FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2015334014> ?p ?o ?g. }

• W2015334014 endingPage "146" @default.
• W2015334014 startingPage "136" @default.
• W2015334014 abstract "Scavenger receptor class B type I (SR-BI) functions as an HDL receptor that promotes the selective uptake of cholesteryl esters (CEs). The physiological role of SR-BI in VLDL metabolism, however, is largely unknown. SR-BI deficiency resulted in elevated VLDL cholesterol levels, both on chow diet and upon challenge with high-cholesterol diets. To specifically elucidate the role of SR-BI in VLDL metabolism, the plasma clearance and hepatic uptake of 125I-β-VLDL were studied in SR-BI+/+ and SR-BI−/− mice. At 20 min after injection, 66 ± 2% of the injected dose was taken up by the liver in SR-BI+/+ mice, as compared with only 22 ± 4% (P = 0.0007) in SR-BI−/− mice. In vitro studies established that the Bmax of 125I-β-VLDL binding was reduced from 469 ± 30 ng/mg in SR-BI+/+ hepatocytes to 305 ± 20 ng/mg (P = 0.01) in SR-BI−/− hepatocytes. Both in vivo and in vitro, limited to no selective uptake of CEs from β-VLDL was found. Interestingly, HDL effectively competed for the association of β-VLDL in the presence as well as in the absence of SR-BI, indicating a second common recognition site. In conclusion, SR-BI plays an important physiological role in the metabolism of VLDL (remnants). Scavenger receptor class B type I (SR-BI) functions as an HDL receptor that promotes the selective uptake of cholesteryl esters (CEs). The physiological role of SR-BI in VLDL metabolism, however, is largely unknown. SR-BI deficiency resulted in elevated VLDL cholesterol levels, both on chow diet and upon challenge with high-cholesterol diets. To specifically elucidate the role of SR-BI in VLDL metabolism, the plasma clearance and hepatic uptake of 125I-β-VLDL were studied in SR-BI+/+ and SR-BI−/− mice. At 20 min after injection, 66 ± 2% of the injected dose was taken up by the liver in SR-BI+/+ mice, as compared with only 22 ± 4% (P = 0.0007) in SR-BI−/− mice. In vitro studies established that the Bmax of 125I-β-VLDL binding was reduced from 469 ± 30 ng/mg in SR-BI+/+ hepatocytes to 305 ± 20 ng/mg (P = 0.01) in SR-BI−/− hepatocytes. Both in vivo and in vitro, limited to no selective uptake of CEs from β-VLDL was found. Interestingly, HDL effectively competed for the association of β-VLDL in the presence as well as in the absence of SR-BI, indicating a second common recognition site. In conclusion, SR-BI plays an important physiological role in the metabolism of VLDL (remnants). The scavenger receptor class B type I (SR-BI) is a 57 kDa cell surface receptor that mediates the selective uptake of cholesteryl esters (CEs) from HDLs (1Acton S.L. Scherer P.E. Lodish H.F. Krieger M. Expression cloning of SR-BI, a CD36-related class B scavenger receptor.J. Biol. Chem. 1994; 269: 21003-21009Abstract Full Text PDF PubMed Google Scholar, 2Acton S. Rigotti A. Landschultz K.T. Xu S. Hobbs H.H. Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor.Science. 1996; 271: 518-520Crossref PubMed Scopus (1986) Google Scholar, 3Krieger M. Charting the fate of the “good cholesterol”: identification and characterization of the high-density lipoprotein receptor SR-BI.Annu. Rev. Biochem. 1999; 68: 523-558Crossref PubMed Scopus (458) Google Scholar). During this process, CEs from the core of the HDL particle are delivered into cells without degradation of the protein moiety. SR-BI is highly expressed in liver and steroidogenic tissues, plays a key role in HDL cholesterol metabolism, and regulates the supply of cholesterol to steroidogenic tissues (2Acton S. Rigotti A. Landschultz K.T. Xu S. Hobbs H.H. Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor.Science. 1996; 271: 518-520Crossref PubMed Scopus (1986) Google Scholar, 4Landschulz K.T. Pathak R.P. Rigotti A. Krieger M. Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic tissues of the rat.J. Clin. Invest. 