FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2015738114> ?p ?o ?g. }

• W2015738114 endingPage "19935" @default.
• W2015738114 startingPage "19930" @default.
• W2015738114 abstract "The precursor of the chloroplast flavoprotein ferredoxin-NADP+ reductase from pea was expressed in Escherichia coli as a carboxyl-terminal fusion to glutathione S-transferase. The fused protein was soluble, and the precursor could be purified in a few steps involving affinity chromatography on glutathione-agarose, cleavage of the transferase portion by protease Xa, and ion exchange chromatography on DEAE-cellulose. The purified prereductase contained bound FAD but displayed marginally low levels of activity. Removal of the transit peptide by limited proteolysis rendered a functional protease-resistant core exhibiting enzymatic activity. The FAD-containing precursor expressed in E. coli was readily transported into isolated pea chloroplasts and was processed to the mature size, both inside the plastid and by incubation with stromal extracts in a plastid-free reaction. Import was dependent on the presence of ATP and was stimulated severalfold by the addition of plant leaf extracts. The precursor of the chloroplast flavoprotein ferredoxin-NADP+ reductase from pea was expressed in Escherichia coli as a carboxyl-terminal fusion to glutathione S-transferase. The fused protein was soluble, and the precursor could be purified in a few steps involving affinity chromatography on glutathione-agarose, cleavage of the transferase portion by protease Xa, and ion exchange chromatography on DEAE-cellulose. The purified prereductase contained bound FAD but displayed marginally low levels of activity. Removal of the transit peptide by limited proteolysis rendered a functional protease-resistant core exhibiting enzymatic activity. The FAD-containing precursor expressed in E. coli was readily transported into isolated pea chloroplasts and was processed to the mature size, both inside the plastid and by incubation with stromal extracts in a plastid-free reaction. Import was dependent on the presence of ATP and was stimulated severalfold by the addition of plant leaf extracts. Chloroplast ferredoxin-NADP+ oxidoreductases (FNRs, 1The abbreviations used are: FNRferredoxin-NADP+ oxidoreductase (EC 1.18.1.2)GSTglutathione S-transferase (EC 2.5.1.18)LHCPlight-harvesting chlorophyll a/b binding proteinpre-FNRFNR precursorPAGEpolyacrylamide gel electrophoresis. EC 1.18.1.2) are hydrophilic proteins of about 35 kDa that contain 1 mol of noncovalently bound FAD/monomer(1Carrillo N. Vallejos R.H. Barber J. The Light Reactions: Topics in Photosynthesis. Vol. 8. Elsevier, Amsterdam1987: 527-560Google Scholar, 2Karplus P.A. Daniels M.J. Herriott J.R. Science. 1991; 251: 60-66Crossref PubMed Scopus (464) Google Scholar). They catalyze the reversible electron transfer between pyridine nucleotides and electron carrier proteins such as ferredoxin or flavodoxin. In chloroplasts and cyanobacteria the reaction is driven toward NADP+ reduction, providing the NADPH necessary for CO2 fixation and other biosynthetic pathways(1Carrillo N. Vallejos R.H. Barber J. The Light Reactions: Topics in Photosynthesis. Vol. 8. Elsevier, Amsterdam1987: 527-560Google Scholar, 2Karplus P.A. Daniels M.J. Herriott J.R. Science. 1991; 251: 60-66Crossref PubMed Scopus (464) Google Scholar). In addition to this physiological reaction, FNR is able to catalyze in vitro the oxidation of NADPH by suitable electron acceptors like potassium ferricyanide (diaphorase activity) or the ferredoxin-cytochrome c system (cytochrome c reductase). These two activities have been extensively used to study the FNR catalytic mechanism ((1Carrillo N. Vallejos R.H. Barber J. The Light Reactions: Topics in Photosynthesis. Vol. 8. Elsevier, Amsterdam1987: 527-560Google Scholar) and references therein). ferredoxin-NADP+ oxidoreductase (EC 1.18.1.2) glutathione S-transferase (EC 2.5.1.18) light-harvesting chlorophyll a/b binding protein FNR precursor polyacrylamide gel electrophoresis. Like most plastid proteins, FNR is nucleus-encoded (3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar) and synthesized in cytosolic ribosomes as a higher molecular mass precursor (pre-FNR), containing a transit peptide of 5 kDa at its amino terminus(3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar, 4Grossman A.R. Bartlett S.G. Schmidt G.W. Mullet J.E. Chua N.