FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016074103> ?p ?o ?g. }

• W2016074103 endingPage "14021" @default.
• W2016074103 startingPage "14015" @default.
• W2016074103 abstract "The amyloid precursor protein (APP) can be cleaved by a β-secretase to generate a β-amyloid peptide, which has been implicated in the pathogenesis of Alzheimer's disease. However, APP can also be cleaved by an α-secretase to form a non-amyloidogenic secreted form of APP (APP-S). APP-S secretion can be physiologically regulated. This study examined the glutamatergic regulation of APP in the human neuronal Ntera 2 (NT2N) cell line.Metabotropic glutamate receptor subtypes 1α/β and 5α were identified in the NT2N neurons by reverse transcription-polymerase chain reaction. Stimulation of these phosphatidylinositol-linked receptors with glutamate or specific receptor agonists resulted in a dose- and time-dependent increase in the secretion of the amyloid precursor protein (APP-S), measured by the immunoprecipitation of APP-S from the medium of [35S]methionine-labeled NT2N neurons. The glutamate-induced APP-S secretion was maximal at 30 min and at a concentration of 1 mm glutamate. Glutamate-induced APP-S secretion required activation of phospholipase C, which resulted in inositol 1,4,5-trisphosphate production, as shown by the rapid glutamate-induced accumulation of inositol 1,4,5-trisphosphate. Glutamate also caused an increase in intracellular Ca2+. The protein kinase C activator phorbol 12-myristate 13-acetate, a phorbol ester, as well as 1-oleoyl-2-acetoyl-3-glycerol, a cell-permeable diacylglycerol analog, also stimulated APP-S secretion. These findings suggest that APP-S secretion from NT2N neurons can be regulated by the activation of phosphatidylinositol-linked metabotropic glutamate receptor signaling pathway. The amyloid precursor protein (APP) can be cleaved by a β-secretase to generate a β-amyloid peptide, which has been implicated in the pathogenesis of Alzheimer's disease. However, APP can also be cleaved by an α-secretase to form a non-amyloidogenic secreted form of APP (APP-S). APP-S secretion can be physiologically regulated. This study examined the glutamatergic regulation of APP in the human neuronal Ntera 2 (NT2N) cell line. Metabotropic glutamate receptor subtypes 1α/β and 5α were identified in the NT2N neurons by reverse transcription-polymerase chain reaction. Stimulation of these phosphatidylinositol-linked receptors with glutamate or specific receptor agonists resulted in a dose- and time-dependent increase in the secretion of the amyloid precursor protein (APP-S), measured by the immunoprecipitation of APP-S from the medium of [35S]methionine-labeled NT2N neurons. The glutamate-induced APP-S secretion was maximal at 30 min and at a concentration of 1 mm glutamate. Glutamate-induced APP-S secretion required activation of phospholipase C, which resulted in inositol 1,4,5-trisphosphate production, as shown by the rapid glutamate-induced accumulation of inositol 1,4,5-trisphosphate. Glutamate also caused an increase in intracellular Ca2+. The protein kinase C activator phorbol 12-myristate 13-acetate, a phorbol ester, as well as 1-oleoyl-2-acetoyl-3-glycerol, a cell-permeable diacylglycerol analog, also stimulated APP-S secretion. These findings suggest that APP-S secretion from NT2N neurons can be regulated by the activation of phosphatidylinositol-linked metabotropic glutamate receptor signaling pathway. Alzheimer's disease is characterized by the deposition of β-amyloid (Aβ) 1The abbreviations used are: Aβ, β-amyloid; APP, amyloid precursor protein; APP-S, non-amyloidogenic secreted form of