FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2015218125> ?p ?o ?g. }

• W2015218125 endingPage "29978" @default.
• W2015218125 startingPage "29968" @default.
• W2015218125 abstract "Mammalian lipins (lipin-1, lipin-2, and lipin-3) are Mg2+-dependent phosphatidate phosphatase (PAP) enzymes, which catalyze a key reaction in glycerolipid biosynthesis. Lipin-1 also functions as a transcriptional coactivator in conjunction with members of the peroxisome proliferator-activated receptor family. An S734L mutation in LPIN2 causes Majeed syndrome, a human inflammatory disorder characterized by recurrent osteomyelitis, fever, dyserythropoietic anemia, and cutaneous inflammation. Here we demonstrate that mutation of the equivalent serine in mouse lipin-1 and lipin-2 to leucine or aspartate abolishes PAP activity but does not impair lipin association with microsomal membranes, the major site of glycerolipid synthesis. We also determined that lipin-2 has transcriptional coactivator activity for peroxisome proliferator-activated receptor-response elements similar to lipin-1 and that this activity is not affected by mutating the conserved serine. Therefore, our results indicate that the symptoms of the Majeed syndrome result from a loss of lipin-2 PAP activity. To characterize sites of lipin-2 action, we detected lipin-2 expression by in situ hybridization on whole mouse sections and by quantitative PCR of tissues relevant to Majeed syndrome. Lipin-2 was most prominently expressed in liver, where levels were much higher than lipin-1, and also in kidney, lung, gastrointestinal tract, and specific regions of the brain. Lipin-2 was also expressed in circulating red blood cells and sites of lymphopoiesis (bone marrow, thymus, and spleen). These results raise the possibility that the loss of lipin-2 PAP activity in erythrocytes and lymphocytes may contribute to the anemia and inflammation phenotypes observed in Majeed syndrome patients. Mammalian lipins (lipin-1, lipin-2, and lipin-3) are Mg2+-dependent phosphatidate phosphatase (PAP) enzymes, which catalyze a key reaction in glycerolipid biosynthesis. Lipin-1 also functions as a transcriptional coactivator in conjunction with members of the peroxisome proliferator-activated receptor family. An S734L mutation in LPIN2 causes Majeed syndrome, a human inflammatory disorder characterized by recurrent osteomyelitis, fever, dyserythropoietic anemia, and cutaneous inflammation. Here we demonstrate that mutation of the equivalent serine in mouse lipin-1 and lipin-2 to leucine or aspartate abolishes PAP activity but does not impair lipin association with microsomal membranes, the major site of glycerolipid synthesis. We also determined that lipin-2 has transcriptional coactivator activity for peroxisome proliferator-activated receptor-response elements similar to lipin-1 and that this activity is not affected by mutating the conserved serine. Therefore, our results indicate that the symptoms of the Majeed syndrome result from a loss of lipin-2 PAP activity. To characterize sites of lipin-2 action, we detected lipin-2 expression by in situ hybridization on whole mouse sections and by quantitative PCR of tissues relevant to Majeed syndrome. Lipin-2 was most prominently expressed in liver, where levels were much higher than lipin-1, and also in kidney, lung, gastrointestinal tract, and specific regions of the brain. Lipin-2 was also expressed in circulating red blood cells and sites of lymphopoiesis (bone marrow, thymus, and spleen). These results raise the possibility that the loss of lipin-2 PAP activity in erythrocytes and lymphocytes may contribute to the anemia and inflammation phenotypes observed in Majeed syndrome patients. The mammalian lipin protein family is composed of three members, lipin-1, lipin-2, and lipin-3, each of which are ∼100 kDa in size and have 44–48% amino acid similarity (reviewed in Ref. 1Reue K. Brindley D.N. J. Lipid Res. 2008; 49: 2493-2503Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Orthologous lipin genes are present in plants, invertebrates, and single cell eukaryotes such as yeast and plasmodium (2Péterfy M. Phan J. Xu P. Reue K. Nat. Genet. 