-H. J. Biol. Chem. 1982; 257: 1558-1563Abstract Full Text PDF PubMed Google Scholar). This peptide extension allows the precursor protein to be targeted to and translocated across the plastid envelope. During or shortly after import, the transit peptide is cleaved off by a stromal protease, and the mature flavoprotein binds tightly to the outer surface of the thylakoid membrane(3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar, 4Grossman A.R. Bartlett S.G. Schmidt G.W. Mullet J.E. Chua N.-H. J. Biol. Chem. 1982; 257: 1558-1563Abstract Full Text PDF PubMed Google Scholar, 5Vallejos R.H. Ceccarelli E.A. Chan R. J. Biol. Chem. 1984; 259: 8048-8051Abstract Full Text PDF PubMed Google Scholar). Although the mechanism of chloroplast protein import is being investigated extensively (for recent reviews see (6Keegstra K. Olsen L.J. Theg S.M. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1989; 40: 471-501Crossref Google Scholar, 7de Boer A.D. Weisbeek P.J. Biochim. Biophys. Acta. 1991; 1071: 221-253Crossref PubMed Scopus (157) Google Scholar, 8Soll J. Alefsen H. Physiol. Plant. 1993; 87: 433-440Crossref Scopus (27) Google Scholar)), it is not yet completely understood. From the available evidence it has been proposed that precursor proteins must be kept in a loosely folded state in order to be imported into plastids or mitochondria(9Eilers M. Schatz G. Nature. 1986; 322: 228-232Crossref PubMed Scopus (467) Google Scholar, 10Pfanner N. Neupert W. Annu. Rev. Biochem. 1990; 59: 331-353Crossref PubMed Scopus (212) Google Scholar). This hypothesis is supported by a number of experimental observations (9Eilers M. Schatz G. Nature. 1986; 322: 228-232Crossref PubMed Scopus (467) Google Scholar, 10Pfanner N. Neupert W. Annu. Rev. Biochem. 1990; 59: 331-353Crossref PubMed Scopus (212) Google Scholar, 11Pilon M. de Boer A.D. Knols S.L. Koppelman M.H.G.M. van der Graaf R.M. de Kruijff B. Weisbeek P.J. J. Biol. Chem. 1990; 265: 3358-3361Abstract Full Text PDF PubMed Google Scholar, 12Pilon M. Rietveld A.G. Weisbeek P.J. de Kruijff B. J. Biol. Chem. 1992; 267: 19907-19913Abstract Full Text PDF PubMed Google Scholar, 13Waegemann K. Paulsen H. Soll J. FEBS Lett. 1990; 261: 89-92Crossref Scopus (95) Google Scholar, 14Li H. Theg S.M. Bauerle C.M. Keegstra K. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6748-6752Crossref PubMed Scopus (48) Google Scholar), although the actual conformation of transport-competent precursors is far from understood. The degree of defined structure has been determined in some recombinant precursors solubilized from bacterial inclusion bodies by the use of chaotropic agents. The physiological meaning of the resulting conformations is, however, uncertain, and in any event, structural measurements on these solubilized precursors yielded rather conflicting results. For instance, a low content of defined secondary structure could be demonstrated for the small ferredoxin precursor(11Pilon M. de Boer A.D. Knols S.L. Koppelman M.H.G.M. van der Graaf R.M. de Kruijff B. Weisbeek P.J. J. Biol. Chem. 1990; 265: 3358-3361Abstract Full Text PDF PubMed Google Scholar, 12Pilon M. Rietveld A.G. Weisbeek P.J. de Kruijff B. J. Biol. Chem. 1992; 267: 19907-19913Abstract Full Text PDF PubMed Google Scholar), whereas a recombinant, import-competent pre-LHCP showed a folded conformation composed of both α-helix and β-sheet(15Oblong J.E. Lamppa G.K. J. Biol. Chem. 1992; 267: 14328-14334Abstract Full Text PDF PubMed Google Scholar). Other studies also suggest that some authentic precursors may adopt a folded conformation and still be competent for organelle import. Those of the chloroplast 5-enoylpyruvylshikimate-3-phosphate synthase (16della-Cioppa G. Bauer S.C. Klein B.K. Shah D.M. Fraley R.T. Kishore G.M. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 6873-6877Crossref PubMed Scopus (136) Google Scholar) and of several mitochondrial proteins (17Felipo V. Miralles V. Knecht E. Hernandez-Yago J. Grisolia S. Eur. J. Biochem. 1983; 133: 641-644Crossref PubMed Scopus (10) Google Scholar, 18Choi S.Y. Churchich J.E. Eur. J. Biochem. 