APP; PI, phosphatidylinositol; DAG, 1,2-diacyl-sn-glycerol; PMA, 12-myristate 13-acetate; ACPD, 1-aminocyclopentane-cis-1,3-dicarboxylic acid; NMDA,N-methyl-d-aspartic acid; CCG-I, (carboxycyclopropyl)glycine; AIDA, 1-aminoindan-1,5-dicarboxylic acid; OAG, 1-oleoyl-2-acetyl-sn-glycerol; CNQX, 6-cyano-7-nitroquinoxaline-2,3-dione; AP5,d-2-amino-5-phosphonopentanoic acid; MPPG, α-methyl-4-phosphonophenylglycine; MSOPPE, α-methylserine-O-phosphate monophenyl ester; AMPA, α-amino-3-hydroxy-5-methyl-4-isoxazalepropionic acid; NT2, NTera 2/cl.D1; NT2N, NTera 2/cl.D1 differentiated neurons; mGluR1α/β, metabotropic glutamate receptor subtype 1α/β; mGluR5α, metabotropic glutamate receptor subtype 5α; RT-PCR, reverse transcription-polymerase chain reaction; DMEM, Dulbecco's modified Eagle's medium; PAGE, poly- acrylamide gel electrophoresis; IP, inositol 1-phosphate; IP2, inositol 1,4-bisphosphate, IP3, inositol 1,4,5-trisphosphate; IP4, inositol 1,3,4,5-tetrakisphosphate; bp, base pair(s). into senile plaques, the formation of neurofibrillary tangles, and neuronal death. Senile plaques consist of a Aβ protein surrounded by dystrophic neuritic processes, astrocytes, and microglia. The β-amyloid protein is a 39–43-amino acid cleavage product of β-amyloid precursor proteins (APP) (1Hardy J. Allsop D. Trends Pharmacol. Sci. 1991; 12: 383-388Abstract Full Text PDF PubMed Scopus (1867) Google Scholar, 2Sisodia S.S. Price D.L. Curr. Opin. Neurobiol. 1992; 2: 648-652Crossref PubMed Scopus (18) Google Scholar, 3Yankner B.A. Mesulam M.M. N. Engl. J. Med. 1991; 325: 1849-1857Crossref PubMed Scopus (208) Google Scholar, 4Selkoe D.J. Yamazaki T. Citron M. Podlisny M.B. Koo E.H. Teplow D.B. Haass C. Ann. N. Y. Acad. Sci. 1996; 777: 57-64Crossref PubMed Scopus (225) Google Scholar). APP is a family of transmembrane glycoproteins with a large extracytoplasmic domain, a membrane-spanning domain containing the Aβ peptide, and a short intracytoplasmic domain (4Selkoe D.J. Yamazaki T. Citron M. Podlisny M.B. Koo E.H. Teplow D.B. Haass C. Ann. N. Y. Acad. Sci. 1996; 777: 57-64Crossref PubMed Scopus (225) Google Scholar). APP exists as three alternatively spliced isoforms, ranging from 695 to 770 amino acids in length and is expressed in mammalian neuronal and nonneuronal cells and tissues (5Selkoe D.J. Annu. Rev. Neurosci. 1994; 17: 489-517Crossref PubMed Scopus (829) Google Scholar). APP is most abundant in the brain and APP695 is the major APP in the human neuronal cell line NTera 2/cl.D1 (NT2) (6Wertkin A.M. Turner R.S. Pleasure S.J. Golde T.E. Younkin S.G. Trojanowski J.Q. Lee V.M.Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9513-9517Crossref PubMed Scopus (195) Google Scholar). APP is thought to be processed through various pathways. APP processed by a constitutive secretory pathway (or α-secretase) results in a large secreted form (APP-Sα) excluding Aβ formation (7Esch F.S. Keim P.S. Beattie E.C. Blacher R.W. Culwell A.R. Oltersdorf T. McClure D. Ward P.J. Science. 1990; 248: 1122-1124Crossref PubMed Scopus (1208) Google Scholar, 8Sisodia S.S. Koo E.H. Beyreuther K. Unterbeck A. Price D.L. Science. 1990; 248: 492-495Crossref PubMed Scopus (745) Google Scholar). Processing by a β-secretase or by an endosomal and lysosomal pathway produces the 4-kDa Aβ protein (9Estus S. Golde T.E. Kunishita T. Blades D. Lowery D. Eisen M. Usiak M. Qu X.M. Tabira T. Greenberg B.D. Science. 1992; 255: 726-728Crossref PubMed Scopus (346) Google Scholar, 10Golde T.E. Estus S. Younkin L.H. Selkoe D.J. Younkin S.G. Science. 1992; 255: 728-730Crossref PubMed Scopus (624) Google Scholar). Mutations in the APP gene have been shown to result in the abnormal processing of APP, which may lead to subsequent Aβ deposition and accumulation (11Cai X.D. Golde T.E. Younkin S.G. Science. 