2001; 27: 121-124Crossref PubMed Scopus (475) Google Scholar), suggesting that lipin proteins play a fundamental cellular role that has been conserved in evolution. In particular, extended stretches of 100–200 amino acids at the N-terminal and C-terminal regions of the protein (the N-LIP and C-LIP domains, respectively) are highly conserved among the three mammalian lipin family members and among species. Within the C-LIP domain are two key protein functional motifs as follows: a haloacid dehalogenase motif (DXDXT) found in a superfamily of Mg2+-dependent phosphatases (3Han G.S. Wu W.I. Carman G.M. J. Biol. Chem. 2006; 281: 9210-9218Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar, 4Carman G.M. Han G.S. J. Biol. Chem. 2009; 284: 2593-2597Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar), and a transcription factor-binding motif (LXXIL) (5Finck B.N. Gropler M.C. Chen Z. Leone T.C. Croce M.A. Harris T.E. Lawrence Jr., J.C. Kelly D.P. Cell Metab. 2006; 4: 199-210Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar). These motifs confer two distinct molecular functions on members of the lipin family. All three mammalian lipins are Mg2+-dependent phosphatidate phosphatase (PAP) 4The abbreviations used are: PAPMg2+-dependent phosphatidate phosphatasePAphosphatidatePPARαperoxisome proliferator-activated receptor-αPGC-1αPPARγ coactivator protein-1αPPREPPAR-response elementqPCRquantitative PCRHADhaloacid dehalogenasefforwardrreverse. enzymes, which catalyze the conversion of phosphatidate (PA) to diacylglycerol, a key step in the biosynthesis of triacylglycerol, phosphatidylcholine, and phosphatidylethanolamine (3Han G.S. Wu W.I. Carman G.M. J. Biol. Chem. 2006; 281: 9210-9218Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar, 4Carman G.M. Han G.S. J. Biol. Chem. 2009; 284: 2593-2597Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 7Harris T.E. Huffman T.A. Chi A. Shabanowitz J. Hunt D.F. Kumar A. Lawrence Jr., J.C. J. Biol. Chem. 2007; 282: 277-286Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). Lipin-1 also acts as a transcriptional coactivator in hepatocytes, where it interacts with a complex containing peroxisome proliferator-activated receptor (PPAR) α and PPARγ coactivator-1α (PGC-1α) to regulate the expression of genes involved in fatty acid oxidation (5Finck B.N. Gropler M.C. Chen Z. Leone T.C. Croce M.A. Harris T.E. Lawrence Jr., J.C. Kelly D.P. Cell Metab. 2006; 4: 199-210Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar). Roles for lipin-2 and lipin-3 as transcriptional coactivators have not been characterized. Mg2+-dependent phosphatidate phosphatase phosphatidate peroxisome proliferator-activated receptor-α PPARγ coactivator protein-1α PPAR-response element quantitative PCR haloacid dehalogenase forward reverse. All three mammalian lipin family members function as PAP enzymes, raising the question of why multiple proteins are required. Previous gene expression studies in a panel of mouse and human tissues indicate that the three lipin genes have distinct but overlapping tissue distributions (6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). Lipin-1 is most prominently expressed in adipose tissue, skeletal muscle, cardiac muscle, and testis, with lower expression in other tissues, including liver, kidney, and brain. Lipin-2 is expressed at high levels in liver and also to some extent in kidney, brain, and gut. Lipin-3 is expressed at much lower levels in the tissues surveyed, but mRNA is detectable in liver and gut. There is some overlap in the tissue expression of some lipin family members, making it unclear how each contributes to PAP and coactivator function. For example, lipin-1 and lipin-2 are both expressed in liver, although the relative levels and cell types in which they are expressed have not been definitively determined. Studies of PAP and coactivator activity in liver have thus far focused largely on lipin-1, which is required for normal induction of fasting-induced gene expression (5Finck B.N. Gropler M.C. Chen Z. Leone T.C. Croce M.A. Harris T.E. Lawrence Jr., J.C. Kelly D.P. Cell Metab. 