1986; 161: 289-294Crossref PubMed Scopus (4) Google Scholar, 19Altieri F. Mattingly Jr., J.R. Rodriguez-Berrocal F.J. Youssef J. Iriarte A. Wu T. Martinez-Carrion M. J. Biol. Chem. 1989; 264: 4782-4786Abstract Full Text PDF PubMed Google Scholar, 20Jeng J. Weiner H. Arch. Biochem. Biophys. 1991; 289: 214-222Crossref PubMed Scopus (43) Google Scholar) display enzymatic activity, suggesting an active site conformation similar to that of the mature enzyme. Some precursor proteins are able to assemble into active oligomeric structures(19Altieri F. Mattingly Jr., J.R. Rodriguez-Berrocal F.J. Youssef J. Iriarte A. Wu T. Martinez-Carrion M. J. Biol. Chem. 1989; 264: 4782-4786Abstract Full Text PDF PubMed Google Scholar, 20Jeng J. Weiner H. Arch. Biochem. Biophys. 1991; 289: 214-222Crossref PubMed Scopus (43) Google Scholar), or to bind prosthetic groups or ligands prior to translocation(19Altieri F. Mattingly Jr., J.R. Rodriguez-Berrocal F.J. Youssef J. Iriarte A. Wu T. Martinez-Carrion M. J. Biol. Chem. 1989; 264: 4782-4786Abstract Full Text PDF PubMed Google Scholar, 21Fernandez M.D. Lamppa G.K. J. Biol. Chem. 1991; 266: 7220-7226Abstract Full Text PDF PubMed Google Scholar, 22Taroni F. Rosenberg L.E. J. Biol. Chem. 1991; 266: 13267-13271Abstract Full Text PDF PubMed Google Scholar, 23America T. Hageman J. Guéra A. Rook F. Archer K. Keegstra K. Weisbeek P. Plant Mol. Biol. 1994; 24: 283-294Crossref PubMed Scopus (43) Google Scholar). In the case of plastid-targeted flavoproteins, the mechanisms of import and cofactor attachment are still poorly understood, and our goal is to study these processes using chloroplast FNR as a model. A FAD-containing FNR precursor has been synthesized in wheat germ extracts supplemented with FAD, but neither the import competence nor the structure of the precursor holoprotein was determined(24Carrillo N. Eur. J. Biochem. 1985; 150: 469-474Crossref PubMed Scopus (14) Google Scholar). On the other hand, expression of a pea pre-FNR gene in Escherichia coli resulted in the accumulation of a nearly mature form of the reductase displaying catalytic and spectral properties that were very similar to those of the plant enzyme(25Ceccarelli E.A. Viale A.M. Krapp A.R. Carrillo N. J. Biol. Chem. 1991; 266: 14283-14287Abstract Full Text PDF PubMed Google Scholar). The transit peptide was removed by bacterial proteases in an apparently nonspecific reaction. The use of protease-deficient strains of E. coli largely prevented this processing, but the unprocessed precursor was insoluble (25Ceccarelli E.A. Viale A.M. Krapp A.R. Carrillo N. J. Biol. Chem. 1991; 266: 14283-14287Abstract Full Text PDF PubMed Google Scholar). In this study we describe the preparation and properties of a recombinant pre-FNR that contained bound FAD but was largely devoid of activity. Limited proteolysis of the purified precursor resulted in activation of the reductase in the absence of exogenously added FAD. The purified precursor protein was imported into isolated chloroplasts and processed to mature size. FNR cDNA clones were kindly provided by Dr. J. C. Gray, Cambridge University, United Kingdom. Construction of the expression vector pGF202 is shown in Fig. 1. A PstI-EcoRI cDNA fragment (1.3 kilobase pairs), containing pea pre-FNR coding sequences and part of the 3′-noncoding region(3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar), was inserted into the BamHI and EcoRI sites of pGEX-3X (26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar) to generate recombinant plasmid pGF202. Two complementary synthetic oligonucleotides (Biodynamics SRL, Buenos Aires) were annealed to provide the BamHI-PstI adaptor. 5′GATC A T C G AAGGCCGTATGGCTGCTGCA3′3′T A GC TTCCGGCATACCGACG5′ LINKER Note that the 5′-end region of the adaptor does not regenerate a BamHI site upon ligation to its cohesive site in pGEX-3X. The 3′-end nucleotides of this linker encode the first four residues of pre-FNR (Met and three Ala residues), that were missing in the 1.3-kilobase pair cDNA fragment(3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar). The four codon supstream of the initial ATG encode the recognition sequence for restriction protease Xa(26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar), with the cleavage site placed immediately before methionine 1 of pea pre-FNR. After amplification in transformed E. coli