1p/Spt2p is a yeast chromatin protein that, when mutated or deleted, alters the transcription of a family of genes presumably by modulating local chromatin structure. In this study, we investigated the ability of different domains of this protein to bind four-way junction DNA (4WJDNA) since 4WJDNA can serve as a model for bent double helical DNA and for the crossed structure formed at the exit and entry of DNA to the nucleosomes. Sequence alignment of Sin1p/Spt2p homologues from 11 different yeast species showed conservation of several domains. We found that three domains of Sin1p/Spt2p fused to glutathione S-transferase can each bind independently in a structure-specific manner to 4WJDNA as measured in a gel mobility shift assay. A feature common to these domains is a cluster of positively charged amino acids. Modification of this cluster resulted in either abolishment of binding or a change in the binding properties. One of the domains tested clearly bound superhelical DNA, although it failed to induce bending in a circularization assay. Poly-l-lysine, which may be viewed as a cluster of positively charged amino acids, bound 4WJDNA as well. Phenotypic analysis showed that disruption of any of these domains resulted in suppression of a his4-912δ allele, indicating that each domain has functional significance. We propose that Sin1p/Spt2p is likely to modulate local chromatin structure by binding two strands of double-stranded DNA at their crossover point. Sin1p/Spt2p is a yeast chromatin protein that, when mutated or deleted, alters the transcription of a family of genes presumably by modulating local chromatin structure. In this study, we investigated the ability of different domains of this protein to bind four-way junction DNA (4WJDNA) since 4WJDNA can serve as a model for bent double helical DNA and for the crossed structure formed at the exit and entry of DNA to the nucleosomes. Sequence alignment of Sin1p/Spt2p homologues from 11 different yeast species showed conservation of several domains. We found that three domains of Sin1p/Spt2p fused to glutathione S-transferase can each bind independently in a structure-specific manner to 4WJDNA as measured in a gel mobility shift assay. A feature common to these domains is a cluster of positively charged amino acids. Modification of this cluster resulted in either abolishment of binding or a change in the binding properties. One of the domains tested clearly bound superhelical DNA, although it failed to induce bending in a circularization assay. Poly-l-lysine, which may be viewed as a cluster of positively charged amino acids, bound 4WJDNA as well. Phenotypic analysis showed that disruption of any of these domains resulted in suppression of a his4-912δ allele, indicating that each domain has functional significance. We propose that Sin1p/Spt2p is likely to modulate local chromatin structure by binding two strands of double-stranded DNA at their crossover point. Sin1p/Spt2p is a yeast chromatin non-histone protein. While the precise function of the protein is still unknown, it is known to function as a negative transcriptional regulator of a number of genes including SUC2 (1Pollard K.J. Peterson C.L. Mol. Cell. Biol. 1997; 17: 6212-6222Crossref PubMed Scopus (190) Google Scholar), INO1 (2Peterson C.L. Kruger W. Herskowitz I. Cell. 1991; 64: 1135-1143Abstract Full Text PDF PubMed Scopus (138) Google Scholar), and SSA3 (3Baxter B.K. Craig E.A. J. Bacteriol. 1998; 180: 6484-6492Crossref PubMed Google Scholar). Activity of the HO promoter, as measured from an HO promoter driving a lacZ gene (4Sternberg P.W. Stern M.J. Clark I. Herskowitz I. Cell. 1987; 48: 567-577Abstract Full Text PDF PubMed Scopus (173) Google Scholar), is also regulated by SIN1/SPT2. swi1, swi2, and swi3 mutants are unable to transcribe RNA from the HO promoter. However, in sin1/swi double mutants, transcription is restored. Mutants in SPT2 were first identified as suppressors of ty and δ insertions in the 5′ non-coding region of the HIS4 gene (5Winston F. Chaleff D.T. Valent B. Fink G.R. Genetics. 