2006; 4: 199-210Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar), and accounts for the glucocorticoid-regulated PAP activity in this tissue (8Manmontri B. Sariahmetoglu M. Donkor J. Bou Khalil M. Sundaram M. Yao Z. Reue K. Lehner R. Brindley D.N. J. Lipid Res. 2008; 49: 1056-1067Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). However, recent work has also implicated lipin-2 as an important contributor to hepatic PAP activity, which is up-regulated in the liver of lipin-1-deficient mice, is induced by fasting, and is increased in obesity (9Gropler M.C. Harris T.E. Hall A.M. Wolins N.E. Gross R.W. Han X. Chen Z. Finck B.N. J. Biol. Chem. 2009; 284: 6763-6772Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). In addition, studies employing RNA-mediated silencing of lipin-1 or lipin-2 in cultured HeLa M cells and 3T3-L1 cells indicate that lipin-1 and lipin-2 have distinct functions (10Grimsey N. Han G.S. O'Hara L. Rochford J.J. Carman G.M. Siniossoglou S. J. Biol. Chem. 2008; 283: 29166-29174Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). Further evidence that lipin-1 and lipin-2 play distinct physiological roles comes from naturally occurring mutations in mice and humans. The founding member of the lipin family, lipin-1, is the defective gene product in the fatty liver dystrophy (fld) mouse (2Péterfy M. Phan J. Xu P. Reue K. Nat. Genet. 2001; 27: 121-124Crossref PubMed Scopus (475) Google Scholar), which carries a null mutation of Lpin1. This mouse exhibits generalized lipodystrophy, peripheral neuropathy, insulin resistance, and increased susceptibility to atherosclerosis (11Langner C.A. Birkenmeier E.H. Ben-Zeev O. Schotz M.C. Sweet H.O. Davisson M.T. Gordon J.I. J. Biol. Chem. 1989; 264: 7994-8003Abstract Full Text PDF PubMed Google Scholar, 12Langner C.A. Birkenmeier E.H. Roth K.A. Bronson R.T. Gordon J.I. J. Biol. Chem. 1991; 266: 11955-11964Abstract Full Text PDF PubMed Google Scholar, 13Reue K. Xu P. Wang X.P. Slavin B.G. J. Lipid Res. 2000; 41: 1067-1076Abstract Full Text Full Text PDF PubMed Google Scholar). Consistent with its tissue distribution, lipin-1 contributes the majority of PAP activity in adipose tissue and muscle (6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 7Harris T.E. Huffman T.A. Chi A. Shabanowitz J. Hunt D.F. Kumar A. Lawrence Jr., J.C. J. Biol. Chem. 2007; 282: 277-286Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar). Lipin-1 is also expressed in peripheral nerve, where it is required for normal Schwann cell function (14Nadra K. de Preux Charles A.S. Médard J.J. Hendriks W.T. Han G.S. Grès S. Carman G.M. Saulnier-Blache J.S. Verheijen M.H. Chrast R. Genes Dev. 2008; 22: 1647-1661Crossref PubMed Scopus (107) Google Scholar), and in liver, where it plays a role in response to fasting and in hepatic lipoprotein secretion (5Finck B.N. Gropler M.C. Chen Z. Leone T.C. Croce M.A. Harris T.E. Lawrence Jr., J.C. Kelly D.P. Cell Metab. 2006; 4: 199-210Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar, 8Manmontri B. Sariahmetoglu M. Donkor J. Bou Khalil M. Sundaram M. Yao Z. Reue K. Lehner R. Brindley D.N. J. Lipid Res. 2008; 49: 1056-1067Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 15Bou Khalil M. Sundaram M. Zhang H.Y. Links P.H. Raven J.F. Manmontri B. Sariahmetoglu M. Tran K. Reue K. Brindley D.N. Yao Z. J. Lipid Res. 2009; 50: 47-58Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 16Chen Z. Gropler M.C. Norris J. Lawrence Jr., J.C. Harris T.E. Finck B.N. Arterioscler. Thromb. Vasc. Biol. 2008; 28: 1738-1744Crossref PubMed Scopus (69) Google Scholar). Mutations in human LPIN1 have recently been detected and cause recurrent acute myoglobinuria in childhood (17Zeharia A. Shaag A. Houtkooper R.H. Hindi T. de Lonlay P. Erez G. Hubert L. Saada A. de Keyzer Y. Eshel G. Vaz F.M. Pines O. Elpeleg O. Am. J. Hum. Genet. 2008; 83: 489-494Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar), indicating a critical role for lipin-1 in human muscle function. Based on phenotypes resulting from human and mouse mutations, lipin-1 has a unique function in vivo. Less is known about the roles of lipin-2 or lipin-3 because mutant mouse models for these family members have not been characterized. However, rare human mutations in the LPIN2 gene cause Majeed syndrome, an inflammatory disorder characterized by chronic recurrent multifocal osteomyelitis, congenital dyserythropoietic anemia, and cutaneous inflammation (18El-Shanti H.I. Ferguson P.J. Clin. Orthop. Relat. Res. 2007; 462: 11-19Crossref PubMed Scopus (109) Google Scholar, 19Ferguson P.J. El-Shanti H.I. Curr. Opin. Rheumatol. 