cells (strain AD202; (27Nakano H. Yamazaki T. Ikeda M. Masai H. Miyatake S. Saito T. Nucleic Acids Res. 1994; 22: 543-544Crossref PubMed Scopus (46) Google Scholar)) and isolation of double-stranded plasmid DNA, recombinant clones were selected by the presence of the insert and the disappearance of the BamHI restriction site in the plasmids. The sequence at the adaptor-joining locus was determined by double-stranded DNA sequencing. Recombinant DNA techniques were carried out following established procedures(28Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1987Google Scholar). Expression of pre-FNR in E. coli cells harboring plasmid pGF202, preparation of cell lysates, and purification of the GST-pre-FNR fusion were carried out using published methods(25Ceccarelli E.A. Viale A.M. Krapp A.R. Carrillo N. J. Biol. Chem. 1991; 266: 14283-14287Abstract Full Text PDF PubMed Google Scholar, 26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar, 29Serra E.C. Carrillo N. Krapp A.R. Ceccarelli E.A. Protein Expression Purif. 1993; 4: 539-544Crossref PubMed Scopus (18) Google Scholar), with minor modifications. Briefly, bacterial crude extracts obtained from 400-800 ml of culture medium were applied to a 1.5 × 15-cm glutathione-agarose column (sulfur linkage; Sigma). With the aid of a peristaltic pump, the lysate was circulated through the agarose bead for 10 h at 6°C in order to ensure maximum binding. The column was then washed with 5 volumes of 20 mM phosphate buffer, pH 7.3, 150 mM NaCl, and two volumes of 50 mM Tris-HCl, pH 8.0. The fusion product was finally eluted by 10 mM reduced glutathione in 50 mM Tris-HCl, pH 8.0, and exhaustively dialyzed against TS medium (50 mM Tris-HCl, pH 7.5, 75 mM NaCl). Following cleavage with restriction factor Xa (Boehringer Mannheim), the digest was passed through glutathione-agarose, applied to a DEAE-cellulose column equilibrated in TS medium, and washed with the same buffer. The first protein fraction eluting under these conditions contained electrophoretically pure FNR precursor. To obtain 35S-labeled pre-FNR, E. coli cells harboring plasmid pGF202 were cultured (8 h at 37°C, A550 = 0.6-0.8) in 0.25 × LB broth (28Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1987Google Scholar) containing 0.1 mg/ml carbenicillin, and then supplemented with 0.5 mM isopropyl-1-thio-β-D-galactopyranoside and 10 μCi/ml [35S]methionine (1230 Ci/mmol) (DuPont). Following a 120-min incubation period under the same conditions, cells were harvested and disrupted, and the labeled pre-FNR was purified as described above. The specific activity of the purified precursor was estimated using a protein assay (30Sedmak J. Grossberg S. Anal. Biochem. 1977; 79: 544-552Crossref PubMed Scopus (2507) Google Scholar) and scintillation counting. Crude lysates, bacterial pellets, and purified samples were analyzed by SDS-PAGE in 12% gels according to Laemmli(31Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Protease digestions were carried out at 25°C in 50 mM HEPES-KOH, pH 7.5, 5 mM CaCl2, and 0.1 mg/ml pre-FNR. The reactions were started by the addition of protease to a final concentration of 10 μg/ml. At the indicated times, 50-μl aliquots were withdrawn into ice-cold tubes containing 5 μl of the corresponding protease inhibitor: 10 mM EDTA (thermolysin), soybean trypsin inhibitor (trypsin), or 100 μM phenylmethylsulfonyl fluoride (chymotrypsin). A 10-μl aliquot was taken using a Hamilton syringe and immediately assayed for FNR activity. The rest of the sample was mixed with 0.25 volumes of 10 mM EDTA, 2.5% (v/v) β-mercaptoethanol, 10% (w/v) SDS, boiled for 3 min, and subjected to SDS-PAGE. Intact chloroplasts were isolated from 10-14-day-old pea seedlings (Pisum sativum L., cv. Cuarentona Enana) using percoll gradient centrifugation (32Schreier P.H. Reiss B. Kuntz M. Gelvin S.B. Schilperoort R.A. Verma D.P.S. Plant Molecular Biology Manual. Kluwer, Dordrecht1988: 1-22Google Scholar) and suspended in import buffer (50 mM HEPES-KOH, pH 8.0, 330 mM sorbitol) at about 2 mg chlorophyll/ml. Plastid numbers per microliter of suspension were estimated by counting on a modified Neubauer camera. A standard import reaction contained the radiolabeled precursor (∼5 × 105 dpm at a pre-FNR concentration of about 0.4 μM), 5 × 107 chloroplasts, and (unless otherwise stated) 2.2 mM MgATP in import buffer. Pea leaf extracts, prepared according to Waegemann et al.