1984; 107: 179-197Crossref PubMed Google Scholar). As the negative regulation of these genes is overcome by the SW1/SNF chromatin remodeling complex, it was suggested that a function of SIN1p/SPT2p is to somehow maintain chromatin compaction at specific locations in the chromatin. While Sin1p/Spt2p does not bind DNA in a sequence-specific way, it has been shown to bind double-stranded DNA (6Kruger W. Herskowitz I. Mol. Cell. Biol. 1991; 11: 4135-4146Crossref PubMed Scopus (128) Google Scholar). It is estimated that there are about 1200 (7Ghaemmaghami S. Huh W.K. Bower K. Howson R.W. Belle A. Dephoure N. O'Shea E.K. Weissman J.S. Nature. 2003; 425: 737-741Crossref PubMed Scopus (2995) Google Scholar) to 2000 (8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar) copies of the protein molecule per cell, indicating that it probably binds the chromatin at multiple locations. It was shown that in vitro the N terminus of Sin1p/Spt2p protein interacts with the tetratricopeptide repeat domains of Cdc23p, a protein involved in chromosome segregation, whereas the C terminus of Sin1p/Spt2p binds proteins involved in transcriptional regulation (9Katcoff D.J. Yona E. Hershkovits G. Friedman H. Cohen Y. Dgany O. Nucleic Acids Res. 1993; 21: 5101-5109Crossref PubMed Scopus (9) Google Scholar, 10Shpungin S. Liberzon A. Bangio H. Yona E. Katcoff D.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8274-8277Crossref PubMed Scopus (11) Google Scholar). Sequence analysis shows that Sin1p/Spt2p contains two domains that have homology to HMG1 1The abbreviations used are: HMG, high mobility group; 4WJDNA, four-way junction DNA; GST, glutathione S-transferase; 3WJDNA, three-way junction DNA.1The abbreviations used are: HMG, high mobility group; 4WJDNA, four-way junction DNA; GST, glutathione S-transferase; 3WJDNA, three-way junction DNA. in higher eukaryotes as well as an acidic domain and a polar helical C-tail (6Kruger W. Herskowitz I. Mol. Cell. Biol. 1991; 11: 4135-4146Crossref PubMed Scopus (128) Google Scholar, 8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar) (see Fig. 1). It was shown that one of these domains (amino acids 100–162) was able to bind double-stranded DNA without substantial sequence specificity (6Kruger W. Herskowitz I. Mol. Cell. Biol. 1991; 11: 4135-4146Crossref PubMed Scopus (128) Google Scholar, 11Yona E. Bangio H. Erlich P. Tepper S.H. Katcoff D.J. Mol. Gen. Genet. 1995; 246: 774-777Crossref PubMed Scopus (6) Google Scholar). Some key features of HMG boxes, however, were not present in this sequence, and its similarity to HMG was disputed (12Landsman D. Nature. 1993; 363: 590Crossref PubMed Scopus (5) Google Scholar). A detailed functional mapping of the molecule in the context of the SPT phenotype (5Winston F. Chaleff D.T. Valent B. Fink G.R. Genetics. 1984; 107: 179-197Crossref PubMed Google Scholar) was performed (8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar), identifying two functional regions. Amino acids 117–179 (overlapping the DNA-binding domain described above) contained a “dominance domain” that was required to be left intact in dominant spt2 mutants. In addition, deletion of the highly basic C terminus of Spt2p (amino acids 325–333) or a lessening of its charge resulted in the dominant suppressor phenotype. A variety of proteins extending from prokaryotes to humans, including those containing HMG domains, can bind four-way junction DNA (4WJDNA) in a structure-specific way (13Zlatanova J. van Holde K. FASEB J. 1998; 12: 421-431Crossref PubMed Scopus (87) Google Scholar). In humans, for example, a cruciform-binding protein from the 14-3-3 family has been found (14Pearson C.E. Zannis-Hadjopoulos M. Price G.B. Zorbas H. EMBO J. 1995; 14: 1571-1580Crossref PubMed Scopus (37) Google Scholar, 15Todd A. Cossons N. Aitken A. Price G.B. Zannis-Hadjopoulos M. Biochemistry. 1998; 37: 14317-14325Crossref PubMed Scopus (48) Google Scholar) as have its yeast counterparts Bmh1p and Bmh2p (16Callejo M. Alvarez D. Price G.B. Zannis-Hadjopoulos M. J. Biol. Chem. 2002; 277: 38416-38423Abstract Full Text Full Text PDF PubMed Scopus (26) Google Scholar). These proteins have been implicated in initiation of replication (17Novac O. Alvarez D. Pearson C.E. Price G.B. Zannis-Hadjopoulos M. J. Biol. Chem. 2002; 277: 11174-11183Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). RAD51B, another human protein, binds 4WJDNA and has a function in homologous recombinational repair (18Yokoyama H. Kurumizaka H. Ikawa S. Yokoyama