FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2015388675> ?p ?o ?g. }

• W2015388675 endingPage "13676" @default.
• W2015388675 startingPage "13668" @default.
• W2015388675 abstract "The rabbit antibody repertoire, which in the form of polyclonal antibodies has been used in diagnostic applications for decades, would be an attractive source for the generation of therapeutic human antibodies. The humanization of rabbit antibodies, however, has not been reported. Here we use phage display technology to select and humanize antibodies from rabbits that were immunized with human A33 antigen which is a target antigen for the immunotherapy of colon cancer. We first selected rabbit antibodies that bind to a cell surface epitope of human A33 antigen with an affinity in the 1 nm range. For rabbit antibody humanization, we then used a selection strategy that combines grafting of the complementarity determining regions with framework fine tuning. The resulting humanized antibodies were found to retain both high specificity and affinity for human A33 antigen. The rabbit antibody repertoire, which in the form of polyclonal antibodies has been used in diagnostic applications for decades, would be an attractive source for the generation of therapeutic human antibodies. The humanization of rabbit antibodies, however, has not been reported. Here we use phage display technology to select and humanize antibodies from rabbits that were immunized with human A33 antigen which is a target antigen for the immunotherapy of colon cancer. We first selected rabbit antibodies that bind to a cell surface epitope of human A33 antigen with an affinity in the 1 nm range. For rabbit antibody humanization, we then used a selection strategy that combines grafting of the complementarity determining regions with framework fine tuning. The resulting humanized antibodies were found to retain both high specificity and affinity for human A33 antigen. immunoglobulin complementarity-determining region variable domain constant domain antibody fragment heavy chain fragment single-chain variable domain fragment phosphate-buffered saline enzyme-linked immunosorbent assay Tris-buffered saline polyacrylamide gel electophoresis The growing significance of antibody-based strategies for the treatment of a variety of diseases demands efficient and reliable routes to human or humanized antibodies with high specificity and affinity. Nonhuman antibodies are highly immunogenic in humans thereby limiting their potential use for therapeutic applications, especially when repeated administration is necessary. In order to reduce their immunogenicity, nonhuman antibodies have been humanized using strategies that are based on rational design, in vitroevolution, or a combination of both. An alternative route is the direct generation of human antibodies from transgenic mice containing human immunoglobulin (Ig)1 loci or by selection from naive or synthetic human antibody libraries displayed on phage (1.Barbas III, C.F. Nat. Med. 1995; 1: 837-839Crossref PubMed Scopus (40) Google Scholar, 2.Hudson P.J. Curr. Opin. Immunol. 1999; 11: 548-557Crossref PubMed Scopus (178) Google Scholar). Here we exploit a new route to humanized antibodies. We use phage display technology to select and humanize antibodies from rabbits that were immunized with a human antigen. Monoclonal antibodies from multiple species are accessible by screening combinatorial antibody libraries displayed on phage (3.Rader C. Barbas III, C.F. Curr. Opin. Biotechnol. 1997; 8: 503-508Crossref PubMed Scopus (197) Google Scholar). The accessibility of antibody repertoires of multiple species might become substantial in the search for new therapeutic antibodies. In particular the rabbit antibody repertoire, which in the form of polyclonal antibodies has been used in diagnostic applications for decades, would be an attractive source for therapeutic antibodies. The humanization of rabbit antibodies, however, has not been reported. To allow selective antibody targeting, both high specificity of the antibody and restrictive tissue expression of the antigen are required. For cancer therapy, only a few antibody-antigen systems that meet these requirements have been identified (4.Scott A.M. Welt S. Curr. Opin. Immunol. 