2007; 19: 492-498Crossref PubMed Scopus (129) Google Scholar). These symptoms indicate that lipin-2 plays a nonredundant function in vivo. Three distinct LPIN2 mutations have been identified in unrelated Arabic families. In one family, deletion of two nucleotides in the lipin-2 coding region leads to a premature stop codon in the first third of the protein (20Ferguson P.J. Chen S. Tayeh M.K. Ochoa L. Leal S.M. Pelet A. Munnich A. Lyonnet S. Majeed H.A. El-Shanti H. J. Med. Genet. 2005; 42: 551-557Crossref PubMed Scopus (312) Google Scholar), likely resulting in nonsense-mediated mRNA decay and no functional protein product. A second mutation occurs in the donor splice site for exon 17 of the LPIN2 gene, which leads to readthrough of intron sequences adding 65 irrelevant amino acid residues before reaching a stop codon (21Al-Mosawi Z.S. Al-Saad K.K. Ijadi-Maghsoodi R. El-Shanti H.I. Ferguson P.J. Arthritis Rheum. 2007; 56: 960-964Crossref PubMed Scopus (93) Google Scholar). Although both of these mutations would prevent production of full-length lipin-2 protein, the third known mutation is a point mutation that leads to a single amino acid substitution, S734L (20Ferguson P.J. Chen S. Tayeh M.K. Ochoa L. Leal S.M. Pelet A. Munnich A. Lyonnet S. Majeed H.A. El-Shanti H. J. Med. Genet. 2005; 42: 551-557Crossref PubMed Scopus (312) Google Scholar). The affected serine residue resides in the C-LIP domain downstream of the PAP active site and transcriptional coactivator motifs. This serine residue is conserved in all three lipin family members and across most species, suggesting a conformational requirement that is required either for catalytic activity and/or a transcriptional coactivator function. Here we characterize the effect of mutating the conserved serine on the PAP activity, membrane translocation properties, and coactivator functions of lipin-1 and lipin-2. Also because the Majeed syndrome affects blood, bone, and skin, this raises the question of whether lipin-2 has a direct role in the functions of these tissues. To investigate this, we perform a detailed expression analysis of lipin-2 by in situ hybridization of whole mice and qPCR of tissues relevant to Majeed syndrome. C57BL/6J mice were obtained from the Jackson Laboratory (Bar Harbor, ME). All mice were fed Purina 5001 mouse chow and were maintained on a 12:12-h light:dark cycle. Animal studies were performed under approval of the UCLA and University of Alberta, Edmonton, Institutional Animal Care and Use Committees. V5 epitope-tagged lipin-1 and lipin-2 expression plasmids were generated as described previously (6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). Site-directed mutagenesis was performed using the QuickChange site-directed mutagenesis kit (Stratagene). Oligonucleotides used are as follows: lipin-1AS721L (f, TACAAGTTTCTCTATTGTTTAGCACGTGCCATTGGGATGGCGGAC, and r, GTCCGCCATCCCAATGGCACGTGCTAAACAATAGAGAAACTTGTA); lipin-1AS721D (f, TACAAGTTTCTCTATTGTGACGCACGTGCCATTGGGATGGCGGAC, and r, GTCCGCCATCCCAATGGCACGTGCGTCACAATAGAGAAACTTGTA); lipin-2S731L (f, TGGCTACAAGTTTCTGTACTGTTTAGCACGTGCCATCGGCATGGC, and r, GCCATGCCGATGGCACGTGCTAAACAGTACAGAAACTTGTAGCCA); and lipin-2S731D (f, TGGCTACAAGTTTCTGTACTGTGACGCACGTGCCATCGGCATGGC, and r, GCCATGCCGATGGCACGTGCGTCACAGTACAGAAACTTGTAGCCA). HEK 293 and Hepa 1–6 cells (American Type Culture Collection, Manassas, VA) were propagated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics and incubated at 37 °C in 5% CO2. Cells were transfected with Effectene (Qiagen). Two days after transfection, the cells were lysed and assayed for PAP or luciferase reporter activity. PAP assays were performed as described previously (6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). Briefly, HEK 293 cells were homogenized in 0.25 m sucrose containing 2 mm dithiothreitol (to stabilize PAP activity), protease inhibitor mixture (EDTA-free, Roche Diagnostics), phosphatase inhibitor cocktails I and II (Sigma), and 0.15% Tween 20. We assayed PAP activity in a final volume of 0.1 ml containing 100 mm Tris maleate buffer, pH 7.5, 5 mm Mg2+, and 0.6 mm PA labeled with [3H]palmitate (about 75 Ci/mol) dispersed in 0.4 mm PC and 1 mm EDTA (22Jamal Z. Martin A. Gomez-Muñoz A. Brindley D.N. J. Biol. Chem. 1991; 266: 2988-2996Abstract Full Text PDF PubMed Google Scholar, 23Martin A. Gomez-Muñoz A. Jamal Z. Brindley D.N. Methods Enzymol. 