S. Shibata T. J. Biol. Chem. 2003; 278: 2767-2772Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). In other contexts, it is believed that the ability of proteins to bind 4WJDNA often reflects in vivo protein binding to bent DNA or to crossing strands of DNA (13Zlatanova J. van Holde K. FASEB J. 1998; 12: 421-431Crossref PubMed Scopus (87) Google Scholar). It has been reported that in the absence of Mg2+ ions, 4WJDNA takes on an extended “open” conformation, while Mg2+ ions permit a more closed conformation, adopting more the shape of an X as the DNA undergoes partial folding by means of pairwise stacking of the double helical arms (19Ortiz-Lombardia M. Gonzalez A. Eritja R. Aymami J. Azorin F. Coll M. Nat. Struct. Biol. 1999; 6: 913-917Crossref PubMed Scopus (180) Google Scholar, 20Duckett D.R. Murchie A.I. Diekmann S. von Kitzing E. Kemper B. Lilley D.M. Cell. 1988; 55: 79-89Abstract Full Text PDF PubMed Scopus (421) Google Scholar, 21Cooper J.P. Hagerman P.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7336-7340Crossref PubMed Scopus (139) Google Scholar, 22Murchie A.I. Clegg R.M. von Kitzing E. Duckett D.R. Diekmann S. Lilley D.M. Nature. 1989; 341: 763-766Crossref PubMed Scopus (320) Google Scholar, 23Clegg R.M. Murchie A.I. Zechel A. Carlberg C. Diekmann S. Lilley D.M. Biochemistry. 1992; 31: 4846-4856Crossref PubMed Scopus (236) Google Scholar). Pohler et al. (24Pohler J.R. Norman D.G. Bramham J. Bianchi M.E. Lilley D.M. EMBO J. 1998; 17: 817-826Crossref PubMed Scopus (103) Google Scholar) carefully studied the interaction between HMG boxes and 4WJDNA. They found that a single HMG domain binds 4WJDNA exclusively in its extended open square conformation, which is predominant in solution lacking Mg2+ ions. In this study, we investigated the nature of interactions between segments of Sin1p/Spt2p expressed as glutathione S-transferase (GST) fusions and 4WJDNA with the hope that these data will improve our understanding of how Sin1p/Spt2p binds chromatin in vivo. We found that a domain encompassing amino acids 100–162, previously suggested to have HMG-like structure, did not bind 4WJDNA in either its extended square conformation or in its more closed X conformation, while another HMG-like domain (amino acids 1–96) was able to bind both four-way junction DNA conformations. Surprisingly an acidic domain (amino acids 224–304) was found to bind 4WJDNA only in its extended conformation in a structure-specific manner as do genuine HMG boxes. Additionally the polar C-tail domain (amino acids 303–333) was found to bind 4WJDNA in both conformations. Substitution of several of the positively charged amino acids with alanine led to the disappearance of the binding. As each of these domains that bind 4WJDNA contains a cluster of positively charged amino acids, we propose that this cluster may be involved in the binding of the peptides to the 4WJDNA. Protein binding to 4WJDNA often implicates the ability of the protein to bind a crossed structure of DNA in vivo such as at the entrance and exit of DNA from the nucleosome. Our data suggest that several domains of Sin1p/Spt2p secure crossing DNA in the chromatin. This binding could result in increased chromatin compaction or a localized change in the ability of particular DNA sequences to bind regulatory proteins. Plasmids and Bacterial Strains—The expression vectors used are derivatives of pGEX-3X (Amersham Biosciences) that have portions of SIN1/SPT2 inserted such that they are expressed as GST-peptide fusions. Constructs and peptide isolation are described in Refs. 10Shpungin S. Liberzon A. Bangio H. Yona E. Katcoff D.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8274-8277Crossref PubMed Scopus (11) Google Scholar, 25Liberzon A. Shpungin S. Bangio H. Yona E. Katcoff D.J. FEBS Lett. 1996; 388: 5-10Crossref PubMed Scopus (14) Google Scholar, and 26Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Benson Chanda V. Current Protocols in Molecular Biology. (Greene Publishing Associates) John Wiley & Sons, Brooklyn, NY, and Media, PA1987: 16.7.1-16.7.7Google Scholar. DNA encoding the acidic domain of Sin1p/Spt2p (Ser224–Arg304) was amplified from genomic DNA by PCR using forward and reverse primers 27209 and 26238, respectively (see Table I). The PCR was carried out for 40 