1993; 259: 514-516Crossref PubMed Scopus (835) Google Scholar, 12Golde T.E. Cai X.D. Shoji M. Younkin S.G. Ann. N. Y. Acad. Sci. 1993; 695: 103-108Crossref PubMed Scopus (31) Google Scholar). Recent evidence for this was provided by a human familial Alzheimer's disease mutant APP transgenic mouse that expresses high levels of APP, as well as Aβ, which increases in an age-dependent manner. This results in the formation of amyloid plaques, dendritic and synaptic loss, and astrocytosis, as seen in Alzheimer's disease (13Games D. Adams D. Alessandrini R. Barbour R. Berthelette P. Blackwell C. Carr T. Clemens J. Donaldson T. Gillespie F. et al.Nature. 1995; 373: 523-527Crossref PubMed Scopus (2251) Google Scholar, 14Johnson-Wood K. Lee M. Motter R. Hu K. Gordon G. Barbour R. Khan K. Gordon M. Tan H. Games D. Lieberburg I. Schenk D. Seubert P. McConlogue L. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 1550-1555Crossref PubMed Scopus (585) Google Scholar). Mutations in the presenilin 1 and 2 genes (responsible for many cases of familial Alzheimer's disease) alter APP processing by increasing Aβ generation (15Borchelt D.R. Thinakaran G. Eckman C.B. Lee M.K. Davenport F. Ratovitsky T. Prada C.M. Kim G. Seekins S. Yager D. Slunt H.H. Wang R. Seeger M. Levey A.I. Gandy S.E. Copeland N.G. Jenkins N.A. Price D.L. Younkin S.G. Sisodia S.S. Neuron. 1996; 17: 1005-1013Abstract Full Text Full Text PDF PubMed Scopus (1348) Google Scholar, 16Citron M. Westaway D. Xia W.M. Carlson G. Diehl T. Levesque G. Johnson-Wood K. Lee M. Seubert P. Davis A. Kholodenko D. Motter R. Sherrington R. Perry B. Yao H. Strome R. Lieberburg I. Rommens J. Kim S. Schenk D. Fraser P. Hyslop P.S. Selkoe D.J. Nat. Med. 1997; 3: 67-72Crossref PubMed Scopus (1169) Google Scholar, 17Hardy J. Trends Neurosci. 1997; 20: 154-159Abstract Full Text Full Text PDF PubMed Scopus (1277) Google Scholar, 18Xia W. Zhang J. Kholodenko D. Citron M. Podlisny M.B. Teplow D.B. Haass C. Seubert P. Koo E.H. Selkoe D.J. J. Biol. Chem. 1997; 272: 7977-7982Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar). This supports the idea of a primary role for APP and Aβ in the pathogenesis of Alzheimer's disease. Many populations of neurons are affected in Alzheimer's disease, in particular the cholinergic and glutamatergic neurons of the hippocampus and cerebral cortex, therefore it is important to examine these receptor signaling pathways. The m1 and m3 muscarinic receptors have been shown previously to stimulate the secretion of APP, and recently the activation of metabotropic glutamate receptors was shown to cause an increase in APP secretion (19Wolf B.A. Wertkin A.M. Jolly Y.C. Yasuda R.P. Wolfe B.B. Konrad R.J. Manning D. Ravi S. Williamson J.R. Lee V.M.-Y. J. Biol. Chem. 1995; 270: 4916-4922Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar, 20Lee R.K. Wurtman R.J. Cox A.J. Nitsch R.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8083-8087Crossref PubMed Scopus (179) Google Scholar). Metabotropic glutamate receptors are seven transmembrane-spanning proteins that consist of eight receptor subtypes. The mGluR1 and R5 subtypes are linked to phosphatidylinositol (PI) hydrolysis, whereas the other six subtypes are negatively coupled to adenylate cyclase. The degeneration and loss of neurons seen in Alzheimer's disease and a recent study demonstrating the involvement of metabotropic glutamate receptors in the regulation of APP secretion suggest that a defect in the receptors or in their signaling pathways might lead to abnormal processing of APP and subsequent Aβ deposition. The regulatory mechanism of APP processing and secretion is unknown; however, recent findings suggest that the control is through neurotransmitter receptor coupling to signal transduction pathways (21Nitsch R.M. Slack B.E. Wurtman R.J. Growdon J.H. Science. 