1997; 9: 717-722Crossref PubMed Scopus (75) Google Scholar). The A33 system which has been established in clinical trials is one of them (5.Welt S. Divgi C.R. Real F.X. Yeh S.D. Garin-Chesa P. Finstad C.L. Sakamoto J. Cohen A. Sigurdson E.R. Kemeny N. Carswell E.A. Oettgen H.F. Old L.J. J. Clin. Oncol. 1990; 8: 1894-1906Crossref PubMed Scopus (111) Google Scholar, 6.Welt S. Divgi C.R. Kemeny N. Finn R.D. Scott A.M. Graham M. Germain J.S. Richards E.C. Larson S.M. Oettgen H.F. Old L.J. J. Clin. Oncol. 1994; 12: 1561-1571Crossref PubMed Scopus (145) Google Scholar, 7.Welt S. Scott A.M. Divgi C.R. Kemeny N.E. Finn R.D. Daghighian F. Germain J.S. Richards E.C. Larson S.M. Old L.J. J. Clin. Oncol. 1996; 14: 1787-1797Crossref PubMed Scopus (155) Google Scholar). Mouse monoclonal antibody A33 (5.Welt S. Divgi C.R. Real F.X. Yeh S.D. Garin-Chesa P. Finstad C.L. Sakamoto J. Cohen A. Sigurdson E.R. Kemeny N. Carswell E.A. Oettgen H.F. Old L.J. J. Clin. Oncol. 1990; 8: 1894-1906Crossref PubMed Scopus (111) Google Scholar) detects an antigen that is expressed in normal human colon epithelial cells and by >95% of human colon cancers. Human A33 antigen (8.Heath J.K. White S.J. Johnstone C.N. Catimel B. Simpson R.J. Moritz R.L. Tu G.F. Ji H. Whitehead R.H. Groenen L.C. Scott A.M. Ritter G. Cohen L. Welt S. Old L.J. Nice E.C. Burgess A.W. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 469-474Crossref PubMed Scopus (157) Google Scholar, 9.Ritter G. Moritz R.L. Ji H. Cohen L.S. Nice E.C. Catimel B. Heath J.K. White S.J. Welt S. Burgess A.W. Old L.J. Simpson R.J. Biochem. Biophys. Res. Commun. 1997; 236: 682-686Crossref PubMed Scopus (39) Google Scholar) is a transmembrane glycoprotein of the Ig superfamily. It consists of 2 extracellular Ig folds, a single transmembrane domain, and a highly polar intracellular tail containing aS-palmitoylation site. The function of the human A33 antigen in normal and malignant colon tissue is not yet known, however, several properties of the A33 antigen suggested that it is a promising target for immunotherapy of colon cancer (10.Welt S. Ritter G. Semin. Oncol. 1999; 26: 683-690PubMed Google Scholar). These properties include (i) the highly restricted expression pattern of the A33 antigen, (ii) the expression of large amounts of the A33 antigen on colon cancer cells, (iii) the absence of secreted or shed A33 antigen, (iv) the fact that upon binding of antibody A33 to the A33 antigen, antibody A33 is internalized and sequestered in vesicles, and (v) the good targeting of antibody A33 to A33 antigen expressing colon cancer in preliminary clinical studies. Here we chose the human A33 antigen as a therapeutically relevant target to demonstrate both the applicability and rationale of generating humanized antibodies from immune rabbits. Human colon cancer cell lines LIM1215, SW1222, HT29, and SW620 were obtained from the cell bank of the Ludwig Institute for Cancer Research at Memorial Sloan-Kettering Cancer Center. A 1.6-kilobaseXhoI/PstI cDNA fragment, containing the full-length coding sequence of human A33 antigen (8.Heath J.K. White S.J. Johnstone C.N. Catimel B. Simpson R.J. Moritz R.L. Tu G.F. Ji H. Whitehead R.H. Groenen L.C. Scott A.M. Ritter G. Cohen L. Welt S. Old L.J. Nice E.C. Burgess A.W. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 469-474Crossref PubMed Scopus (157) Google Scholar), was subcloned into pBlueBac4 transfer vector (Invitrogen, San Diego, CA). Transfection of Sf9 cells, isolation of recombinant viruses, and subsequent infection of Sf9 cells was performed according to the manufacturer's recommendations. Recombinant protein was purified from cell extracts as described (11.Moritz R.L. Ritter G. Catimel B. Cohen L.S. Welt S. Old L.J. Burgess A.W. Nice E.C. Simpson R.J. J. Chromatogr. Sect. A. 1998; 798: 91-101Crossref PubMed Scopus (16) Google Scholar). Over a period of 4 to 5 months, 2 rabbits from the New Zealand White strain were treated with 3 subcutaneous injections of 106 LIM1215 cells followed by 3 subcutaneous injections of 1 μg of recombinant human A33 antigen in a 1-ml emulsion of Ribi adjuvant in PBS (Ribi Immunochem Research, Hamilton, MT). Antisera from the immune animals was analyzed for binding to recombinant human A33 antigen by ELISA using alkaline phosphatase-conjugated goat anti-rabbit Fc polyclonal antibodies (Cappel, West Chester, PA) as secondary antibodies. Five days after the final boost, spleen and bone marrow from 1 leg were harvested and used for total RNA preparation with TRI-REAGENT from