cycles of 95 °C for 1 min (denaturation), 42 °C for 45 s (annealing), and 72 °C for 1 min (extension). Following amplification, the DNA fragment was digested with BamHI and EcoRI and then ligated into similarly digested pGEX-3X. Ligation mixtures were first introduced into Escherichia coli XL-Blue, while E. coli BL21(DE3) was used for protein expression. Plasmid pBR322 was isolated using a Qiagen plasmid purification kit according to the manufacturer's instructions.Table IPrimer listPrimer designationPrimer sequenceUnderlined restriction site27209GACGGATCCAATCAAGATACCAGGATGBamHI26238CCGAATTCTTGCCATTTCCTCCTCTTEcoRI1517993CTTGCCTCTATTGAACATAGCCCAAATTTC1517994CTTGCCTCTATTGAACATAGCCCTAATTTCW267AREVCTTGCCTCTATTGAACATAGCCGCAATTTC1517991GCTATGGTTCAATAGAGGCAAGAAGCGGTCA1517992GCTATGGTTCAATAGAGGCAAGGCGCGGTCAADLEFTGAACCAAGCTTATGGTAAAATTGCCGAGGAAGHindIIIADLEFTMIDCTCAAGCTCATCGTAATCGTATTTCTGTTTTCTAGATTCTAACTADRIGHTMIDTACGATTACGATGAGCTTGAGADRIGHTCTTCATTAGTCATTTCACGTCCATATATC Open table in a new tab PCR Mutagenesis of the Acidic Domain of SIN1/SPT2—Mutagenesis of W267R, W267A, and K275A in the acidic domain of Sin1p/Spt2p was carried out by two-step PCR using wild type internal and/or mismatched primers (Table I). In the first step, the following portions of the acidic domain were amplified. 1) The 5′ section (Ser224–Lys274) of the acidic domain was amplified using forward and reverse primers 27209 and 1517993, respectively. 2) The 5′ section (Ser224–Lys274) of the acidic domain was amplified using forward and reverse primers 27209 and 1517994, respectively, introducing the W267R mutation. Similarly primers 27209 and W267AREV were used to introduce the W267A mutation. 3) The 3′ section (Ala268–Arg304) of the acidic domain was amplified using forward and reverse primers 1517991 and 26238, respectively. 4) The 3′ section (Ala268–Arg304) of the acidic domain was amplified using forward and reverse primers 1517992 and 26238, respectively, introducing the K275A mutation. PCR was performed as described for amplification of the entire acidic domain of SIN1/SPT2. For the second step, two-stage PCR was carried out. First each of two adjacent DNA fragments from the above PCR that share an overlapping segment were used, both as template and as primers for each other. PCR of sections 1 + 4 yielded the complete acidic domain with the K275A mutation, PCR of sections 2 + 3 yielded the complete acidic domain with the W267R mutation, and PCR of sections 2 + 4 yielded the complete acidic domain with both the W267R and K275A mutations. The PCR was carried out for 16 cycles of 95 °C for 1 min (denaturation), 43 °C for 45 s (annealing), and 72 °C for 1 min (extension). Next a PCR mixture containing primers 27209 and 26238, dNTPs, Taq polymerase buffer, and Taq polymerase was added to each tube, and 40 cycles of PCR were performed. This resulted in amplification of the entire acidic domain of SIN1/SPT2. Following amplification, the DNA fragment was digested with BamHI and EcoRI and ligated into similarly digested pGEX-3X as described above. Deletion of the acidic domain for functional assays was performed similarly using pLL10 (8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar) as template and with the first PCR using primers ADLEFT and ADLEFTMID and the second reaction using primers ADRIGHTMID and ADRIGHT. Following the amplifications, the DNA fragment was digested with HindIII and ligated into similarly digested pLL10. The precise deletion was confirmed by DNA sequencing. Mutations W267R and K275A were introduced into the acidic domain using the same PCR mutagenesis technique and primers 1517994 and 1517992. Gel Mobility Shift Assay—4WJDNA, 3WJDNA, and duplex oligonucleotides (both having the same sequence as the arms of the 4WJDNA) were made for experiments as described previously (27Bianchi M.E. EMBO J. 1988; 7: 843-849Crossref PubMed Scopus (96) Google Scholar). One of the oligonucleotides was end-radiolabeled using [γ-32P]ATP. The formation of the 4WJDNA was verified by digestion with AluI and EcoRI, each of which have digestion sites in an arm of the 4WJDNA (data not shown). Binding reactions were performed in 20 μl containing 10 fmol of 32P-labeled 4WJDNA, 10 mm Tris-HCl, pH 7.5, 25 mm NaCl, 10 mm MgCl2, 5% Ficoll, and 0.2 mg/ml herring sperm DNA. Aliquots