(13Waegemann K. Paulsen H. Soll J. FEBS Lett. 1990; 261: 89-92Crossref Scopus (95) Google Scholar), were added at a final protein concentration of 0.3 mg/ml. The samples were incubated at 25°C for 30 min. At the end of the import reaction, thermolysin was added to the suspension to 100 μg/ml and incubated on ice for 30 min. The protease treatment was stopped by the addition of EDTA to 10 mM, and chloroplasts were reisolated by centrifugation through silicone oil layers (AR 200) according to Robinson and Walker(33Robinson S.P. Walker D.A. Arch. Biochem. Biophys. 1979; 196: 319-323Crossref PubMed Scopus (42) Google Scholar). Aliquots from labeled precursor and import reactions were analyzed by SDS-PAGE(31Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). After electrophoresis, the gels were treated for fluorography using 20% (w/v) diphenyloxazole in dimethyl sulfoxide (34Bar-Nun S. Ohad I. Methods Enzymol. 1980; 69: 363-374Crossref Scopus (4) Google Scholar) and exposed to Kodak XAR x-ray films. The radioactive bands were excised using the developed fluorograms as a guide and quantitated by liquid scintillation counting. Import efficiency (the fraction of added protein imported by the chloroplasts in a 30-min assay) was calculated assuming that all methionine residues in pre-FNR were equally labeled. Thus the precursor contains 12 labeled residues, and the mature protein contains 11(3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar). Preparation of stromal processing extracts and in vitro processing of purified pre-FNR were carried out essentially as described by Archer and Keegstra(35Archer K. Keegstra K. Plant Mol. Biol. 1993; 23: 1105-1115Crossref PubMed Scopus (25) Google Scholar). Amino terminal sequence analysis was performed using an Applied Biosystems 477/A protein sequencer. Total protein was determined by a dye-binding assay(30Sedmak J. Grossberg S. Anal. Biochem. 1977; 79: 544-552Crossref PubMed Scopus (2507) Google Scholar), using bovine serum albumin or purified FNR as standards. Glutathione S-transferase, FNR diaphorase, and cytochrome c reductase activities were measured spectrophotometrically as described previously(29Serra E.C. Carrillo N. Krapp A.R. Ceccarelli E.A. Protein Expression Purif. 1993; 4: 539-544Crossref PubMed Scopus (18) Google Scholar). FAD content of recombinant FNR was determined using high performance liquid chromatography and fluorescence detection(24Carrillo N. Eur. J. Biochem. 1985; 150: 469-474Crossref PubMed Scopus (14) Google Scholar). Absorption and fluorescence spectra were recorded in a Hitachi 150-20 spectrophotometer and in a Jasco FP-770 spectrofluorometer, respectively. Expression vector pGF202 (Fig. 1) contains the entire coding sequence of pre-FNR fused in-frame to the 3′-end of the Schistozoma japonicum glutathione S-transferase gene cloned in plasmid pGEX-3X (26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar). A target sequence for protease Xa was introduced with the oligonucleotide adaptor (Fig. 1). The new cleavage site is placed immediately prior to methionine 1 of pea pre-FNR. The construct is under the control of the tac promoter(26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar), providing high level synthesis of the GST-pre-FNR fusion upon induction by isopropyl-1-thio-β-D-galactopyranoside. The presence of pea FNR polypeptides in E. coli cells was studied by SDS-PAGE and immunoblotting(28Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1987Google Scholar). An immunoreactive peptide with an apparent molecular mass of 65 kDa was detected in the soluble fraction of disrupted bacteria (not shown). This size agrees fairly well with that expected for the fusion protein between GST (27 kDa; (26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar)) and pre-FNR (40 kDa; (3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar)). As already reported for the GST-FNR fusion expressed in E. coli(29Serra E.C. Carrillo N. Krapp A.R. Ceccarelli E.A. Protein Expression Purif. 