1996; 98: 984-995Crossref PubMed Scopus (463) Google Scholar, 5Cao G. Garcia C.K. Wyne K.L. Schulz R.A. Parker K.L. Hobbs H.H. Structure and localization of the human gene encoding SR-BI/CLA-1. Evidence for transcriptional control by steroidogenic factor 1.J. Biol. Chem. 1997; 272: 33068-33076Abstract Full Text Full Text PDF PubMed Scopus (228) Google Scholar). Several lines of evidence indicate an anti-atherogenic role for SR-BI in atherogenesis. Huszar et al. showed that LDL receptor-deficient (LDLR−/−) mice with an attenuated expression of SR-BI are more susceptible to atherosclerotic lesion development (6Huszar D. Varban M. Lee Rinninger F. Feeley R. Arai T. Fairchild-Huntress V. Donovan M.J. Tall A.R. Increased LDL cholesterol and atherosclerosis in LDL receptor-deficient mice with attenuated expression of scavenger receptor B1.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1068-1073Crossref PubMed Scopus (150) Google Scholar). Furthermore, disruption of SR-BI in wild-type (7Van Eck M. Twisk J. Hoekstra M. Van Rij B.T. Van der Lans C.A. Bos I.S.T. Kruijt J.K. Kuipers F. Van Berkel T.J.C. Differential effects of scavenger receptor BI deficiency on lipid metabolism in cells of the arterial wall and in the liver.J. Biol. Chem. 2003; 278: 23699-23705Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar) as well as in LDLR−/− mice (8Covey S.D. Krieger M. Wang W. Penman M. Trigatti B.L. Scavenger receptor class B type I-mediated protection against atherosclerosis in LDL receptor-negative mice involves its expression in bone marrow-derived cells.Arterioscler. Thromb. Vasc. Biol. 2003; 23: 1589-1594Crossref PubMed Scopus (192) Google Scholar) results in a highly increased susceptibility to atherosclerotic lesion development. When cross-bred onto the apolipoprotein E knockout (apoE−/−) background, SR-BI deficiency leads to severe cardiac dysfunction and premature death (9Trigatti B. Rayburn H. Vinals M. Braun A. Miettinen H. Penman M. Hertz M. Schrenzel M. Amigo L. Rigotti A. et al.Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology.Proc. Natl. Acad. Sci. USA. 1999; 96: 9322-9327Crossref PubMed Scopus (437) Google Scholar, 10Braun A. Trigatti B.L. Post M.J. Sato K. Simons M. Edelberg J.M. Rosenberg R.D. Schrenzel M. Krieger M. Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice.Circ. Res. 2002; 90: 270-276Crossref PubMed Scopus (423) Google Scholar). Hepatic overexpression of SR-BI, on the other hand, protects against the development of atherosclerosis (11Kozarsky K.F. Donahee M.H. Glick J.M. Krieger M. Rader D.J. Gene transfer and hepatic overexpression of the HDL receptor SR-BI reduces atherosclerosis in the cholesterol-fed LDL receptor-deficient mouse.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 721-727Crossref PubMed Scopus (305) Google Scholar, 12Arai T. Wang N. Bezouevski M. Welch C. Tall A.R. Decreased atherosclerosis in heterozygous low density lipoprotein receptor-deficient mice expressing the scavenger receptor BI transgene.J. Biol. Chem. 1999; 274: 2366-2371Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 13Ueda Y. Gong E. Royer L. Cooper P.N. Francone O.L. Rubin E.M. Relationship between expression levels and atherogenesis in scavenger receptor class B, type I transgenics.J. Biol. Chem. 2000; 275: 20368-20373Abstract Full Text Full Text PDF PubMed Scopus (162) Google Scholar).The anti-atherogenic function of SR-BI is largely attributed to its role in the uptake of HDL CE by the liver. However, in addition to its role in controlling HDL cholesterol levels, SR-BI has also been implicated in the binding of a wide array of other ligands, including anionic phospholipids (14Rigotti A. Acton S.L. Krieger M. The class B scavenger receptors SR-BI and CD36 are receptors for anionic phospholipids.J. Biol. Chem. 1995; 270: 16221-16224Abstract Full Text Full Text PDF PubMed Scopus (489) Google Scholar), advanced glycation end-products (15Ohgami N. Nagai R. Miyazaki A. Ikemoto M. Arai H. Horiuchi S. Nakayama M. Scavenger receptor class B type I-mediated reverse cholesterol transport is inhibited by advanced glycation end products.J. Biol. Chem. 2001; 276: 13348-13355Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar), apoptotic cells (16Murao K. Terpstra V. Green S.R. Kondratenko N. Steinberg D. Quehenberger O. Characterization of CLA-1, a human homologue of rodent scavenger receptor BI, as a receptor for high density lipoprotein and apoptotic thymocytes.J. Biol. Chem. 1997; 272: 17551-17557Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar), and native and modified LDLs (2Acton S. Rigotti A. Landschultz K.T. Xu S. Hobbs H.H. Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor.Science. 1996; 271: 518-520Crossref PubMed Scopus (1986) Google Scholar, 17Gu X. Lawrence R. Krieger M. Dissociation of the high density lipoprotein and low density lipoprotein binding activities of murine scavenger receptor class B type I (mSR-BI) using retrovirus library-based activity dissection.J. Biol. Chem. 2000; 275: 9120-9130Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 18Calvo D. Gomez-Coronado D. Lasuncion M.A. Vega M.A. CLA-1 is an 85 kDa plasma membrane glycoprotein that acts as a high-affinity receptor for both native (HDL, LDL, and VLDL) and modified (OxLDL and AcLDL) lipoproteins.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 2341-2349Crossref PubMed Scopus (211) Google Scholar, 19Stangl H. Hyatt M. Hobbs H.H. Transport of lipids from high and low density lipoproteins via scavenger receptor-BI.J. Biol. Chem. 1999; 274: 32692-32698Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). Distinct binding sites on SR-BI mediate the binding of this wide variety of ligands. In vitro studies have demonstrated that HDL competes for the binding of LDL to SR-BI, whereas LDL only poorly inhibits the binding of HDL (2Acton S. Rigotti A. Landschultz K.T. Xu S. Hobbs H.H. Krieger M. Identification of scavenger receptor SR-BI as a high density lipoprotein receptor.Science. 1996; 271: 518-520Crossref PubMed Scopus (1986) Google Scholar, 17Gu X. Lawrence R. Krieger M. Dissociation of the high density lipoprotein and low density lipoprotein binding activities of murine scavenger receptor class B type I (mSR-BI) using retrovirus library-based activity dissection.J. Biol. Chem. 2000; 275: 9120-9130Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 18Calvo D. Gomez-Coronado D. Lasuncion M.A. Vega M.A. CLA-1 is an 85 kDa plasma membrane glycoprotein that acts as a high-affinity receptor for both native (HDL, LDL, and VLDL) and modified (OxLDL and AcLDL) lipoproteins.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 2341-2349Crossref PubMed Scopus (211) Google Scholar, 19Stangl H. Hyatt M. Hobbs H.H. Transport of lipids from high and low density lipoproteins via scavenger receptor-BI.J. Biol. Chem. 1999; 274: 32692-32698Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). Furthermore, SR-BI mutagenesis studies provided support for the proposal that the interaction of SR-BI with HDL differs from that with LDL (17Gu X. Lawrence R. Krieger M. Dissociation of the high density lipoprotein and low density lipoprotein binding activities of murine scavenger receptor class B type I (mSR-BI) using retrovirus library-based activity dissection.J. Biol. Chem. 2000; 275: 9120-9130Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar).Interestingly, SR-BI transgenics display reduced VLDL and LDL cholesterol levels (12Arai T. Wang N. Bezouevski M. Welch C. Tall A.R. Decreased atherosclerosis in heterozygous low density lipoprotein receptor-deficient mice expressing the scavenger receptor BI transgene.J. Biol. Chem. 1999; 274: 2366-2371Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 20Wang N. Arai T. Ji Y. Rinninger F. Tall A.R. Liver-specific overexpression of scavenger receptor BI decreases levels of very low density lipoprotein apoB, low density lipoprotein apoB, and high density lipoprotein in transgenic mice.J. Biol. Chem. 1998; 273: 32920-32926Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar), whereas disruption of the SR-BI gene in apoE−/− mice results in an increase in circulating VLDL and LDL levels (9Trigatti B. Rayburn H. Vinals M. Braun A. Miettinen H. Penman M. Hertz M. Schrenzel M. Amigo L. Rigotti A. et al.Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology.Proc. Natl. Acad. Sci. USA. 1999; 96: 9322-9327Crossref PubMed Scopus (437) Google Scholar, 10Braun A. Trigatti B.L. Post M.J. Sato K. Simons M. Edelberg J.M. Rosenberg R.D. Schrenzel M. Krieger M. Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice.Circ. Res. 2002; 90: 270-276Crossref PubMed Scopus (423) Google Scholar). In addition, adenoviral overexpression of SR-BI in liver reduces VLDL and LDL levels in C57Bl/6 mice (11Kozarsky K.F. Donahee M.H. Glick J.M. Krieger M. Rader D.J. Gene transfer and hepatic overexpression of the HDL receptor SR-BI reduces atherosclerosis in the cholesterol-fed LDL receptor-deficient mouse.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 721-727Crossref PubMed Scopus (305) Google Scholar, 21Kozarsky K.F. Donahee M.H. Rigotti A. Iqbal S.N. Edelman E.R. Krieger M. Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels.Nature. 1997; 387: 414-415Crossref PubMed Scopus (626) Google Scholar) and reverses fibrate-induced hypercholesterolemia in apoE−/− mice (22Fu T. Kozarsky K.F. Borensztajn J. Overexpression of SR-BI by adenoviral vector reverses the fibrate-induced hypercholesterolemia of apolipoprotein E-deficient mice.J. Biol. Chem. 2003; 278: 52559-52563Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). The anti-atherogenic effect of SR-BI could therefore also be caused in part by promoting the clearance of atherogenic apoB-containing lipoproteins. On the other hand, Webb et al. have recently shown that adenoviral overexpression of SR-BI in human apoB transgenic mice (23Webb N.R. de Beer M.C. Yu J. Kindy M.S. Daugherty A. Van der Westhuyzen D.R. de Beer F. Overexpression of SR-BI by adenoviral vector promotes clearance of apoA-I, but not apoB in human apoB transgenic mice.J. Lipid Res. 2002; 43: 1421-1428Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar) and apoE−/− mice (24Webb N.R. de Beer M.C. Van der Westhuyzen D.R. ApoB-containing lipoproteins in apoE-deficient mice are not metabolized by the class B scavenger receptor BI.J. Lipid Res. 2004; 45: 272-280Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar) only minimally affected LDL cholesterol levels. Furthermore, in the apoE−/− mice, no effect on VLDL cholesterol, the major cholesterol-transporting lipoprotein in these mice, was observed. The atherogenic form of VLDL that accumulates in animals on a high-cholesterol diet is β-migrating VLDL (β-VLDL), the ultimate remnant of LPL-mediated lipolysis of VLDL triglycerides (25Mahley R.W. Holcombe K.S. Alterations of the plasma lipoproteins and apoproteins following cholesterol feeding in rats.J. Lipid Res. 1977; 18: 314-324Abstract Full Text PDF PubMed Google Scholar, 26Shore V.G. Shore B. Hart R.G. Changes in apolipoproteins and properties of rabbit very low density lipoproteins on induction of cholesteremia.Biochemistry. 1974; 13: 1579-1585Crossref PubMed Scopus (143) Google Scholar). In the present study, we utilized radiolabeled β-VLDL to exclude a possible limiting role of LPL activity in the clearance of VLDL. Direct evidence for a role of SR-BI in β-VLDL metabolism in vivo was obtained by performing serum decay and liver uptake studies in SR-BI-deficient mice and wild-type littermates. In addition, the effect of SR-BI deficiency on the metabolism of β-VLDL was determined in vitro using primary hepatocytes isolated from SR-BI-deficient and wild-type mice.EXPERIMENTAL PROCEDURESMiceSR-BI knock-out mice were kindly provided by Dr. M. Krieger. In these mice, the entire coding region of the first exon, constituting the N-terminal cytoplasmic domain and a portion of the N-terminal transmembrane domain, were deleted, leading to a functionally null allele (27Rigotti A. Trigatti B.L. Penman M. Rayburn H. Herz J. Krieger M. A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism.Proc. Natl. Acad. Sci. USA. 1997; 94: 12610-12615Crossref PubMed Scopus (749) Google Scholar). Heterozygous SR-BI knock-out mice were crossed to generate wild-type (SR-BI+/+), heterozygous mutant (SR-BI+/−), and homozygous mutant (SR-BI−/−) progeny. The presence of the targeted and/or wild-type SR-BI alleles was determined by PCR amplification of DNA extracted from tail biopsies. The primers 5′-GAT-GGG-ACA-TGG-GAC-ACG-AAG-CCA-TTC-T-3′ and 5′-TCT-GTC-TCC-GTC-TCC-TTC-AGG-TCC-TGA-3′ were used to detect the presence of the targeted and the wild-type SR-BI allele simultaneously. PCR resulted in a 1.0 kb band and a 1.5 kb amplification product diagnostic