1991; 197: 553-563Crossref PubMed Scopus (49) Google Scholar). The final concentration of Tween 20 in the assay was adjusted to 0.05%. Reactions were stopped after incubation at 37 °C with 2.2 ml of chloroform containing 0.08% olive oil as carrier for neutral lipids. Then 0.8 g of basic alumina was added to adsorb the PA and any [3H]palmitate formed by phospholipase A-type activities (23Martin A. Gomez-Muñoz A. Jamal Z. Brindley D.N. Methods Enzymol. 1991; 197: 553-563Crossref PubMed Scopus (49) Google Scholar). The tubes were centrifuged, and 1 ml of the chloroform, which contains the [3H]diacylglycerol product, was dried and quantitated by scintillation counting. Protein concentrations (measured by the Bradford method) and the times of incubation (normally 30 min) were adjusted so that <10% of the PA was consumed during the incubation. Total PAP activities were calculated from measurements at three different protein concentrations to ensure the proportionality of the assay. The activities measured in parallel assays containing 8 mm N-ethylmaleimide allowed us to estimate the contribution of lipid phosphate phosphatase activity to the total activity. This former activity was negligible compared with that of the overexpressed PAP activity, and therefore no correction was necessary in these experiments. PAP activity was normalized to lipin protein expression by quantitative Western blot analysis. Equivalent amounts of protein from each sample were electrophoresed in 3–8% SDS-polyacrylamide gradient gels (Invitrogen) and transferred to nitrocellulose membranes using a semi-dry electroblotter (Bio-Rad). Membranes were blocked with 5% nonfat milk powder in Tris-buffered saline and incubated overnight with mouse monoclonal anti-V5 antibody conjugated to horseradish peroxidase (Invitrogen). Protein bands were detected using ECL-Plus chemiluminescent reagent (Amersham Biosciences). Fluorescent signal was detected with the Typhoon Imaging System and quantified with ImageQuant software. Hepa 1–6 cells were transiently transfected with a PPRE-firefly luciferase reporter plasmid along with phRL-TK-renilla luciferase control vector (Promega), pCMX-PPARα, pCMX-PGC-1α, pCMX-RXR (kindly provided by Dr. Peter Tontonoz), and wild-type or mutant lipin expression plasmids. As a negative control to demonstrate specificity of the response, the PPRE-Luc reporter was replaced with a mutant version in which the PPRE sequences were deleted (ΔPPRE). Two days after transfection, cells were washed in 1× phosphate-buffered saline and lysed in Passive Lysis Buffer (Promega), and luciferase assays were performed using the Dual-Luciferase assay system (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for differences in transfection efficiency. In each experiment, samples were analyzed in quadruplicate. Measurement of the capacity of wild-type and mutant lipin-2 proteins to translocate to endoplasmic reticulum membranes was based upon our previous work (24Hopewell R. Martin-Sanz P. Martin A. Saxton J. Brindley D.N. Biochem. J. 1985; 232: 485-491Crossref PubMed Scopus (57) Google Scholar). Livers of male Sprague-Dawley rats were perfused with 60 ml of sterile ice-cold phosphate-buffered saline, pH 7.4, and homogenized in 0.25 m sucrose containing 2 mm dithiothreitol and 20 mm HEPES buffer, adjusted to pH 7.4 with KOH. The homogenates were centrifuged at 4 °C for 15,300 × g for 20 min, and the supernatant was then centrifuged for a further 400,000 × g for 40 min to pellet the microsomal fraction. This pellet was resuspended at 37 °C in homogenization buffer containing 6 mg/ml fatty acid-free bovine serum albumin and incubated for 20 min to remove fatty acids and dissociate bound lipin from the membranes. The microsomal membranes were then collected after re-centrifuging at 4 °C as above and resuspended in the same buffer. Recombinant lipins were expressed in HEK 293 cells, which were then homogenized in 0.25 m sucrose containing 2 mm dithiothreitol and 20 mm HEPES buffer, and adjusted to pH 7.4 with KOH and phosphatase inhibitor cocktails 1 and 2 from Sigma. The mitochondria-free