1993; 4: 539-544Crossref PubMed Scopus (18) Google Scholar), several reactive bands of smaller size were also evident (data not shown, but see below). The appearance of both the full-length and shorter reactive peptides was strictly dependent on isopropyl-1-thio-β-D-galactopyranoside induction. The amount of recombinant protein produced in AD202 cells, estimated in a large number of assays by slot blot and immunoreaction(25Ceccarelli E.A. Viale A.M. Krapp A.R. Carrillo N. J. Biol. Chem. 1991; 266: 14283-14287Abstract Full Text PDF PubMed Google Scholar), ranged between 1 and 3% of the total cell protein (not shown). Following disruption of induced cells and fractionation of their contents, about 70% of the reactive material was recovered in the soluble fraction. The remainder was found aggregated into bacterial pellets and was largely represented by truncated species (not shown). A protocol described for the purification of GST fusions (26Smith D.B. Johnson K.S. Gene (Amst.). 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar, 29Serra E.C. Carrillo N. Krapp A.R. Ceccarelli E.A. Protein Expression Purif. 1993; 4: 539-544Crossref PubMed Scopus (18) Google Scholar) was used to isolate GST-pre-FNR from transformed bacteria. The fusion protein was first bound to a glutathione-agarose matrix and then eluted with glutathione, together with the truncated immunoreactive products present in the crude lysates (Fig. 2A, lane1). The fraction eluted from the column displayed GST activity but little or no FNR-diaphorase (not shown). Incubation of this extract with factor Xa resulted in the disappearance of the fusion product, with accumulation of a 40-kDa protein (Fig. 2A, lanes 2-4). However, a peptide with electrophoretic mobility similar to that of mature FNR also accumulated as incubation progressed, indicating that some processing of the transit peptide might have occurred (Fig. 2A, lanes 2-4). Digestion of the prepiece was strictly dependent on the addition of Factor Xa, suggesting that degradation was caused by the coagulation factor itself or by traces of a contaminating protease. Absorption of a 15-min digest on glutathione-agarose removed most GST and undigested fusion protein, leaving a mixture of precursor and mature FNR (Fig. 2B, lane1). The two proteins could be separated by ion exchange chromatography on DEAE-cellulose, rendering an electrophoretically homogeneous precursor polypeptide (Fig. 2B, lanes4-6). The final yield is at present about 0.2 mg/precursor/liter of culture medium. Amino acid sequencing of the purified pre-FNR indicated that methionine 1 was the only significant residue at the amino terminus (not shown). The pre-FNR protein isolated from E. coli transformants displayed 1-5% of the specific diaphorase activity of mature reductase, which prompted us to investigate the spectral properties of the precursor. Purified pre-FNR indeed showed a flavoprotein absorption spectrum in the visible region. Fluorescence emission and excitation spectra also indicated the presence of FAD (not shown). Analysis of flavin content indicates that the purified cleaved precursor contains 0.87 ± 0.10 FAD/molecule of apoprotein, compared with 0.91 ± 0.08 in the plant holoenzyme assayed under the same conditions. The 275:456 spectral ratio of pre-FNR was 13.1, compared with 8.1 in mature FNR, and the extinction coefficients at 380 and 456 nm were ∼5-10% lower in the recombinant precursor (not shown). Taken together, the previous results suggest that although pre-FNR is able to bind FAD, the conformation of the flavin moiety may be different from that of the mature holoprotein, resulting in a nonfunctional preholoreductase. The strength of the interaction between FAD and pre-FNR was not determined, but the precursor could be precipitated in 30% saturation ammonium sulfate and redissolved without apparent loss of bound flavin. The FNR precursor was stable at −20°C for several months, but repetitive freezing and thawing resulted in the disappearance of the 40-kDa band, with formation of a mature sized immunoreactive product (not shown). We thus stored the purified pre-FNR in aliquots at −70°C. To evaluate if the precursor holoprotein can be cleaved by the chloroplast processing protease, we exposed pre-FNR to a stromal lysate containing processing activity(35Archer K. Keegstra K. Plant Mol. Biol. 1993; 23: 1105-1115Crossref PubMed Scopus (25) Google Scholar). Fig. 3 shows that