of the recombinant protein were incubated with 4WJDNA for 45 min at room temperature. Reactions not containing Mg2+ ions were made isoionic with the above reaction mixture by substitution of an appropriate amount of Na+ ions. Reaction mixtures were electrophoresed on a 6.5% polyacrylamide gel at 5 V/cm for 3–3.5 h in Tris borate/EDTA buffer adjusted to pH 7.3. The gel was dried and autoradiographed. Prior to applying the samples to the gel, it was extensively prerun. Each experiment was repeated two to three times with recombinant protein samples from independently prepared batches. Protein Binding to Supercoiled DNA—Increasing concentrations of peptide were mixed with plasmid pBR322 (a mixture of supercoiled, nicked, and linearized (with HindIII) DNA) in 15 μl of 50 mm Tris-Cl, pH 7.5, 20 mm NaCl, 1 mm EDTA, 0.1% Triton X-100 for 40 min at room temperature as described previously (28Yaneva J. Schroth G.P. Van Holde K.E. Zlatanova J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 7060-7064Crossref PubMed Scopus (27) Google Scholar). The reaction mixtures were then electrophoresed through 2% agarose in TAE buffer (40 mm Tris acetate, pH = 7.5, 1 mm EDTA) at 8 V/cm. Following the electrophoresis the gel was stained with ethidium bromide and photographed. Functional Analysis of Sin1p/Spt2p Acidic Domain (Amino Acids 224–304) in Holoprotein—The Lefebvre and Smith (8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar) assay system was used to monitor the ability of Sin1p/Spt2p to suppress the his4-912δ mutation containing SIN1/SPT2 wild type, sin1/spt2 with a deleted acidic domain (sin1/spt2 Δ224–304), and sin1/spt2 mutated in both W267R and K275A. Recently, as a result of sequencing of multiple fungal genomes, it has become possible to align putative amino acid sequences of homologous genes and to deduce from the alignment evolutionarily conserved regions of the gene that are presumably important for the function of the protein (29Kellis M. Patterson N. Endrizzi M. Birren B. Lander E.S. Nature. 2003; 423: 241-254Crossref PubMed Scopus (1429) Google Scholar, 30Cliften P. Sudarsanam P. Desikan A. Fulton L. Fulton B. Majors J. Waterston R. Cohen B.A. Johnston M. Science. 2003; 301: 71-76Crossref PubMed Scopus (697) Google Scholar). We have, therefore, aligned Saccharomyces cerevisiae Sin1p/Spt2p homologues from Saccharomyces mikatae, Saccharomyces kudriavzevii, Saccharomyces bayanus, and Saccharomyces castellii (30Cliften P. Sudarsanam P. Desikan A. Fulton L. Fulton B. Majors J. Waterston R. Cohen B.A. Johnston M. Science. 2003; 301: 71-76Crossref PubMed Scopus (697) Google Scholar); Saccharomyces paradoxus and S. mikatae (29Kellis M. Patterson N. Endrizzi M. Birren B. Lander E.S. Nature. 2003; 423: 241-254Crossref PubMed Scopus (1429) Google Scholar); Candida glabrata, Yarrowia lipolytica, Kluyveromyces lactis, and Debaryomyces hansenii (52Dujon B. Sherman D. Fischer G. Durrens P. Casaregola S. Lafontaine I. De Montigny J. Marck C. Neuveglise C. Talla E. Goffard N. Frangeul L. Aigle M. Anthouard V. Babour A. Barbe V. Barnay S. Blanchin S. Beckerich J.M. Beyne E. Bleykasten C. Boisrame A. Boyer J. Cattolico L. Confanioleri F. De Daruvar A. Despons L. Fabre E. Fairhead C. Ferry-Dumazet H. Groppi A. Hantraye F. Hennequin C. Jauniaux N. Joyet P. Kachouri R. Kerrest A. Koszul R. Lemaire M. Lesur I. Ma L. Muller H. Nicaud J.M. Nikolski M. Oztas S. Ozier-Kalogeropoulos O. Pellenz S. Potier S. Richard G.F. Straub M.L. Suleau A. Swennen D. Tekaia F. Wesolowski-Louvel M. Westhof E. Wirth B. Zeniou-Meyer M. Zivanovic I. Bolotin-Fukuhara M. Thierry A. Bouchier C. Caudron B. Scarpelli C. Gaillardin C. Weissenbach J. Wincker P. Souciet J.L. Nature. 