supernatant was then isolated after centrifugation for 16,000 × g for 20 min to collect lipin-2 bound to endoplasmic reticulum membranes and in the cytosol. For the translocation experiments, 350 μg of liver microsomal protein was incubated for 5 min at 37 °C in a final volume of 20 μl of homogenizing buffer containing 6 mg/ml bovine serum albumin and 0–750 μm K+ oleate. The extract from the HEK 293 cells containing recombinant lipin (about 250 μg of total protein) was added, and the tubes were then incubated for 10 min at 37 °C to equilibrate the lipins between cytosol and membrane fractions (24Hopewell R. Martin-Sanz P. Martin A. Saxton J. Brindley D.N. Biochem. J. 1985; 232: 485-491Crossref PubMed Scopus (57) Google Scholar). Following this, the samples were cooled on ice for 5 min. The soluble proteins were then collected after centrifugation at 400,000 × g for 40 min at 4 °C. The pellets (membranes) were resuspended in 45 μl of homogenization buffer. The cytosolic fractions were treated with 4 volumes of acetone at −20 °C. The precipitated protein was collected by centrifugation and resolubilized in 45 μl of homogenization buffer. Samples for Western blotting were prepared with 4× NuPAGE LDS SB from Invitrogen and then stored at −80 °C. Total RNA was isolated from C57BL/6J mouse liver with TRIzol (Invitrogen), and cDNA was synthesized from 1 μg of RNA using Omniscript reverse transcriptase kit (Qiagen, Valencia, CA). The PCR-restriction fragment length polymorphism assay was performed by simultaneous amplification of lipin-2 and lipin-1 using the following primers (f, ACCATCTACCTGTGGAA, and r, AGAAACTTGTAGCCATTCT), followed by restriction enzyme digestion of amplified fragment with either EcoRV or PvuII (New England Biolabs). Products were analyzed by electrophoresis in 2% agarose. To generate templates for sense and antisense RNA generation, we PCR-amplified a 661-bp fragment of mouse lipin-2 cDNA (oligonucleotide primers f, cttcctaggccaccactcag, and r, tgaaataatctgccccaagg) and subcloned it into pCR 2.1-TOPO (Invitrogen). Plasmids were sequences to select templates for sense and antisense probe generation and linearized by digestion with BamHI. In situ hybridization was performed using the services of Phylogeny, Inc. (Columbus, OH). 35S-UTP-labeled cRNA of transcripts was synthesized by in vitro transcription and hybridized to mouse whole body or tissue sections. Whole body sections were prepared from adult mice fasted for 4–5 h in the morning before sacrifice. Additional tissues were prepared from animals with and without fasting, as indicated. Sections were frozen, cut into 10 μm thick sections, mounted on gelatin-coated slides, and stored at −80 °C. Sections were then hybridized overnight at 55 °C in 50% deionized formamide, 0.3 m NaCl, 20 mm Tris-HCl, pH 7.4, 5 mm EDTA, 10 mm NaH2PO4, 10% dextran sulfate, 1× Denhardt's, 50 μg/ml total yeast RNA, and 50,000–80,000 cpm/μl 35S-labeled cRNA probe. The tissues were subjected to stringent washing at 65 °C in 50% formamide, 2× SSC, 10 mm dithiothreitol and washed in phosphate-buffered saline before treatment with 20 μg/ml RNase A at 37 °C for 30 min. Following washes in 2× SSC and 0.1× SSC for 10 min at 37 °C, the slides were dehydrated, exposed to Kodak BioMaxMR x-ray film for 2–5 days, and then dipped in Kodak NTB nuclear track emulsion and exposed in light-tight boxes with desiccant at 4 °C for 10–15 days. Photographic development was carried out in Kodak D-19. Slides were counterstained lightly with hematoxylin and analyzed using both light and dark field optics. Sense control cRNA probes (identical to the mRNAs) always gave background levels of hybridization signal. Blood and tissues were isolated from adult male C57BL/6J mice. Red blood cells were isolated from fresh whole blood after centrifugation at 200 × g for 10 min at 4 °C. The spleen was divided into two pieces, and the white blood cell fraction was isolated from one piece by selective lysis of erythrocytes using 2.5 ml of lysis buffer (0.15 m NH4Cl, 10 mm KHCO3, 0.1 mm Na2EDTA), incubating at room temperature for 5 min, and collecting remaining cells (enriched in lymphocytes) by centrifugation at 200 × g for 10 min. Cells were washed in phosphate-buffered saline containing 3% fetal bovine serum, and the final pellet was used for RNA isolation. RNA and cDNA were prepared from blood cells or flash-frozen tissues (liver, spleen, and thymus) as described above. qPCR was performed with SYBR Green as described previously (6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 25Donkor J. Sparks L.M. Xie H. Smith S.R. Reue K. J. Clin. Endocrinol. Metab. 