pre-FNR was processed to mature size upon incubation with the extracts. Over a period of 45 min, the amounts of mature FNR increased as the precursor declined, indicating that binding of FAD did not affect the accessibility of the transit peptidase target site. In order to get an indication of the overall chain packing of the precursor polypeptide, we performed protease sensitivity experiments. Spinach FNR is known to possess a protease-resistant core that begins at lysine 35 (lysine 29 in the pea reductase) and extends far beyond into the carboxyl-terminal domain(36Gadda G. Aliverti A. Ronchi S. Zanetti G. J. Biol. Chem. 1990; 265: 11955-11959Abstract Full Text PDF PubMed Google Scholar). Removal of the protease-sensitive regions had no effect on diaphorase activity, while cytochrome c reduction was inactivated due to an impairment of ferredoxin binding(36Gadda G. Aliverti A. Ronchi S. Zanetti G. J. Biol. Chem. 1990; 265: 11955-11959Abstract Full Text PDF PubMed Google Scholar). Protease accessibility assays had not been performed on the pea enzyme, but the sequence conservation between the two species (3Newman B.J. Gray J.C. Plant Mol. Biol. 1988; 10: 511-520Crossref PubMed Scopus (91) Google Scholar, 37Karplus P.A. Walsh K.A. Herriott J.R. Biochemistry. 1984; 23: 6576-6583Crossref PubMed Scopus (88) Google Scholar) predicted a similar behavior. In fact, digestion products obtained after limited proteolysis of mature pea FNR with thermolysin (Fig. 4A), trypsin, or chymotrypsin (not shown) were very similar to those reported for the spinach enzyme(36Gadda G. Aliverti A. Ronchi S. Zanetti G. J. Biol. Chem. 1990; 265: 11955-11959Abstract Full Text PDF PubMed Google Scholar). Activity measurements confirmed inhibition of cytochrome c reduction and little effect on diaphorase (Fig. 4C). When pre-FNR was assayed under the same conditions, the digestion products did not differ significantly between the mature reductase and the precursor (Fig. 4, A and B), suggesting that the preholoprotein is packed to a certain extent. Fig. 4B shows a time course for thermolysin proteolysis of pre-FNR. Under our experimental conditions there is a rapid degradation to a product of ∼33 kDa in the first 1-3 min. Further digestion occurred at a much lower rate. Interestingly enough, the diaphorase activity of purified pre-FNR increased abruptly upon partial thermolysin digestion. The time course of activation showed a good correlation with the appearance of the 33-kDa product and was followed by a slow inactivation, which paralleled that of the mature reductase under the same conditions of incubation time and protease concentration (Fig. 4D). Similar results were obtained by using trypsin or chymotrypsin (not shown). Also, incubation of the FNR precursor with stromal extracts (Fig. 3) resulted in small variable increases in diaphorase activity, but the extent of the activation could not be evaluated due to the high endogenous activity of the chloroplast lysates (∼3 diaphorase units/mg of total protein). The previous data suggest that the rapid phase of proteolysis caused cleavage of the transit peptide and probably of a portion of the amino-terminal mature sequence as it occurs in spinach(36Gadda G. Aliverti A. Ronchi S. Zanetti G. J. Biol. Chem. 1990; 265: 11955-11959Abstract Full Text PDF PubMed Google Scholar). Removal of the transit peptide region appa" @default.
• W2015738114 created "2016-06-24" @default.
• W2015738114 creator A5002305226 @default.
• W2015738114 creator A5009301110 @default.
• W2015738114 creator A5012915348 @default.
• W2015738114 creator A5040634752 @default.
• W2015738114 creator A5063223053 @default.
• W2015738114 creator A5071904322 @default.
• W2015738114 date "1995-08-01" @default.
• W2015738114 modified "2023-09-27" @default.
• W2015738114 title "The Precursor of Pea Ferredoxin-NADP+ Reductase Synthesized in Escherichia coli Contains Bound FAD and Is Transported into Chloroplasts" @default.
• W2015738114 cites W1485362482 @default.
• W2015738114 cites W1491610149 @default.
• W2015738114 cites W1492114650 @default.
• W2015738114 cites W1502765874 @default.
• W2015738114 cites W1503211689 @default.
• W2015738114 cites W1510003654 @default.
• W2015738114 cites W1521406343 @default.
• W2015738114 cites W1526372251 @default.