1992; 258: 304-307Crossref PubMed Scopus (850) Google Scholar). In order to examine the glutamatergic signaling pathway, the human teratocarcinoma cell line NTera 2/cl.D1 (NT2N) was used. NT2N cells are post-mitotic, terminally differentiated neurons that possess cell surface markers consistent with neurons of the central nervous system. Pure cultures of neurons are obtained through differentiation of the stem cell population with retinoic acid and treatment of the replated neuronal population with mitotic inhibitors to clear any contaminating nonneuronal cells. NT2N neurons provide a strong model for examining APP secretion because they endogenously express APP and secrete both APP and Aβ in response to physiological stimuli. In contrast to non-neuronal cells, NT2N neurons express APP695, the major APP isoform expressed in the brain, and NT2N neurons process APP differently (6Wertkin A.M. Turner R.S. Pleasure S.J. Golde T.E. Younkin S.G. Trojanowski J.Q. Lee V.M.Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9513-9517Crossref PubMed Scopus (195) Google Scholar, 22Arai H. Lee V.M.Y. Messinger M.L. Greenberg B.D. Lowery D.E. Trojanowski J.Q. Ann. Neurol. 1991; 30: 686-693Crossref PubMed Scopus (139) Google Scholar). For this study, NT2N neurons were used to determine if glutamate is involved in the regulation of APP secretion. The media and serum used to maintain the NT2N culture were from Life Technologies, Inc., and all of the mitotic inhibitors and antibiotics used in the cell culture were purchased from Sigma. Matrigel was from Collaborative Research (Bedford, MA). The DAG kinase and lipase inhibitors were from Biomol (Plymouth Meeting, PA), and the glutamate receptor agonists and antagonists were purchased from Tocris Cookson (Ballwin, MO). The phorbol ester PMA was from Sigma and the calcium ionophore A23187 was from Boehringer Mannheim. [35S]Methionine (1000–1500 Ci/mmol) was purchased from ICN Biomedicals (Costa Mesa, CA) andmyo-[3H]inositol (84 Ci/mmol), [3H]inositol 1-phosphate (10 Ci/mmol), [3H]inositol 1,4-bisphosphate (10 Ci/mmol), [3H]inositol 1,4,5-trisphosphate (21 Ci/mmol), and [3H]inositol 1,3,4,5-tetrakisphosphate (21 Ci/mmol) were from NEN Life Science Products. Trichloroacetic acid, trichlorotrifluorethane, and trioctylamine used in the inositol extraction procedure were also from Sigma. SAX Amprep minicolumns were obtained from Amersham Pharmacia Biotech. RNA isolation kit was fromCLONTECH, RT-PCR reagents were from Promega (Madison, WI), and the mGluR1 primers were from the Wistar Institute (University of Pennsylvania, Philadelphia, PA), and mGluR5 primers were from National Biosciences Inc. (Beverly, MA). The human teratocarcinoma NTera2/c1.D1 (NT2) cells were maintained in Opti-MEM supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (23Pleasure S.J. Page C. Lee V.M.Y. J. Neurosci. 1992; 12: 1802-1815Crossref PubMed Google Scholar). 