Molecular Research Center (Cincinnati, OH). First-strand cDNA was synthesized using the Superscript Preamplification System for First Strand cDNA Synthesis kit with oligo(dT) priming (Life Technologies, Inc.). The first-strand cDNAs from each rabbit were subjected to separate 35-cycle polymerase chain reactions using Perkin-Elmer AmpliTaq DNA polymerase (Roche Molecular Systems, Brunchburg, NY) and 10 primer combinations for the amplification of rabbit VL (9 × Vκ and 1 × Vλ) coding sequences and 4 combinations for the amplification of rabbit VH coding sequences (Table I). The antisense primers consist of a hybrid rabbit/human sequence designed for the fusion of rabbit VL and VH coding sequences to human Cκ and CH1 coding sequences, respectively. Human Cκ and CH1 coding sequences were amplified from a pComb3H-compatible expression vector (3.Rader C. Barbas III, C.F. Curr. Opin. Biotechnol. 1997; 8: 503-508Crossref PubMed Scopus (197) Google Scholar) that contained the sequence of a human Fab directed to tetanus toxoid (12.Barbas III, C.F. Kang A.S. Lerner R.A. Benkovic S.J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7978-7982Crossref PubMed Scopus (1036) Google Scholar) using the primer combination HKC-F (5-ACTGTGGCTGCACCATCTGTC-3′)/lead-B (5′GCCATGGCTGGTTGGGCAGC-3′) and HIgGCH1-F (5′-GCCTCCACCAAGGGCCCATCGGTC-3′)/dpseq (5′-AGAAGCGTAGTCCGGAACGTC-3′), respectively. The antisense primer lead-B hybridizes to a sequence upstream of the Fd fragment coding sequence and is used to amplify the Cκ coding sequence together with the sequence intervening LC and Fd fragment coding sequences in phagemid vector pComb3H (3.Rader C. Barbas III, C.F. Curr. Opin. Biotechnol. 1997; 8: 503-508Crossref PubMed Scopus (197) Google Scholar). Based on this strategy, the chimeric rabbit/human LC and Fd fragment coding sequences are assembled and fused by 2 sequential overlap extension polymerase chain reaction steps. In the first step, rabbit VL and human Cκ are fused using the primer combination RSC-F (5′-GAGGAGGAGGAGGAGGAGGCGGGGCCCAGGCGGCCGAGCTC-3′)/lead-B and rabbit VH and human CH1 are fused using the primer combination lead-VH (5-GCTGCCCAACCAGCCATGGCC-3′) and dp-EX (5′-GAGGAGGAGGAGGAGGAGAGAAGCGTAGTCCGGAACGTC-3′). In the second step, the assembled chimeric LC and Fd fragment coding sequences are fused using the flanking primers RSC-F and dp-EX. Only LC and Fd fragment coding sequences derived from the same animal were combined. The final construct was cloned into phagemid vector pComb3H using 2 asymmetric SfiI sites (3.Rader C. Barbas III, C.F. Curr. Opin. Biotechnol. 1997; 8: 503-508Crossref PubMed Scopus (197) Google Scholar), yielding a complexity of 2 × 107 independent transformants. The phage library displaying the chimeric rabbit/human Fab was panned against immobilized recombinant human A33 antigen using 200 ng of protein in 25 μl of TBS for coating on 1 well of a Costar number 3690 96-well plate, 0.05% (v/v) Tween 20 in TBS for washing, and 10 mg/ml trypsin (Difco) in TBS for elution. Trypsinization was for 30 min at 37 °C. The washing steps were increased from 5 in the first round to 10 in the second round and 15 in the third and fourth round. A round of panning defines a sequence of binding of the phage to the antigen, removal of unspecific binders, and elution of specific binders followed by their reamplification in Escherichia coli. Indicative of a successful selection, the output numbers strongly increased after the third and fourth round. The output phage pool of each round was monitored by phage ELISA using horseradish peroxidase-conjugated sheep anti-M13 phage polyclonal antibodies (Amersham Pharmacia Biotech, Buckinghamshire, United Kingdom) as secondary antibodies. An increasing signal above background from round to round was noted. Fourty clones from the final output were grown and induced with 1 mmisopropyl-β-d-thiogalactopyransoside. Supernatants were tested for binding to immobilized recombinant human A33 antigen by ELISA using alkaline phosphatase-conjugated goat anti-human F(ab′)2 polyclonal antibodies (Pierce, Rockford, IL) as secondary antibody. All clones gave a strong signal above background and were further analyzed by DNA fingerprinting. For this, phagemids were isolated, Fab coding sequences amplified using the flanking primers ompseq (5′-AAGACAGCTATCGCGATTGCAG-3′) and gback (5′-GCCCCCTTATTAGCGTTTGCCATC-3′), and digested with the 4-base pair cutter BstOI. Three different, although highly similar, fingerprints were obtained. Two of them, rabbit clones 1 and 2, were found in 13 and 26 clones, respectively. The third rabbit clone (3.Rader C. Barbas III, C.F. Curr. Opin. Biotechnol. 