• W2015738114 cites W1547451736 @default.
• W2015738114 cites W1548190938 @default.
• W2015738114 cites W1551466056 @default.
• W2015738114 cites W1561216036 @default.
• W2015738114 cites W1591001773 @default.
• W2015738114 cites W1596072788 @default.
• W2015738114 cites W1658558754 @default.
• W2015738114 cites W1964466060 @default.
• W2015738114 cites W1974056935 @default.
• W2015738114 cites W2003076028 @default.
• W2015738114 cites W2004146008 @default.
• W2015738114 cites W2006369456 @default.
• W2015738114 cites W2009924722 @default.
• W2015738114 cites W2022510326 @default.
• W2015738114 cites W2025657664 @default.
• W2015738114 cites W2026803445 @default.
• W2015738114 cites W2032362475 @default.
• W2015738114 cites W2051764123 @default.
• W2015738114 cites W2057899539 @default.
• W2015738114 cites W2058188433 @default.
• W2015738114 cites W2067585179 @default.
• W2015738114 cites W2068446924 @default.
• W2015738114 cites W2072100750 @default.
• W2015738114 cites W2074974662 @default.
• W2015738114 cites W2075878536 @default.
• W2015738114 cites W2082062508 @default.
• W2015738114 cites W2084194441 @default.
• W2015738114 cites W2084520521 @default.
• W2015738114 cites W2086737896 @default.
• W2015738114 cites W2098881252 @default.
• W2015738114 cites W2100837269 @default.
• W2015738114 cites W2116918100 @default.
• W2015738114 cites W2166725680 @default.
• W2015738114 cites W336091613 @default.
• W2015738114 doi "https://doi.org/10.1074/jbc.270.34.19930" @default.
• W2015738114 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7650008" @default.
• W2015738114 hasPublicationYear "1995" @default.
• W2015738114 type Work @default.
• W2015738114 sameAs 2015738114 @default.
• W2015738114 citedByCount "15" @default.
• W2015738114 countsByYear W20157381142012 @default.
• W2015738114 countsByYear W20157381142016 @default.
• W2015738114 crossrefType "journal-article" @default.
• W2015738114 hasAuthorship W2015738114A5002305226 @default.
• W2015738114 hasAuthorship W2015738114A5009301110 @default.
• W2015738114 hasAuthorship W2015738114A5012915348 @default.
• W2015738114 hasAuthorship W2015738114A5040634752 @default.
• W2015738114 hasAuthorship W2015738114A5063223053 @default.
• W2015738114 hasAuthorship W2015738114A5071904322 @default.
• W2015738114 hasBestOaLocation W20157381141 @default.
• W2015738114 hasConcept C104317684 @default.
• W2015738114 hasConcept C134621786 @default.
• W2015738114 hasConcept C134651460 @default.
• W2015738114 hasConcept C181199279 @default.
• W2015738114 hasConcept C185592680 @default.
• W2015738114 hasConcept C2776961318 @default.
• W2015738114 hasConcept C547475151 @default.
• W2015738114 hasConcept C55493867 @default.
• W2015738114 hasConcept C69305403 @default.
• W2015738114 hasConceptScore W2015738114C104317684 @default.
• W2015738114 hasConceptScore W2015738114C134621786 @default.
• W2015738114 hasConceptScore W2015738114C134651460 @default.
• W2015738114 hasConceptScore W2015738114C181199279 @default.
• W2015738114 hasConceptScore W2015738114C185592680 @default.
• W2015738114 hasConceptScore W2015738114C2776961318 @default.
• W2015738114 hasConceptScore W2015738114C547475151 @default.
• W2015738114 hasConceptScore W2015738114C55493867 @default.
• W2015738114 hasConceptScore W2015738114C69305403 @default.
• W2015738114 hasIssue "34" @default.
• W2015738114 hasLocation W20157381141 @default.
• W2015738114 hasOpenAccess W2015738114 @default.
• W2015738114 hasPrimaryLocation W20157381141 @default.
• W2015738114 hasRelatedWork W1547451736 @default.
• W2015738114 hasRelatedWork W1968586275 @default.
• W2015738114 hasRelatedWork W2015738114 @default.
• W2015738114 hasRelatedWork W2023454305 @default.
• W2015738114 hasRelatedWork W2044984062 @default.
• W2015738114 hasRelatedWork W2071090284 @default.
• W2015738114 hasRelatedWork W2141763712 @default.

• next