of the wild-type and the targeted allele, respectively. Mice were maintained on sterilized regular chow, containing 4.3% (w/w) fat and no added cholesterol (RM3; Special Diet Services, Witham, UK), or when indicated, a semi-synthetic Western-type diet, containing 15% (w/w) fat and 0.25% (w/w) cholesterol (Diet W; Abdiets, Woerden, The Netherlands) or a high-cholesterol/cholate diet, containing 15% (w/w) fat, 1% cholesterol, and 0.5% cholate (Diet N; Abdiets). Animal experiments were performed at the Gorlaeus Laboratories of the Leiden/Amsterdam Center for Drug Research in accordance with national laws and conducted in conformity with the Public Health Service Policy. All experimental protocols were approved by the Ethics Committee for Animal Experiments of Leiden University.Cholesterol analysesAfter an overnight fasting period, approximately 100 μl of blood was drawn by tail bleeding. The concentrations of free cholesterol in serum were determined by enzymatic colorimetric assays with 0.025 U/ml cholesterol oxidase (Sigma) and 0.065 U/ml peroxidase (Roche Diagnostics; Mannheim, Germany) in reaction buffer (1.0 KPi buffer, pH 7.7, containing 0.01 M phenol, 1 mM 4-amino-antipyrine, 1% polyoxyethylene-9-laurylether, and 7.5% methanol). Total cholesterol content was determined after addition of 15 μg/ml cholesteryl esterase (Roche Diagnostics). Absorbance was read at 490 nm. The distribution of cholesterol over the different lipoproteins in serum was determined by fractionation of 30 μl serum of each mouse using a Superose 6 column (3.2 × 300 mm; Smart-system, Pharmacia, Uppsala, Sweden). Total cholesterol content of the effluent was determined as above.Analysis of gene expression by real-time quantitative PCRTotal RNA was extracted from liver by the acid guanidium thiocyanate-phenol chloroform extraction method according to Chomczynski and Sacchi (28Chomczynski P. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62993) Google Scholar). cDNA was synthesized from 0.5–1 μg of total RNA using RevertAid™ M-MuLV Reverse Transcriptase according to the manufacturer's instructions. mRNA levels were quantitatively determined on an ABI Prism® 7700 Sequence Detection system (Applied Biosystems; Foster City, CA) using SYBR-green technology. PCR primers (Table 1) were designed using Primer Express 1.5 software with the manufacturer's default settings (Applied Biosystems). mRNA expression levels are indicated relative to the average of the housekeeping genes hypoxanthine phosphoribosyltransferase (HPRT), GAPDH, ribosomal protein 36B4, and 18Sr-RNA.TABLE 1Primers for real-time PCR analysisGeneGenBank Accession NumberForward PrimerReverse PrimerAmplicon Size (bp)SR-BINM016741GGCTGCTGTTTGCTGCGGCTGCTTGATGAGGGAGGG63LRP-1NM008512TGGGTCTCCCGAAATCTGTTACCACCGCATTCTTGAAGGA95LDLRZ19521CTGTGGGCTCCATAGGCTATCTGCGGTCCAGGGTCATCTTC68HPRTJ00423TTGCTCGAGATGTCATGAAGGAAGCAGGTCAGCAAAGAACTTATAGC91GAPDHNM008084TCCATGACAACTTTGGCATTGTCACGCCACAGCTTTCCA10336B4NM007475GGACCCGAGAAGACCTCCTTGCACATCACTCAGAATTTCAATGG8518Sr-RNAX00686CCATTCGAACGTCTGCCCGTCACCCGTGGTCACCATG69HPRT, hypoxanthine phosphoribosyltransferase; LDLR, LDL receptor; LRP-1, LDL receptor-related protein type 1; SR-BI, scavenger receptor class B type I. Open table in a new tab Immunoblot analysisLiver homogenate was prepared by lysis in 50 mM Tris-HCl, 1% Triton-X100, 0.5% deoxycholate, 1% SDS containing 0.02 μg/ml leupeptin, 0.02 μg/ml aprotinin, and 0.02 μg/ml trypsin inhibitor. Cell debris was removed by centrifugation at 10,000 rpm for 10 min, and the protein concentration was determined according to Lowry et al. (29Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. Protein measurement with Folin phenol reagent.J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Equal amounts of protein were separated on 7.5% SDS-PAGE gels and electrophoretically transferred to Protran nitrocellulose membrane (Schleicher and Schnell; Dassel, Germany). Immunolabeling was performed using either rabbit polyclonal α-SR-BI (ab3; Abcam, Cambridge, UK), rabbit polyclonal α-GAPDH (ab9485; Abcam), goat polyclonal α-LDL receptor-related protein type 1 (α-LRP-1) (sc16166; Santa Cruz Biotechnology, Santa Cruz, CA), or