1997; 8: 503-508Crossref PubMed Scopus (197) Google Scholar) was represented only once. The sequence of the variable domains of heavy and light chain of clones 1, 2, and 3 was determined by DNA sequencing using the primers newpelseq (5′-CTATTGCCTACGGCAGCCGCTG-3′) and ompseq, respectively. Rabbit antibody sequences have been submitted to GenBank™ under accession numbers AF 245498–245503.Table IPrimers for the amplification of rabbit Vκ, Vλ, and VH coding sequencesVκ 5′ sense primers 1, 5′-GGGCCCAGGCGGCCGAGCTCGTGMTGACCCAGACTCCA-3′ 2, 5′-GGGCCCAGGCGGCCGAGCTCGATMTGACCCAGACTCCA-3′ 3, 5′-GGGCCCAGGCGGCCGAGCTCGTGATGACCCAGACTGAA-3′Vκ 3′ antisense primers 1, 5′-ACAGATGGTGCAGCCACAGTTAGGATCTCCAGCTCGGTCCC-3′ 2, 5′-GACAGATGGTGCAGCCACAGTTTTGATTTCCACATTGGTGCC-3′ 3, 5′-GACAGATGGTGCAGCCACAGTTTTGACSACCACCTCGGTCCC-3′Vλ5′ sense primer 5′-GGGCCCAGGCGGCCGAGCTCGTGCTGACTCAGTCGCCCTC-3′Vλ 3′ antisense primer 5′-CGAGGGGGCAGCCTTGGGCTGGCCTGTGACGGTCAGCTGGGTCCC-3′VH 5′ sense primers 1, 5′-GCTGCCCAACCAGCCATGGCCCAGTCGGTGGAGGAGTCCRGG-3′ 2, 5′-GCTGCCCAACCAGCCATGGCCCAGTCGGTGAAGGAGTCCGAG-3′ 3, 5′-GCTGCCCAACCAGCCATGGCCCAGTCGYTGGAGGAGTCCGGG-3′ 4, 5′-GCTGCCCAACCAGCCATGGCCCAGSAGCAGCTGRTGGAGTCCGG-3′VH3′ antisense primer 5′-CGATGGGCCCTTGGTGGAGGCTGARGAGAYGGTGACCAGGGTGCC-3′Note that the 3′ antisense primers are designed to allow the fusion of rabbit variable domains to human constant domains (M = A or C; R = A or G; S = G or C; Y = C or T). Open table in a new tab Note that the 3′ antisense primers are designed to allow the fusion of rabbit variable domains to human constant domains (M = A or C; R = A or G; S = G or C; Y = C or T). Human germ-line VLand VH sequences with the highest degree of homology with the corresponding rabbit sequences were identified from the VBASE Directory of Human V Gene Sequences by amino acid sequence alignment. The identified human sequences were diversified at positions that are potentially involved in antigen binding and used as frameworks for the grafting of the 6 rabbit CDRs as defined by Kabat et al.(13.Kabat E.A. Wu T.T. Perry H.M. Gottesman K.S. Foeller C. Sequences of Proteins of Immunological Interest. 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD1991Google Scholar). Overlapping oligonucleotides were designed accordingly, synthesized, and assembled to synthetic VL and VH coding sequences in 2 sequential 10-cycle polymerase chain reaction steps using the Expand High Fidelity PCR System (Roche Molecular Systems). Using the same procedure as described for the generation of the rabbit antibody library, the synthetic VLand VH coding sequences were fused to human Cκ and CH1 coding sequences, respectively, and the resulting humanized light chain and Fd fragment coding sequences were assembled. The final construct was SfiI cloned into a variant of pComb3H in which the ampicillin resistance gene had been replaced by a chloramphenicol resistance. This prevents potential contaminations with phage derived from the rabbit antibody libraries. The resulting library with a theoretical complexity of only 256 consisted of 1 × 107 independent transformants and was panned against immobilized recombinant human A33 antigen essentially as described for the screening of the rabbit antibody library but under more stringent conditions. The amount of antigen was decreased from 100 ng in the first and second round to 50 ng in the third and fourth round and 25 ng in the fifth and sixth round. Ten washing steps with 0.5% (v/v) Tween 20 in TBS were performed for each of the 6 rounds. Round 3 and 4 as well as 5 and 6 were linked without phage amplification. For this, phage from round 3 and 5 were eluted by adding 50 μl of 100 mm HCl glycine (pH 2.2), incubated for 10 min at room temperature, collected, neutralized with 3 μl of 2m Tris base and 50 μl of 1% (w/v) bovine serum albumin in TBS, and directly subjected to another round of panning. Phage from rounds 1, 2, 4, and 6 were eluted by trypsinization as described before. Out of 70 clones from the final output that were analyzed by ELISA and all found to be positive, 24 clones were further analyzed by DNA sequencing as described before. The following