2.3 × 106 cells were seeded into a 75-cm2 flask and treated with 10 μm retinoic acid (in DMEM medium with 10% fetal bovine serum and 1% penicillin/streptomycin) twice a week for 5 weeks. Cells were then trypsinized and replated (Replate 2) onto poly-d-lysine/Matrigel (Collaborative Research)-coated 10-cm dishes or six-well plates. Cells were fed once a week with DMEM medium supplemented with 5% fetal bovine serum, 1% penicillin/streptomycin, and mitotic inhibitors (1 mmcytosine arabinoside, 10 mm fluorodeoxyuridine, 10 mm uridine) for 4 weeks. This yielded a >95% pure culture of differentiated human neurons (NT2N) that could be maintained in culture for 7–8 weeks. NT2N 10-cm dishes or six-well plates (240–480 ng of DNA) were washed three times in Krebs-Hepes buffer (25 mm Hepes, pH 7.4, 115 mmNaCl, 24 mm NaHCO3, 5 mm KCl, 2.5 mm CaCl2, 1 mm MgCl2, 0.1% bovine serum albumin, 3 mmd-glucose), preincubated 30 min under an atmosphere of 95% O2/5% CO2 at 37 °C, and then incubated for the appropriate time with agonists (glutamate, ACPD, quisqualate, CCG-I, PMA, A23187, OAG). To examine the effect of the glutamate receptor antagonists (CNQX, AP5, AIDA, MPPG, MSOPPE) and DAG lipase and kinase inhibitors (RG80267, R59949), the cells were pretreated with the agents for 30 min at 37 °C and then incubated for an additional 30 min alone or in presence of glutamate. In order to metabolically label APP, NT2N cells were serum-starved for 20 min in DMEM methionine-free medium and then labeled with 100–400 μCi/ml [35S]methionine in DMEM methionine-free medium (1% penicillin/streptomycin, 5% fetal bovine serum) for 3 h. The cells were then treated as described above. After treatment, the supernatant was removed and centrifuged for 15 min at 15,000 × g to remove any remaining cells. The supernatant was precleared with protein A-Sepharose beads and then immunoprecipitated overnight with 10–20 μg of an anti-APP-S polyclonal antibody (Karen) and protein A-Sepharose beads as described previously (6Wertkin A.M. Turner R.S. Pleasure S.J. Golde T.E. Younkin S.G. Trojanowski J.Q. Lee V.M.Y. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 9513-9517Crossref PubMed Scopus (195) Google Scholar). Immunoprecipitates were analyzed on 7.5% SDS-PAGE mini-gels, and the radioactivity quantitated using Image Quant software on a Molecular Dynamics PhosphorImager. For data analysis, the control was designated as 100% within each experiment due the differences in radioactive counts between the controls in separate experiments. The glutamate-induced APP-S secretion was determined to be specific for APP after demonstrating that glutamate did not have an effect on the amount of total secreted proteins (data not shown). 60–90 μg of total RNA was isolated from NT2N cells as described previously (24Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63232) Google Scholar). Reverse transcription was then performed as follows. For reverse transcription, RNA was incubated at 65 °C for 5 min and then placed on ice for 10 min. For each reaction of 31 μl, less than 30 μg of total RNA was added to the reaction mixture of: RNase inhibitor (40 units/ml), first strand cDNA 5 × buffer, Moloney murine leukemia virus reverse transcriptase (200 units/ml), bovine serum albumin (1 mg/ml), 0.1m dithiothreitol, and oligo(dT) (1.5 μg). The reverse transcription reaction was performed in a thermal cycler for 60 min at 42 °C, followed by a 10-min incubation at 72 °C. The cDNA generated was then amplified in a 50-μl PCR using 8.5 μl of the cDNA, 10 × PCR buffer, 1 μl of dNTP mix (10 mmeach of dATP, dCTP, dGTP, dTTP), 0.25 μl of Taq polymerase (5 units/μl), and 2.5 μl of each specific primer (20 μm each) (designed from the published sequence of human mGluR1 (5′ CTGCATGTTCACTCCCAAGATGTACAT, 3′ CACGCGCCTGTGCACCACCATGGAAG) and mGluR5 (5′ TGTGCCCAGCTAGTGATTGC, 3′ TGCTCTTCTCATTCTGGGC) (25Desai M.A. Burnett J.P. Mayne N.G. Schoepp D.D. Mol. Pharmacol. 1995; 48: 648-657PubMed Google Scholar,26Minakami R. Katsuki F. Yamamoto T. Nakamura K. Sugiyama H. Biochem. Biophys. Res. Commun. 