goat polyclonal α-LDLR (sc11824; Santa Cruz Biotechnology) as primary antibodies and horseradish peroxidase-conjugated goat-anti-rabbit IgG and donkey-anti-goat IgG (Jackson ImmunoResearch), respectively, as secondary antibodies. Finally, immunolabeling was detected by ECL (Amersham Bioscience, UK).In vivo VLDL productionSR-BI+/+ and SR-BI−/− mice were injected intravenously with 500 mg of Triton WR-1339 (Sigma) per kg body weight as a 15 g/dl solution in 0.9% NaCl after an overnight fast. Previous studies have shown that plasma VLDL clearance is virtually completely inhibited under these conditions (30Aalto-Setälä K. Fisher E.A. Chen X. Chajek-Shaul T. Hayek T. Zechner R. Walsh A. Ramakrishnan R. Ginsberg H.N. Breslow J.L. Mechanism of hypertriglyceridemia in human apolipoprotein (apo) CIII transgenic mice. Diminished very low density lipoprotein fractional catabolic rate associated with increased apo CIII and reduced apo E on the particles.J. Clin. Invest. 1992; 90: 1889-1900Crossref PubMed Scopus (400) Google Scholar). Blood samples (50 μl) were taken at 0, 1, 2, 3, and 4 h after Triton WR-1339 injection. Plasma triglycerides were analyzed enzymatically and were related to the body mass of the animals. The hepatic VLDL production rate was calculated from the slope of the curve and expressed as g/h/kg body weight.Determination of lipolytic enzyme activityTo determine total body LPL and HL activity, blood was drawn from SR-BI+/+ and SR-BI−/− mice after an overnight fast and at 20 min after an intravenous bolus injection of heparin (100 U/kg). The lipolytic activity of the postheparin plasma was measured by using a radiolabeled triolein emulsion, as described by Zechner (31Zechner R. Rapid and simple isolation procedure for lipoprotein lipase from human milk.Biochim. Biophys. Acta. 1990; 1044: 20-25Crossref PubMed Scopus (48) Google Scholar). In brief, the substrate consisted of a radiolabeled triolein emulsion prepared by sonication of a mixture of 50 mCi glycerol-tri[9,10(n)-3 H]oleate, 4 mg of unlabeled glycerol trioleate, 0.1 mol/l Tris-HCl (pH 8.6), 0.1% Triton X-100, 2% BSA, and 2 ml of heat-inactivated human serum (a source of apoC-II, an LPL activator). Subsequently, 10 μl plasma was added to 0.2 ml of substrate and incubated for 30 min at 37°C. The reaction was stopped by addition of 3.25 ml of a mixture of chloroform-methanol-n-heptane (1:1.28:1.37, v/v/v) and 1 ml of 0.1 mol/l K2CO3-H3BO3 (pH 10.5). FFAs were extracted by vortexing this mixture for 15 s; phases were separated by centrifugation at 3,000 rpm at 4°C for 20 min, and 1 ml of the upper phase was counted for radioactivity. The lipolytic activity was calculated from the amount of FFAs released per milliliter per minute. The lipolytic activity was determined in the presence or absence of 1 mol/l NaCl to differentiate between LPL and HL activity. LPL activity was calculated as the portion of total lipase activity inhibited by 1 mol/l NaCl.LipoproteinsHuman LDL (1.019 g/ml < d < 1.063 g/ml) and HDL (1.063 g/ml < d < 1.21 g/ml) was isolated from serum of healthy volunteers as described by Redgrave et al. (32Redgrave T.G. Roberts D.C. West C.E. Separation of plasma lipoproteins by density-gradient ultracentrifugation.Anal. Biochem. 1975; 65: 42-49Crossref PubMed Scopus (865) Google Scholar).β-VLDL was isolated from male Wistar rats (Charles River; Maastricht, The Netherlands) that were fed a diet containing 2% cholesterol, 5% olive oil, and 0.5% cholate (Hope Farms; Woerden, The Netherlands) for 2 weeks. After overnight fasting, blood was collected from the abdominal aorta and β-VLDL (d < 1.006 g/ml) was isolated using a discontinous KBr gradient, as described by Redgrave, Roberts, and West (32Redgrave T.G. Roberts D.C. West C.E. Separation of plasma lipoproteins by density-gradient ultracentrifugation.Anal. Biochem. 1975; 65: 42-49Crossref PubMed Scopus (865) Google Scholar). The fraction of d < 1.006 g/ml was isolated and dialysed against PBS-1 mM EDTA. The β-VLDL consisted of 10 ± 0.7% protein (of which 42% was apoE, 25% apoB-100, 10% apoB-48, 10% apoC, 10% apoA-I, 2% apoA-II, and 1% apoA-IV) and 90 ± 7.3% lipids [of which 18% were phospholipids (PL), 16% triacylglycerols (TGs), 55% CEs, and 11% free cholesterol (FC)], and displayed β-mobility on agarose gels. The isolated β-VLDL was labeled with 125I at pH 10.0 according to McFarlane (33McFarlane A.S. Efficient trace-labelling of proteins with iodine.Nature. 