oligonucleotides were used for humanization, L denotes primers for the VL assembly, H denotes primers for the VH assembly (r = A or G; S = G or C; W = A or T): L1, 5′- GAGCTCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCTGGCCAGTGAGTTCCTTTTTAATGGTGTATCC-3′; L2, 5′- AGATGGGACCCCAGATTCTAAATTGGATGCACCATAGATCAGGARCTTAGGARCTTTCCCTGGTTTCTGCTGATACCAGGATACACCATTAAAAAGGAACTC-3′; L3, 5′- AATTTAGAATCTGGGGTCCCATCTCGGTTCAGTGGCAGTGGATCTGGGACAGATTWCACTCTCACCATCAGCAGCCTGCAGSCTGAAGATGTTGCAACT-3′; L4, 5′- TTTGATCTCCACCTTGGTCCCTCCGCCGAAAGTCAAACCACTACTACCACTATAACCGCCTAGACAGTAATAAGTTGCAACATCTTCAGSCTGCAG-3′; L flank sense, 5′-GAGGAGGAGGAGGAGGGCCCAGGCGGCCGAGCTCCAGATGACCCAGTCTCCA-3′; L antisense flank, 5′- GACAGATGGTGCAGCCACAGTTCGTTTGATCTCCACCTTGGTCCCTCC-3′; H1, 5′- GAGGTGCAGCTGGTGGAGTCTGGGGGAGGCCTGGTCAAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGA-3′; H2A, 5′- CCAGCTAATGCCATAGTGACTGAAGGTGAATCCAGAGGCTGCACAGGAGAGTCT-3′; H2B, 5′- CCAGCTAATGCCATAGTGACTGAAGTCGATTCCAGAGGCTGCACAGGAGAGTCT-3′; H3, 5′- TTCAGTCACTATGGCATTAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCGCCTACATTTATCCTAATTATGGGAGTGTAGACTACGCGAGC-3′; H4A, 5′- GTTCATTTGCAGATACASTGAGTTCTTGGCGTTGTCTCTGGAGATGGTGAATCGGCCATTCACGCTGCTCGCGTAGTCTACACTCCCATA-3′; H4B, 5′- GTTCATTTGCAGATACASTGAGTTCTGGGCGTTGTCGAGGGAGATGGTGAATCGGCCATTCACGCTGCTCGCGTAGTCTACACTCCCATA-3′; H5, 5′- AACTCASTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTWCTGTGCGAGAGATCGGGGTTATTATTCTGGTAGT-3′; H6, 5′- TGAGGAGACGGTGACCAGGGTGCCCTGGCCCCAGAGATCCAACCGAGTCCCCCTACTACCAGAATAATAACCCCGATC-3′; H flank sense, 5′-GCTGCCCAACCAGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGGGGGA-3′; H flank antisense, 5′- GACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTGCC-3′. Soluble Fab from rabbit clones 1 and 2 and humanized clones A to F were produced in E. coli strain Xl1-Blue using gene III fragment-depleted pComb3H as expression vector (3.Rader C. Barbas III, C.F. Curr. Opin. Biotechnol. 1997; 8: 503-508Crossref PubMed Scopus (197) Google Scholar). Fab were purified from concentrated supernatants and from sonicated lysates of overnight 1-liter flask cultures induced with 1 mm isopropyl-β-d-thiogalactopyransoside by affinity chromatography using a 5-ml Protein G HiTrap column (Amersham Pharmacia Biotech) attached to an fast protein liquid chromatography system (Amersham Pharmacia Biotech). PBS was used as equilibration and washing buffer and 0.5 m acetic acid for elution. Eluted fractions were neutralized immediately using 0.5 volumes of 1m Tris-HCl (pH 9.0), pooled, concentrated, and brought into PBS. Quality was analyzed by SDS-PAGE followed by Coomassie Blue staining, quantity by measuring the optical density at 280 nm using an Eppendorf BioPhotometer (Hamburg, Germany). Surface plasmon resonance for the determination of association (k on) and dissociation (k off) rate constants for binding of rabbit and humanized Fab to recombinant human A33 antigen was performed on a Biacore instrument (Biacore AB, Uppsala, Sweden). A CM5 sensor chip (Biacore AB) was activated for immobilization withN-hydroxysuccinimide andN-ethyl-N′-(3-dimethylaminopropyl)carbodiimide according to the methods outlined by the supplier. Recombinant human A33 antigen was coupled at a low density to the surface by injection of 30 to 40 μl of a 1 ng/μl sample in 10 mm sodium acetate (pH 3.5). Approximately 500 resonance units were immobilized. Subsequently, the sensor chip was deactivated with 1 methanolamine hydrochloride (pH 8.5). Binding of Fab to immobilized A33 antigen was studied by injection of Fab at 5 different concentrations ranging from 75 to 200 nm. PBS was used as the running buffer. The sensor chip was regenerated with 20 mm HCl and remained active for at least 50 measurements. Thek on and k off values were calculated using Biacore AB evaluation software. The equilibrium dissociation constant K d was calculated fromk off/k on. Data obtained from different sensor chips revealed a high consistency and were further validated as described (19.Rader C. Cheresh D.A. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8910-8915Crossref PubMed Scopus (90) Google Scholar). Triton X-100 (0.3% (v/v) in PBS, pH 7.5) lysates of human colon cancer cell lines were resolved by SDS-PAGE under reducing (5% (v/v) β-mercaptoethanol) and nonreducing conditions. Proteins were blotted to polyvinylidene difluoride membranes (Immobilon-P, Millipore, Bedford, MA) and incubated with 0.5 μg/ml Fab followed by alkaline phosphatase-conjugated goat anti-human F(ab′)2 polyclonal antibodies (Pierce). Specific binding was visualized by chemiluminescence (Tropix, Bedford, MA). Flow cytometry was performed using a FACSscan instrument from Becton-Dickinson (Franklin Lakes, NJ). For each determination, 1 × 104 cells were analyzed. Indirect immunofluorescence staining was achieved with 2 μg/ml Fab in 1% (w/v) bovine serum albumin, 25 mm Hepes, 0.05% (w/v) sodium azide in PBS. A 1:100 dilution of fluorescein isithiocyanate-conjugated donkey anti-human F(ab′)2polyclonal antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) was used for detection. Incubation with primary antibodies was for 1 h, with secondary antibodies for 30 min at room temperature. All immunochemical stainings were done on snap-frozen tissue samples, embedded in O.C.T. compound (Tissue Tek, Torrance, CA). 5-μm cuts (HM503 cryostat, Zeiss, Walldorf, Germany) were mounted on slides for immunohistochemistry (Superfrost Plus, Fisher Scientific, Pittsburgh, PA). Serial sections were used, so as to compare staining results of the different antibody preparations. After cutting, the slides were fixed in cold acetone for 10 min and then air dried. Reactivity of the humanized Fab was analyzed using the colon cancer cell line SW1222 xenografted into nude mice. A working concentration of Fab (1 μg/ml) was established by titering. The humanized Fab was detected by biotinylated goat-anti human F(ab)2 polyclonal antibodies (1:200; Vector, Burlingame, CA) and an avidin-biotin complex system (ABC/Elite kit, Vector). Diaminobenzidine tetrahydrochloride (Biogenex, San Ramon, CA) was used as a chromogen. Reactivity of the humanized Fab was also evaluated in human colonic adenocarcinoma samples. In order to prevent immunoreactivity of endogenous human immunoglobulin, a special technique for the detection of humanized Fab was utilized. Prior addition to tissue, the humanized Fab (1 μg/ml) was incubated with biotinylated goat-anti human F(ab)2 polyclonal antibodies in a test tube. The optimal ratio of humanized Fab to secondary antibody was determined in separate titration assays. Incubation of humanized Fab and secondary antibody was done at room temperature for 1 h and followed by an addition of human serum in order to block the activity of unbound secondary antibody. Again, the optimal ratio of human serum to secondary antibody was determined in separate titration assays. Our strategy for the generation and humanization of rabbit antibodies directed to human A33 antigen is outlined in Fig.1. Two rabbits were immunized with the human colon cancer cell line LIM1215 which expresses large amounts of the A33 antigen. A LIM1215 cDNA library had been used to clone the cDNA for human A33 antigen (8.Heath J.K. White S.J. Johnstone C.N. Catimel B. Simpson R.J. Moritz R.L. Tu G.F. Ji H. Whitehead R.H. Groenen L.C. Scott A.M. Ritter G. Cohen L. Welt S. Old L.J. Nice E.C. Burgess A.W. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 469-474Crossref PubMed Scopus (157) Google Scholar). The initial immunization and 2 boosts elicited a weak immune response against recombinant human A33 antigen as revealed by the analysis of the rabbit sera by ELISA (data not shown). Both rabbits were further boosted with recombinant human A33 antigen derived from a baculovirus expression system. A strong immune response against recombinant human A33 antigen in sera from both rabbits resulted (data not shown). Our sequential cell and protein immunization strategy aimed at targeting the humoral immune response to native epitopes of the protein that are accessible at the cell surface. A rabbit antibody library displayed on phage was generated as follows. RNA was isolated from bone marrow and spleen of the immune rabbits, retro-transcribed, and VL and VH coding sequences were amplified using a variety of primer combinations designed to amplify most of the known rabbit antibody sequences (TableI). The primer combinations used here extend the primer sets reported previously (14.Ridder R. Schmitz R. Legay F. Gram H. Bio/Technology. 1995; 13: 255-260Crossref PubMed Scopus (135) Google Scholar, 15.Lang I.M. Barbas III, C.F. Schleef R.R. Gene (Amst.). 1996; 172: 295-298Crossref PubMed Scopus (40) Google Scholar, 16.Foti M. Granucci F. Ricciardi-Castagnoli P. Spreafico A. Ackermann M. Suter M. J. Immunol. Methods. 