2004; 430: 35-44Crossref PubMed Scopus (1258) Google Scholar); and Candida albicans (Stanford Genome Technology Center) using the PILEUP algorithm included in the Genetics Computer Group (GCG) package of programs. As can be seen in Fig. 1, Sin1p/Spt2p is conserved across the species, although the conservation is not uniform throughout the molecule. About 20 amino acids centered at about amino acid 60 and another 20 amino acids centered at about amino acid 145 are conserved. Each of these sequences is centered around the hypothetical HMG domains as suggested by Lefebvre and Smith (8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar). Particularly conserved is the C-terminal quarter of the molecule that includes the acidic domain and the highly basic C terminus. These data suggest that these domains play an important role in the function of the molecule. Interaction between the “HMG-like Boxes” in Sin1p/Spt2p and Four-way Junction DNA—As mentioned above, sequence analysis indicated that Sin1p/Spt2p contains two regions showing sequence similarity with HMG boxes (1Pollard K.J. Peterson C.L. Mol. Cell. Biol. 1997; 17: 6212-6222Crossref PubMed Scopus (190) Google Scholar, 2Peterson C.L. Kruger W. Herskowitz I. Cell. 1991; 64: 1135-1143Abstract Full Text PDF PubMed Scopus (138) Google Scholar): box 1 (amino acids 26–88) and box 2 (amino acids 98–159) (Fig. 1) (8Lefebvre L. Smith M. Mol. Cell. Biol. 1993; 13: 5393-5407Crossref PubMed Scopus (15) Google Scholar). As binding to 4WJDNA is a characteristic of HMG box domains, we asked whether these domains could bind four-way junction DNA in vitro. For this purpose, we used two GST-Sin1p fusion proteins containing amino acids 1–96 and 100–162, engineered as described previously (10Shpungin S. Liberzon A. Bangio H. Yona E. Katcoff D.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 8274-8277Crossref PubMed Scopus (11) Google Scholar, 25Liberzon A. Shpungin S. Bangio H. Yona E. Katcoff D.J. FEBS Lett. 1996; 388: 5-10Crossref PubMed Scopus (14) Google Scholar, 26Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Benson Chanda V. Current Protocols in Molecular Biology. (Greene Publishing Associates) John Wiley & Sons, Brooklyn, NY, and Media, PA1987: 16.7.1-16.7.7Google Scholar), each with a GST tag at the N terminus. Recombinant peptides are shown in Fig. 2. 4WJDNA was radiolabeled and incubated with increasing concentrations of GST-Sin1p (amino acids 1–96) and GST-Sin1p (amino acids 100–162) as described under “Experimental Procedures” and in Fig. 3. Binding reactions were performed both in the presence of 10 mm Mg2+ ions and in its absence. As illustrated in Fig. 3a, the 4WJDNA can take on either an X conformation or a more open crosslike conformation dependent on the presence or absence of Mg2+ ions (24Pohler J.R. Norman D.G. Bramham J. Bianchi M.E. Lilley D.M. EMBO J. 1998; 17: 817-826Crossref PubMed Scopus (103) Google Scholar).Fig. 3Gel mobility shift assay of Sin1p/Spt2p HMG boxes binding to 4WJDNA.a, 4WJDNA structure is dependent on the presence of Mg2+ ions. b, recombinant GST-Sin1p-(1–96) was added to radiolabeled 4WJDNA in increasing concentrations of protein in the presence and the absence of Mg2+ ions. c, same as b except that recombinant GST-Sin1p-(100–162) was used. At concentrations higher than 12 μm protein, a portion of the 4WJDNA does not enter the gel regardless of the presence of Mg2+.View Large Image Figure ViewerDownload Hi-res image Download (PPT) As seen in Fig. 3b, amino acids 1–96 of GST-Sin1p containing putative HMG box 1 were able to bind 4WJDNA both in the X conformation and in the open form. The X conformation of 4WJDNA was retarded only slightly by this peptide even at relatively high concentrations (32 μm) of peptide. In contrast, the 4WJDNA was increasingly retarded as higher concentrations of protein were added to the reaction in the absence of Mg2+ ions, much like the binding of the globular domain of histone H5 to 4WJDNA (31Varga-Weisz P. Zlatanova J. Leuba S.H. Schroth G.P. van Holde K. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3525-3529Crossref PubMed Scopus (73) Google Scholar). At the higher concentrations, the band on the gel became indiscrete, suggesting that the DNA-protein complex was an aggregate without defined structure. A GST-Sin1p peptide (amino acids 100–162) containing HMG box 2 was unable to bind 4WJDNA under any conditions tested (Fig. 3c). At concentrations above 12 μm, the peptide appeared to form an insoluble DNA-protein complex that did not enter the polyacrylamide gel. This was true for 4WJDNA either in its open or in its X conformation. GST alone was unable to bind 4WJDNA with or without Mg2+ ions at any concentration of protein tested (data not shown). An Acidic Domain, GST-Sin1p-(224–304), Binds 4WJDNA in the Open Conformation—As shown in Fig. 1, two additional domains were distinguished by