1994; 199: 1136-1143Crossref PubMed Scopus (58) Google Scholar). The reaction mixtures were layered with mineral oil, placed in the thermal cycler, and programmed for 2 min at 94 °C, followed by 40 cycles at 94 °C for 1 min, 60 °C for 2 min, 72 °C for 3 min, and then a final 7 min at 72 °C. The tubes were placed at 4 °C until the PCR products were analyzed for purity and size on a 1.5% agarose gels. The products were excised from the gels and purified with the Geneclean II kit and the purified products subjected to a restriction enzyme digest with EcoRI for the identification of mGluR1α/β and BglI for mGluR5α. NT2N cells were labeled for 48 h with 10 μCi/dish ofmyo-[3H]inositol, washed three times with Krebs-Hepes buffer (25 mm Hepes, pH 7.4, 115 mmNaCl, 24 mm NaHCO3, 5 mm KCl, 2.5 mm CaCl2, 1 mm MgCl2, 0.1% bovine serum albumin, 3 mmd-glucose, 10 mm LiCl), preincubated 30 min under an atmosphere of 95% O2, 5% CO2 at 37 °C, and then incubated for 2 min with fresh Krebs-Hepes buffer ± 1 mm glutamate. Inositol phosphates were extracted with 0.5 ml of a 1:5 trichloroacetic acid solution and then neutralized with 1 ml of a 3:1 solution of trichlorotrifluoroethane/trioctylamine. The aqueous layers, as well as commercially available inositol phosphates for standardization of the columns, were loaded onto pre-equilibrated Amprep SAX minicolumns and the inositol phosphate adducts (inositol 1-phosphate (IP), inositol 1,4-bisphosphate (IP2), inositol 1,4,5-trisphosphate (IP3), inositol 1,3,4,5-tetrakisphosphate (IP4)) eluted with a step gradient of 5 ml each of 0.05, 0.10, 0.16, and 0.17 m potassium bicarbonate (KHCO3). The fractions were collected and counted in a Wallac scintillation counter. Cells were loaded with fura-2 during a 40-min incubation at 37 °C in 2 ml of Krebs-Hepes buffer (115 mm NaCl, 24 mmNaHCO3, 5 mm KCl, 1 mmMgCl2, 2.5 mm CaCl2, 25 mm glucose, and 25 mm Hepes, pH 7.40) supplemented with 2.5 μm fura-2 acetoxymethylester (Molecular Probes, Eugene, OR) and 0.2 mg/ml pluronic F-127 (Molecular Probes), which was used to increase the loading. The coverslip with the loaded cells was then mounted in a perifusion chamber placed on the homeothermic platform of an inverted Zeiss microscope. The cells were superfused with Krebs-Hepes buffer at 37 °C at a flow rate of 1.5 ml/min. The microscope was used with a × 40 oil objective. Fura-2 was successively excited at 334 and 380 nm by means of two narrow band-pass filters. The emitted fluorescence was filtered through a 520-nm filter, captured with an Attofluor CCD video camera at a resolution of 512 × 480 pixels, digitized into 256 gray levels, and analyzed with version 6.00 of the Attofluor RatioVision software (Atto Instrument, Rockville, MD). The concentration of Ca2+was calculated by comparing the ratio of fluorescence at each pixel to an in vitro 2-point calibration curve. The Ca2+concentration is presented by averaging the values of all pixels in the body of a differentiated NT2N cell (neuron soma), excluding the Ca2+ data of neurites. Data points were collected at an interval of 4.5 s. Student's t test was performed when two groups were compared. Analysis of variance was used, followed by the Student-Newman-Keuls method when multiple groups were compared. In cases where the data did not have a normal distribution, Kruskal-Wallis one-way analysis of variance on ranks was used, followed by Dunn's method of multiple comparison. Differences were considered significant for p < 0.05. NT2N neurons were metabolically labeled with [35S]methionine and then stimulated with 1 mm glutamate for 0–90 min or various concentrations of glutamate for 30 min. APP-S was immunoprecipitated from the medium and the proteins separated on 7.5% SDS-PAGE