1998; 213: 201-212Crossref PubMed Scopus (20) Google Scholar). Importantly, the rabbit antibody library was based on a chimeric Fab format. Variable domains from rabbit light and heavy chains were fused to the corresponding human constant domains. The use of human constant domains suggested several advantages. First, while antigen binding is confined to the variable domains and, thus, is not expected to be influenced by constant domain swapping, the human constant domains confer established and standardized detection and purification means on Fab derived from multiple species. Second, the use of human constant regions was found to improve the E. coli expression level of Fab (17.Carter P. Kelley R.F. Rodrigues M.L. Snedecor B. Covarrubias M. Velligan M.D. Wong W.L.T. Rowland A.M. Kotts C.E. Carver M.E. Yang M. Bourell J.H. Shepard H.M. Henner D. Bio/Technology. 1992; 10: 163-167Crossref PubMed Scopus (314) Google Scholar, 18.Ulrich H.D. Patten P.A. Yang P.L. Romesberg F.E. Schultz P.G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11907-11911Crossref PubMed Scopus (84) Google Scholar). Lastly, a Fab with human constant domains is already partially humanized and can be readily channeled into recently reported strategies for complete humanization (19.Rader C. Cheresh D.A. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 8910-8915Crossref PubMed Scopus (90) Google Scholar). The phage library displaying chimeric rabbit/human Fab was selected by panning against immobilized recombinant human A33 antigen. Among 40 selected clones that demonstrated strong reactivity in ELISA on immobilized recombinant human A33 antigen, only 3 distinct sequences were identified (Fig. 2). Data bank screening revealed that the sequences corresponding to the variable domains were rabbit sequences. The clones with distinct sequences were designated rabbit clones 1 to 3. Rabbit clones 1 and 2 shared identical Vκ coding sequences and 90% identical VH coding sequences. Rabbit clone 3 consisted of a Vκ coding sequence with 90% identity to rabbit clones 1 and 2 and shared an identical VH coding sequence with rabbit clone 3. The high similarity of the sequences included the hypervariable VDJ and VJ joint regions HCDR3 and LCDR3. Thus, it is likely that all the selected sequences originated from 1 B cell clone in 1 of the 2 rabbits that had undergone somatic diversification. Rabbit clones 1 and 2 were produced as soluble Fab in E. coli and purified by protein G affinity chromatography (Fig.3). Analysis by flow cytometry revealed that both Fab specifically bound to human colon cancer cells expressing native human A33 antigen (Fig. 4). Binding of the Fab to human A33 antigen was found to be very strong with affinities in the 1 nm range as determined by surface plasmon resonance using a Biacore instrument. Rabbit clones 1 and 2 gave K d values of 390 pm and 1.6 nm, respectively (Fig. 5, Table III). While both a higher association and a slower dissociation rate constant contributed to the higher affinity of rabbit clone 1, rabbit clone 2 gave consistently higher expression yields in E. coli. Considering the fact that the majority of selected clones contained the rabbit clone 2 sequence, it can be assumed that the higher expression level of rabbit clone 2 led to its preferential selection despite the higher affinity of rabbit clone 1.Figure 4Flow cytometry histograms demonstrating that the selected rabbit clones 1 and 2, as well as the selected humanized clones A-F, bind specifically to native human A33 antigen expressed on the cell surface. For indirect immunofluorescence staining, cells were incubated with Fab (except for the control) followed by f" @default.
• W2015388675 created "2016-06-24" @default.
• W2015388675 creator A5007974324 @default.
• W2015388675 creator A5009105564 @default.
• W2015388675 creator A5046912050 @default.
• W2015388675 creator A5056656950 @default.
• W2015388675 creator A5065812703 @default.
• W2015388675 creator A5075079547 @default.
• W2015388675 creator A5076188773 @default.
• W2015388675 creator A5078132976 @default.
• W2015388675 creator A5088973609 @default.
• W2015388675 creator A5089344430 @default.
• W2015388675 date "2000-05-01" @default.
• W2015388675 modified "2023-10-16" @default.
• W2015388675 title "The Rabbit Antibody Repertoire as a Novel Source for the Generation of Therapeutic Human Antibodies" @default.