sequence analysis. One, amino acids 224–304, is particularly acidic. We investigated the ability of this domain to bind 4WJDNA in an experiment similar to that described above. Surprisingly, despite the strong acidic nature of this domain, it bound 4WJDNA in its open conformation quite efficiently as can be seen in Fig. 4a. A complex was first formed at about 3 μm protein, and then, starting at 9 μm, a second slower migrating complex was observed. Concentrations of this peptide needed for binding were about the same as published values for the HMG1 B-domain when tagged with maltose-binding protein (24Pohler J.R. Norman D.G. Bramham J. Bianchi M.E. Lilley D.M. EMBO J. 1998; 17: 817-826Crossref PubMed Scopus (103) Google Scholar). An apparent KD of 19 μm was measured where KD approximates the protein concentration at which there is half-maximal shift of probe (32Lee K.B. Thomas J.O. J. Mol. Biol. 2000; 304: 135-149Crossref PubMed Scopus (76) Google Scholar). Interestingly GST-Sin1p-(224–304) was unable to bind 4WJDNA in its X conformation even at the highest concentration of protein tried (34 μm). These results were reminiscent of published results with HMG1 domain B (24Pohler J.R. Norman D.G. Bramham J. Bianchi M.E. Lilley D.M. EMBO J. 1998; 17: 817-826Crossref PubMed Scopus (103) Google Scholar). The differential binding of HMG1 domain B to the open versus X conformation was explained by the formation of a rigid structure composed of two α-helical arms that specifically bind the 4WJDNA in its open conformation. The angle of about 80° between the two helical arms of HMG1 domain B is defined by a number of conserved, predominantly aromatic residues (Phe14, Phe17, Trp45, Lys53, and Tyr56) (33Weir H.M. Kraulis P.J. Hill C.S. Raine A.R. Laue E.D. Thomas J.O. EMBO J. 1993; 12: 1311-1319Crossref PubMed Scopus (369) Google Scholar). While the amino acid composition of Sin1p-(224–304) is substantially different from HMG domain B of HMG1, careful examination of the Sin1p-(224–304) sequence shows that residues (Phe240, Trp267, Lys275, and Tyr279) are nearly in the same conserved positions (Fig. 1, marked with stars) as in HMG1 domain B, suggesting that the Sin1p-(224–304) peptide might have a rigid structure as well. It was shown that a W45R mutation in HMG1 A domain reduced the ability of this domain to bind 4WJDNA because of disruption of an α-helix (34Falciola L. Murchie A.I. Lilley D.M. Bianchi M. Nucleic Acids Res. 1994; 22: 285-292Crossref PubMed Scopus (54) Google Scholar, 35Teo S.-H. Grasser K.D. Hardman C.H. Broadhurst R.W. Laue E.D. Thomas J.O. EMBO J. 1995; 14: 3844-3853Crossref PubMed Scopus (63) Google Scholar). We, therefore, first asked how an analogous mutation in GST-Sin1p-(224–304), W267R, might affect its binding to 4WJDNA. As can be seen in Fig. 4b, this mutant peptide retained its ability to bind 4WJDNA in the open conformation. In addition, however, and in contrast to the wild type peptide, it was also able to bind 4WJDNA in the presence of Mg2+ ions in which the X form of the 4WJDNA predominates. We next asked how absence of charge at this position in a W267A mutation would affect 4WJDNA binding. As can be seen in Fig. 4c, the results were very similar to those for W267R with both the open and X conformations of the 4WJDNA being bound by the peptide. When we tested a mutant peptide having a double replacement in this assay, W267R,K275A, similar results were obtained both with and without Mg2+ ions (Fig. 4d). For each of the GST-Sin1p-(224–304) constructs, increasing concentrations of peptide resulted in the appearance of two retarded bands with the mo" @default.
• W2014873573 created "2016-06-24" @default.
• W2014873573 creator A5045807908 @default.
• W2014873573 creator A5074250042 @default.
• W2014873573 creator A5087216143 @default.
• W2014873573 date "2005-02-01" @default.
• W2014873573 modified "2023-10-09" @default.
• W2014873573 title "Functional Domains of the Yeast Chromatin Protein Sin1p/Spt2p Can Bind Four-way Junction and Crossing DNA Structures" @default.
• W2014873573 cites W1491384344 @default.
• W2014873573 cites W1581610674 @default.
• W2014873573 cites W1896024261 @default.
• W2014873573 cites W1935354242 @default.
• W2014873573 cites W1947762817 @default.
• W2014873573 cites W1981072983 @default.