1958; 182: 53-57Crossref PubMed Scopus (1491) Google Scholar), modified as described earlier (34Nagelkerke J.F. Barto K.P. Van Berkel T.J.C. In vivo and in vitro uptake and degradation of acetylated low density lipoprotein by rat liver endothelial, Kupffer and parenchymal cells.J. Biol. Chem. 1983; 258: 12221-12227Abstract Full Text PDF PubMed Google Scholar), or labeled with cholesteryl [1α,2α (n)-3H] oleate (Amersham) by exchange from donor particles as reported previously (35Pieters M.N. Schouten D. Bakkeren H.F. Esbach B. Brouwer A. Knook D.L. Van Berkel T.J.C. Selective uptake of CE from apolipoprotein-E-free high-density lipoproteins by rat parenchymal cells in vivo is efficiently coupled to bile acid synthesis.Biochem. J. 1991; 280: 359-365Crossref PubMed Scopus (56) Google Scholar).VLDL serum decay and liver uptakeThe serum decay and liver uptake of β-VLDL was determined in SR-BI−/− mice and wild-type SR-BI+/+ littermates as described previously (36Van Eck M. Herijgers N. Yates J. Pearce N.J. Hoogerbrugge P.M. Groot P.H.E. Van Berkel T.J.C. Bone marrow transplantation in apolipoprotein E-deficient mice. Effect of apoE gene dosage on serum lipid concentrations, (beta)VLDL catabolism, and atherosclerosis.Arterioscler. Thromb. Vasc. Biol. 1997; 17: 3117-3126Crossref PubMed Scopus (84) Google Scholar, 37Out R. Kruijt J.K. Rensen P.C.N. Hildebrand R.B. De Vos P. Van Eck M. Van Berkel T.J.C. Scavenger receptor BI plays a role in facilitating chylomicron metabolism.J. Biol. Chem. 2004; 279: 18401-18406Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). Briefly, mice were anesthetized by subcutaneous injection of ketamine (60 mg/kg; Eurovet), fentanyl citrate, and fluanisone (1.26 mg/kg and 2 mg/kg, respectively; Janssen). The abdomen was opened and 10 μg 125I-β-VLDL or 3H-β-VLDL was injected into the vena cava inferior. At the indicated times, blood samples (50 μl) were drawn from the vena cava inferior, and liver lobules were tied off, excised, and weighed. Serum samples and liver lobules were counted for radioactivity. The total amount of radioactivity in serum was determined with the equation: serum volume (ml) = [0.0219 × body weight (g)] +2.66. At the indicated times after injection, the distribution of 125I over the different lipoproteins in serum was analyzed by fractionation of 30 μl serum of each mouse using a Superose 6 column (3.2 × 30 mm, Smart-system; Pharmacia) and determination of the radioactivity in the effluent.In vitro association and degradation studies with primary hepatocyesHepatocytes were isolated from SR-BI+/+ and SR-BI−/− mice by linear perfusion at 37°C according to the method of Seglen (38Seglen P.O. Preparation of isolated rat liver cells.Methods Cell Biol. 1976; 13: 29-83Crossref PubMed Scopus (5198) Google Scholar), as previously described (39Henriksen T. Mahoney E.M. Steinberg D. Enhanced macrophage degradation of low-density lipoprotein previously incubated with cultured endothelial cells: recognition by receptors for acetylated low-density lipoprotein.Proc. Natl. Acad. Sci. USA. 1981; 78: 6499-6503Crossref PubMed Scopus (811) Google Scholar). Briefly, the liver was perfused with a 0.05% (w/v) collagenase type IV (Sigma) in a buffer of 67 mM NaCl, 6.7 mM KCl, 4.8 mM CaCl2, 67 mM Hepes, and 2% BSA for 10 min at a flow rate of 14 ml/min. Subsequently, hepatocytes were isolated by gently mincing the liver in Hanks' buffer containing 0.3% BSA, filtered through nylon gauze, and centrifuged three times for 10 min at 50 g. The cell pellets consisted of pure (>99%) hepatocytes as judged by light microscopy, and the viability of the cells was >90% as determined by" @default.
• W2015334014 created "2016-06-24" @default.
• W2015334014 creator A5000147978 @default.
• W2015334014 creator A5003293658 @default.
• W2015334014 creator A5024719221 @default.
• W2015334014 creator A5024733637 @default.
• W2015334014 creator A5031525436 @default.