2008; 93: 233-239Crossref PubMed Scopus (57) Google Scholar). Primers were as follows: lipin-1, GCTCCCGAGAGAAAGTGGTGGA, GGCTTTCCATTCTCGCAGCTCCT; lipin-2, AGTTGACCCCATCACCGTAG, CCCAAAGCATCAGACTTGGT; and lipin-3, TGGAATTGGGATGACAAGGT, CACTGCAAGTACCCCTTGGT. Experimental groups were compared with appropriate control groups as indicated in the figure legends using the Student's t test and were considered statistically significant for p < 0.05. The Majeed S734L mutation in human lipin-2 alters a serine residue that is located in the C-LIP domain downstream of the enzyme active site and coactivator motifs (Fig. 1A). The affected serine residue is conserved in lipin-1, -2, and -3 in mammals and in orthologous proteins in other species. We investigated the biochemical basis for the Majeed syndrome in individuals carrying an S734L missense mutation in lipin-2 by analyzing PAP activity of recombinant mouse lipin-2 with a leucine substitution at the analogous serine residue, Ser 731. We also produced the corresponding mutation in mouse lipin-1A at Ser 724. Lipin-1 protein occurs in two forms (lipin-1A and lipin-1B) that result from alternative mRNA splicing, both of which have PAP activity (6Donkor J. Sariahmetoglu M. Dewald J. Brindley D.N. Reue K. J. Biol. Chem. 2007; 282: 3450-3457Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). The lipin-1A splice variant was utilized in all studies described here. We expressed lipin-1AS724L and lipin-2S731L in HEK 293 cells and determined PAP activity in cell lysates. Wild-type lipin-1A and lipin-2 served as positive controls. Wild-type lipin-1A and lipin-2 had robust PAP activity (63 ± 8.4 and 36 ± 3.1 nmol/mg/min, respectively) (Fig. 1B). As expected, mutation of the PAP motif (D679E) or the coactivator motif (IL693FF) abolished PAP activity, as has been reported previously (5Finck B.N. Gropler M.C. Chen Z. Leone T.C. Croce M.A. Harris T.E. Lawrence Jr., J.C. Kelly D.P. Cell Metab. 2006; 4: 199-210Abstract Full Text Full Text PDF PubMed Scopus (436) Google Scholar). The serine to leucine substitution found in Majeed patients likewise completely abolished PAP activity in both lipin-1 and lipin-2 backgrounds. Wild-type lipin-2 and lipin-2S731L proteins were expressed at similar levels, confirming that the lack of PAP activity is not related to reduced protein levels or protein stability (Fig. 1C and data not shown). Mutation of the Ser residue to aspartic acid likewise abolished PAP activity in both lipin-1A and lipin-2, indicating that activity cannot be restored by the presence of a negative charge (Fig. 1B). Studies performed several years ago, prior to the molecular identification of the lipin proteins, demonstrated that PAP enzymes reside in the cytosolic compartment of the cell. They translocate reversibly to endoplasmic reticulum membranes to catalyze the PAP reaction when cells are stimulated with unsaturated rather than saturated fatty acids (24Hopewell R. Martin-Sanz P. Martin A. Saxton J. Brindley D.N. Biochem. J. 1985; 232: 485-491Crossre" @default.
• W2015218125 created "2016-06-24" @default.
• W2015218125 creator A5006865443 @default.
• W2015218125 creator A5019944871 @default.
• W2015218125 creator A5026782652 @default.
• W2015218125 creator A5029040313 @default.
• W2015218125 creator A5043748600 @default.
• W2015218125 creator A5045859844 @default.
• W2015218125 creator A5046386333 @default.
• W2015218125 creator A5062851947 @default.
• W2015218125 date "2009-10-01" @default.
• W2015218125 modified "2023-10-17" @default.
• W2015218125 title "A Conserved Serine Residue Is Required for the Phosphatidate Phosphatase Activity but Not the Transcriptional Coactivator Functions of Lipin-1 and Lipin-2" @default.
• W2015218125 cites W1498869258 @default.
• W2015218125 cites W1503875668 @default.
• W2015218125 cites W1523366628 @default.
• W2015218125 cites W1890458784 @default.
• W2015218125 cites W1981861340 @default.