gels. Fig.1 (top panel) shows the resulting APP-S bands. The lower APP-S band is the 695 form, while the higher APP-S band is the 751 and/or 770 form, the result of any remaining non-neuronal cells within the culture. Glutamate treatment resulted in a 2-fold increase in APP-s secretion between 5 and 30 min, with maximal secretion at 30 min (p < 0.05versus control) (Fig. 1, bottom panel). Between 30 and 90 min, glutamate-induced secretion decreased to the control level of secretion. Glutamate-induced APP-S secretion was dose-dependent (Fig. 2,bottom panel). Fig. 2 (top panel) shows a representative gel depicting an increase in APP-S695secretion with increasing concentrations of glutamate. Glutamate also caused a rapid and sustained increase in cytosolic Ca2+(Fig. 3, top panel). Likewise, the glutamate-induced increase in cytosolic Ca2+ was also dose-dependent (Fig. 3, bottom panel).Figure 2Effect of glutamate concentration on APP-S secretion in NT2N neurons. Cells were labeled for 3 h with [35S]methionine as in Fig. 1 and stimulated with increasing concentrations of glutamate for 30 min. Top panel, representative gel showing the 110-kDa APP-S band after treatment with glutamate. Bottom panel, APP-S secretion after treatment with 0, 100 nm, 1 μm, 10 μm, 100 μm, and 1 mm glutamate. APP-S secretion was quantitated by PhosphorImager analysis as the amount of radioactivity in the APP-S band and is expressed as a percentage of the control within each experiment. Results are shown as the mean ± S.E. of APP-S secretion from three separate observations/condition.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Time course and dose dependence of glutamate effects on cytosolic Ca2+ in NT2N neurons. NT2N neurons were loaded with fura-2 before they were perifused with Krebs-Hepes buffer. The cells were excited by dual wavelength (334 and 380 nm), and the emission light was filtered at 520 nm before it was captured by a CCD camera. Ca2+ concentrations are calculated from the ratio of the intensities obtained at the two excitation wavelengths. Results are shown as the mean ± S.E. from at least 30 cells in three different experiments. Top panel, time course of glutamate; bottom panel, dose curve of glutamate.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Glutamate receptors can be categorized into two distinct groups, ionotropic and metabotropic receptors (27Westbrook G.L. Curr. Opin. Neurobiol. 1994; 4: 337-346Crossref PubMed Scopus (78) Google Scholar, 28Barnard E.A. Trends Pharmacol. Sci. 1997; 18: 141-148Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Ionotropic receptors are selectively permeable ion channels and are subdivided into three groups according to agonist selectivity, NMDA, kainate, and AMPA receptors. The metabotropic receptors are seven transmembrane-spanning proteins coupled to intracellular second messengers. The metabotropic receptor family consists of at least eight different subtypes that are subdivided into three groups according to sequence similarities, agonist selectivity, and intracellular signaling machinery. Therefore, the effects of both metabotropic and ionotropic glutamate receptor agonists and antagonists were examined in NT2N cells. The effects of both metabotropic and ionotropic glutamate receptor agonists on APP-S secretion are shown in TableI. The ionotropic glutamate receptor agonist NMDA (10 μm) did not have any effect on APP-S secretion; however, the non-NMDA glutamate receptor agonists AMPA (100 μm) and kainate (100 μm) caused a 1.5-fold and a 2-fold increase, respectively, in APP-S secretion. AMPA and kainate also caused an increase in intracellular Ca2+ (Fig.4). The nonspecific