• W2015334014 creator A5036385467 @default.
• W2015334014 creator A5047210389 @default.
• W2015334014 date "2008-01-01" @default.
• W2015334014 modified "2023-10-15" @default.
• W2015334014 title "Scavenger receptor BI facilitates the metabolism of VLDL lipoproteins in vivo" @default.
• W2015334014 cites W1490154674 @default.
• W2015334014 cites W1519847653 @default.
• W2015334014 cites W1523684025 @default.
• W2015334014 cites W1574380753 @default.
• W2015334014 cites W1600508667 @default.
• W2015334014 cites W1764819423 @default.
• W2015334014 cites W1775749144 @default.
• W2015334014 cites W1983038560 @default.
• W2015334014 cites W1985170971 @default.
• W2015334014 cites W1987525850 @default.
• W2015334014 cites W1991694968 @default.
• W2015334014 cites W1993473307 @default.
• W2015334014 cites W1995706082 @default.
• W2015334014 cites W1997678048 @default.
• W2015334014 cites W1999163997 @default.
• W2015334014 cites W2001995220 @default.
• W2015334014 cites W2005525334 @default.
• W2015334014 cites W2010619989 @default.
• W2015334014 cites W2016597009 @default.
• W2015334014 cites W2017120858 @default.
• W2015334014 cites W2022376333 @default.
• W2015334014 cites W2024131238 @default.
• W2015334014 cites W2025197525 @default.
• W2015334014 cites W2026637429 @default.
• W2015334014 cites W2026658644 @default.
• W2015334014 cites W2027338183 @default.
• W2015334014 cites W2030479102 @default.
• W2015334014 cites W2034968148 @default.
• W2015334014 cites W2035252462 @default.
• W2015334014 cites W2038919289 @default.
• W2015334014 cites W2040579726 @default.
• W2015334014 cites W2043832254 @default.
• W2015334014 cites W2048890665 @default.
• W2015334014 cites W2051199633 @default.
• W2015334014 cites W2053984226 @default.
• W2015334014 cites W2063358283 @default.
• W2015334014 cites W2064484544 @default.
• W2015334014 cites W2066288680 @default.
• W2015334014 cites W2066298745 @default.
• W2015334014 cites W2069027872 @default.
• W2015334014 cites W2069421471 @default.
• W2015334014 cites W2069421633 @default.
• W2015334014 cites W2073308465 @default.
• W2015334014 cites W2075952712 @default.
• W2015334014 cites W2081695716 @default.
• W2015334014 cites W2082964386 @default.
• W2015334014 cites W2085536531 @default.
• W2015334014 cites W2085649019 @default.
• W2015334014 cites W2087250632 @default.
• W2015334014 cites W2092270878 @default.
• W2015334014 cites W2093099491 @default.
• W2015334014 cites W2098616846 @default.
• W2015334014 cites W2102642680 @default.
• W2015334014 cites W2116932350 @default.
• W2015334014 cites W2126076118 @default.
• W2015334014 cites W2130086266 @default.
• W2015334014 cites W2132512455 @default.
• W2015334014 cites W2140878307 @default.
• W2015334014 cites W2145532583 @default.
• W2015334014 cites W2150436995 @default.
• W2015334014 cites W2153170868 @default.
• W2015334014 cites W2156818917 @default.
• W2015334014 cites W2160942744 @default.
• W2015334014 cites W2161419248 @default.
• W2015334014 cites W2162330918 @default.
• W2015334014 cites W2166648967 @default.
• W2015334014 cites W2169283243 @default.
• W2015334014 cites W2169914332 @default.
• W2015334014 cites W2170522996 @default.
• W2015334014 cites W4294216491 @default.
• W2015334014 doi "https://doi.org/10.1194/jlr.m700355-jlr200" @default.
• W2015334014 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17954936" @default.
• W2015334014 hasPublicationYear "2008" @default.
• W2015334014 type Work @default.
• W2015334014 sameAs 2015334014 @default.
• W2015334014 citedByCount "86" @default.
• W2015334014 countsByYear W20153340142012 @default.
• W2015334014 countsByYear W20153340142013 @default.
• W2015334014 countsByYear W20153340142014 @default.
• W2015334014 countsByYear W20153340142015 @default.
• W2015334014 countsByYear W20153340142016 @default.
• W2015334014 countsByYear W20153340142017 @default.
• W2015334014 countsByYear W20153340142018 @default.
• W2015334014 countsByYear W20153340142019 @default.
• W2015334014 countsByYear W20153340142020 @default.
• W2015334014 countsByYear W20153340142021 @default.

• next