• W2015218125 cites W1989571181 @default.
• W2015218125 cites W1989595226 @default.
• W2015218125 cites W1998384937 @default.
• W2015218125 cites W1998682759 @default.
• W2015218125 cites W2002959031 @default.
• W2015218125 cites W2014241955 @default.
• W2015218125 cites W2029636772 @default.
• W2015218125 cites W2053976891 @default.
• W2015218125 cites W2068602754 @default.
• W2015218125 cites W2068859969 @default.
• W2015218125 cites W2069245374 @default.
• W2015218125 cites W2071684635 @default.
• W2015218125 cites W2073667659 @default.
• W2015218125 cites W2080086653 @default.
• W2015218125 cites W2080534089 @default.
• W2015218125 cites W2089441009 @default.
• W2015218125 cites W2097055799 @default.
• W2015218125 cites W2102651270 @default.
• W2015218125 cites W2110818806 @default.
• W2015218125 cites W2132468746 @default.
• W2015218125 cites W2135635187 @default.
• W2015218125 cites W2147013322 @default.
• W2015218125 cites W2154802584 @default.
• W2015218125 cites W2160241210 @default.
• W2015218125 cites W2162089651 @default.
• W2015218125 cites W2162774522 @default.
• W2015218125 cites W2184997735 @default.
• W2015218125 doi "https://doi.org/10.1074/jbc.m109.023663" @default.
• W2015218125 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2785625" @default.
• W2015218125 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/19717560" @default.
• W2015218125 hasPublicationYear "2009" @default.
• W2015218125 type Work @default.
• W2015218125 sameAs 2015218125 @default.
• W2015218125 citedByCount "117" @default.
• W2015218125 countsByYear W20152181252012 @default.
• W2015218125 countsByYear W20152181252013 @default.
• W2015218125 countsByYear W20152181252014 @default.
• W2015218125 countsByYear W20152181252015 @default.
• W2015218125 countsByYear W20152181252016 @default.
• W2015218125 countsByYear W20152181252017 @default.
• W2015218125 countsByYear W20152181252018 @default.
• W2015218125 countsByYear W20152181252019 @default.
• W2015218125 countsByYear W20152181252020 @default.
• W2015218125 countsByYear W20152181252021 @default.
• W2015218125 countsByYear W20152181252022 @default.
• W2015218125 countsByYear W20152181252023 @default.
• W2015218125 crossrefType "journal-article" @default.
• W2015218125 hasAuthorship W2015218125A5006865443 @default.
• W2015218125 hasAuthorship W2015218125A5019944871 @default.
• W2015218125 hasAuthorship W2015218125A5026782652 @default.
• W2015218125 hasAuthorship W2015218125A5029040313 @default.
• W2015218125 hasAuthorship W2015218125A5043748600 @default.
• W2015218125 hasAuthorship W2015218125A5045859844 @default.
• W2015218125 hasAuthorship W2015218125A5046386333 @default.
• W2015218125 hasAuthorship W2015218125A5062851947 @default.
• W2015218125 hasBestOaLocation W20152181251 @default.
• W2015218125 hasConcept C104317684 @default.
• W2015218125 hasConcept C11960822 @default.
• W2015218125 hasConcept C178666793 @default.
• W2015218125 hasConcept C184235292 @default.
• W2015218125 hasConcept C185592680 @default.
• W2015218125 hasConcept C195794163 @default.
• W2015218125 hasConcept C2776414213 @default.
• W2015218125 hasConcept C2781338088 @default.
• W2015218125 hasConcept C2909482567 @default.
• W2015218125 hasConcept C36020004 @default.
• W2015218125 hasConcept C55493867 @default.
• W2015218125 hasConcept C77445288 @default.
• W2015218125 hasConcept C86339819 @default.
• W2015218125 hasConcept C86803240 @default.
• W2015218125 hasConcept C95444343 @default.
• W2015218125 hasConceptScore W2015218125C104317684 @default.
• W2015218125 hasConceptScore W2015218125C11960822 @default.
• W2015218125 hasConceptScore W2015218125C178666793 @default.
• W2015218125 hasConceptScore W2015218125C184235292 @default.
• W2015218125 hasConceptScore W2015218125C185592680 @default.
• W2015218125 hasConceptScore W2015218125C195794163 @default.
• W2015218125 hasConceptScore W2015218125C2776414213 @default.
• W2015218125 hasConceptScore W2015218125C2781338088 @default.
• W2015218125 hasConceptScore W2015218125C2909482567 @default.

• next