• W2014873573 cites W1985991521 @default.
• W2014873573 cites W1987459167 @default.
• W2014873573 cites W1987682801 @default.
• W2014873573 cites W1989624089 @default.
• W2014873573 cites W1990352389 @default.
• W2014873573 cites W2000453872 @default.
• W2014873573 cites W2003942418 @default.
• W2014873573 cites W2005249390 @default.
• W2014873573 cites W2011942891 @default.
• W2014873573 cites W2013947447 @default.
• W2014873573 cites W2017118719 @default.
• W2014873573 cites W2019626530 @default.
• W2014873573 cites W2032099089 @default.
• W2014873573 cites W2034163065 @default.
• W2014873573 cites W2037738220 @default.
• W2014873573 cites W2037919401 @default.
• W2014873573 cites W2037980929 @default.
• W2014873573 cites W2040394268 @default.
• W2014873573 cites W2041588206 @default.
• W2014873573 cites W2044121592 @default.
• W2014873573 cites W2045160722 @default.
• W2014873573 cites W2054624670 @default.
• W2014873573 cites W2058682865 @default.
• W2014873573 cites W2062138524 @default.
• W2014873573 cites W2066689854 @default.
• W2014873573 cites W2067103174 @default.
• W2014873573 cites W2071841280 @default.
• W2014873573 cites W2081747849 @default.
• W2014873573 cites W2081958144 @default.
• W2014873573 cites W2092515268 @default.
• W2014873573 cites W2102678326 @default.
• W2014873573 cites W2104925799 @default.
• W2014873573 cites W2109591730 @default.
• W2014873573 cites W2125760148 @default.
• W2014873573 cites W2137441463 @default.
• W2014873573 cites W2145780149 @default.
• W2014873573 cites W2148552953 @default.
• W2014873573 cites W2154264984 @default.
• W2014873573 cites W2160393299 @default.
• W2014873573 cites W2285663888 @default.
• W2014873573 cites W242296685 @default.
• W2014873573 cites W317733335 @default.
• W2014873573 doi "https://doi.org/10.1074/jbc.m406249200" @default.
• W2014873573 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15563464" @default.
• W2014873573 hasPublicationYear "2005" @default.
• W2014873573 type Work @default.
• W2014873573 sameAs 2014873573 @default.
• W2014873573 citedByCount "9" @default.
• W2014873573 countsByYear W20148735732017 @default.
• W2014873573 countsByYear W20148735732023 @default.
• W2014873573 crossrefType "journal-article" @default.
• W2014873573 hasAuthorship W2014873573A5045807908 @default.
• W2014873573 hasAuthorship W2014873573A5074250042 @default.
• W2014873573 hasAuthorship W2014873573A5087216143 @default.
• W2014873573 hasBestOaLocation W20148735731 @default.
• W2014873573 hasConcept C12554922 @default.
• W2014873573 hasConcept C185592680 @default.
• W2014873573 hasConcept C2779222958 @default.
• W2014873573 hasConcept C54355233 @default.
• W2014873573 hasConcept C552990157 @default.
• W2014873573 hasConcept C70721500 @default.
• W2014873573 hasConcept C83640560 @default.
• W2014873573 hasConcept C86803240 @default.
• W2014873573 hasConcept C95444343 @default.
• W2014873573 hasConceptScore W2014873573C12554922 @default.
• W2014873573 hasConceptScore W2014873573C185592680 @default.
• W2014873573 hasConceptScore W2014873573C2779222958 @default.
• W2014873573 hasConceptScore W2014873573C54355233 @default.
• W2014873573 hasConceptScore W2014873573C552990157 @default.
• W2014873573 hasConceptScore W2014873573C70721500 @default.
• W2014873573 hasConceptScore W2014873573C83640560 @default.
• W2014873573 hasConceptScore W2014873573C86803240 @default.
• W2014873573 hasConceptScore W2014873573C95444343 @default.
• W2014873573 hasIssue "7" @default.
• W2014873573 hasLocation W20148735731 @default.
• W2014873573 hasOpenAccess W2014873573 @default.
• W2014873573 hasPrimaryLocation W20148735731 @default.
• W2014873573 hasRelatedWork W1607718650 @default.
• W2014873573 hasRelatedWork W1985900993 @default.
• W2014873573 hasRelatedWork W2124768480 @default.
• W2014873573 hasRelatedWork W2152861454 @default.
• W2014873573 hasRelatedWork W2385199909 @default.
• W2014873573 hasRelatedWork W261727187 @default.
• W2014873573 hasRelatedWork W4206381471 @default.

• next