• W2015388675 cites W104341128 @default.
• W2015388675 cites W1489077030 @default.
• W2015388675 cites W1713285949 @default.
• W2015388675 cites W1965230703 @default.
• W2015388675 cites W1980193228 @default.
• W2015388675 cites W1988964865 @default.
• W2015388675 cites W2005997381 @default.
• W2015388675 cites W2006174330 @default.
• W2015388675 cites W2008973887 @default.
• W2015388675 cites W2009573319 @default.
• W2015388675 cites W2026036045 @default.
• W2015388675 cites W2035772332 @default.
• W2015388675 cites W2053887681 @default.
• W2015388675 cites W2056110137 @default.
• W2015388675 cites W2059568862 @default.
• W2015388675 cites W2070205845 @default.
• W2015388675 cites W2071080266 @default.
• W2015388675 cites W2071378581 @default.
• W2015388675 cites W2075958426 @default.
• W2015388675 cites W2077291494 @default.
• W2015388675 cites W2084639234 @default.
• W2015388675 cites W2114322511 @default.
• W2015388675 cites W2120009834 @default.
• W2015388675 cites W2130379555 @default.
• W2015388675 cites W2142230632 @default.
• W2015388675 cites W2157767795 @default.
• W2015388675 cites W2160974436 @default.
• W2015388675 cites W2171569403 @default.
• W2015388675 cites W2254396289 @default.
• W2015388675 cites W2266000670 @default.
• W2015388675 cites W4239084925 @default.
• W2015388675 cites W4313376893 @default.
• W2015388675 doi "https://doi.org/10.1074/jbc.275.18.13668" @default.
• W2015388675 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10788485" @default.
• W2015388675 hasPublicationYear "2000" @default.
• W2015388675 type Work @default.
• W2015388675 sameAs 2015388675 @default.
• W2015388675 citedByCount "111" @default.
• W2015388675 countsByYear W20153886752012 @default.
• W2015388675 countsByYear W20153886752013 @default.
• W2015388675 countsByYear W20153886752014 @default.
• W2015388675 countsByYear W20153886752015 @default.
• W2015388675 countsByYear W20153886752016 @default.
• W2015388675 countsByYear W20153886752017 @default.
• W2015388675 countsByYear W20153886752018 @default.
• W2015388675 countsByYear W20153886752019 @default.
• W2015388675 countsByYear W20153886752020 @default.
• W2015388675 countsByYear W20153886752021 @default.
• W2015388675 countsByYear W20153886752022 @default.
• W2015388675 countsByYear W20153886752023 @default.
• W2015388675 crossrefType "journal-article" @default.
• W2015388675 hasAuthorship W2015388675A5007974324 @default.
• W2015388675 hasAuthorship W2015388675A5009105564 @default.
• W2015388675 hasAuthorship W2015388675A5046912050 @default.
• W2015388675 hasAuthorship W2015388675A5056656950 @default.
• W2015388675 hasAuthorship W2015388675A5065812703 @default.
• W2015388675 hasAuthorship W2015388675A5075079547 @default.
• W2015388675 hasAuthorship W2015388675A5076188773 @default.
• W2015388675 hasAuthorship W2015388675A5078132976 @default.
• W2015388675 hasAuthorship W2015388675A5088973609 @default.
• W2015388675 hasAuthorship W2015388675A5089344430 @default.
• W2015388675 hasBestOaLocation W20153886751 @default.
• W2015388675 hasConcept C121332964 @default.
• W2015388675 hasConcept C159654299 @default.
• W2015388675 hasConcept C185592680 @default.
• W2015388675 hasConcept C203014093 @default.
• W2015388675 hasConcept C24890656 @default.
• W2015388675 hasConcept C2778473898 @default.
• W2015388675 hasConcept C2779884254 @default.
• W2015388675 hasConcept C2910693471 @default.
• W2015388675 hasConcept C38652104 @default.
• W2015388675 hasConcept C41008148 @default.
• W2015388675 hasConcept C86803240 @default.
• W2015388675 hasConceptScore W2015388675C121332964 @default.
• W2015388675 hasConceptScore W2015388675C159654299 @default.
• W2015388675 hasConceptScore W2015388675C185592680 @default.
• W2015388675 hasConceptScore W2015388675C203014093 @default.
• W2015388675 hasConceptScore W2015388675C24890656 @default.
• W2015388675 hasConceptScore W2015388675C2778473898 @default.
• W2015388675 hasConceptScore W2015388675C2779884254 @default.
• W2015388675 hasConceptScore W2015388675C2910693471 @default.
• W2015388675 hasConceptScore W2015388675C38652104 @default.
• W2015388675 hasConceptScore W2015388675C41008148 @default.

• next