glutamate receptor agonist quisqualate (100 μm) had a slight effect on APP-S secretion; however, the specific metabotropic glutamate receptor group I and II agonists, ACPD (100 μm) and CCG-I (100 μm) both resulted in a 1.5-fold increase in APP-S secretion, suggesting the glutamate-induced APP-S secretion is mediated in part by metabotropic glutamate receptors.Table IEffect of glutamate receptor agonists on APP-S secretion in NT2N cellsAgonistAPP-S secretion% controlControl100.0Glutamate (1 mm)186.2 ± 9.91-ap < 0.05 versus control.NMDA (10 μm)101.5 ± 6.9AMPA (100 μm)159.3 ± 16.01-ap < 0.05 versus control.Kainate (100 μm)211.5 ± 9.81-ap < 0.05 versus control.ACPD (100 μm)148.7 ± 8.01-ap < 0.05 versus control.CCG-I (100 μm)164.0 ± 22.51-ap < 0.05 versus control.Quisqualate (100 μm)131.4 ± 6.4Cells were labeled for 3 h with [35S]methionine as in Fig. 1 and then treated with various of glutamate receptor agonists for 30 min. APP-S secretion was quantitated by PhosphorImager analysis as the amount of radioactivity in the APP-S band and is expressed as a percentage of the control within each experiment. Results are shown as the mean ± S.E. of APP-S secretion from 4 to 13 separate observations/condition.1-a p < 0.05 versus control. Open table in a new tab Cells were labeled for 3 h with [35S]methionine as in Fig. 1 and then treated with various of glutamate receptor agonists for 30 min. APP-S secretion was quantitated by PhosphorImager analysis as the amount of radioactivity in the APP-S band and is expressed as a percentage of the control within each experiment. Results are shown as the mean ± S.E. of APP-S secretion from 4 to 13 separate observations/condition. The metabotropic glutamate receptor antagonists AIDA (100 μm, Group I), MSOPPE (100 μm, Group II), and MPPG (100 μm, Group III) decreased glutamate-induced APP-S secretion by 17, 27, and 24%, respectively, while NMDA receptor antagonists, CNQX (10 μm) and AP5 (10 μm), did not have any effect on glutamate-induced APP-S secretion (TableII) (29Pellicciari R. Luneia R. Costantino G. Marinozzi M. Natalini B. Jakobsen P. Kanstrup A. Lombardi G. Moroni F. Thomsen C. J. Med. Chem. 1995; 38: 3717-3719Crossref PubMed Scopus (168) Google Scholar, 30Thomas P. Ye Y. Lightner E. Hum. Mol. Genet. 1996; 5: 1809-1812Crossref PubMed Scopus (389) Google Scholar, 31Jane D.E. Pittaway K. Sunter D.C. Thomas N.K. Watkins J.C. Neuropharmacology. 1995; 34: 851-856Crossref PubMed Scopus (104) Google Scholar). These results suggest that glutamate-induced APP-S secretion is mediated in part by metabotropic glutamate receptors.Table IIEffect of glutamate receptor antagonists on APP-S secretion in NT2N cellsAntagonistAPP-S secretion% controlControl100.0Glutamate (1 mm)191.5 ± 23.62-ap < 0.05 versus control.CNQX (10 μm)112.0 ± 13.9CNQX + glutamate211.3 ± 22.2AP5 (10 μm)182.0 ± 57.9AP5 + glutamate257.2 ± 26.72-ap < 0.05 versus control.AIDA (100 μm)101.5 ± 11.8AIDA + glutamate160.8 ± 18.2MPPG (100 μm)95.5 ± 2.5MPPG + glutamate146.8 ± 5.5MSOPPE (100 μm)103.8 ± 4.2MSOPPE + glutamate140.3 ± 5.8Cells were labeled for 3 h with [35S]methionine as in Fig. 1 and then pretreated for 30 min with various glutamate receptor antagonists. The cells were then treated for 30 min with the control, 1 mm glutamate, the antagonist alone, or 1 mmglutamate + the antagonist. APP-S secretion was quantitated by PhosphorImager analysis as the amount of radioactivity in the APP-S band and is expressed as a percentage of the control within each experiment. Results are shown as the mean ± S.E. of APP-S secretion from 3 to 14 separate observations/condition.2-a p < 0.05 versus control. Open table in a new tab Cells were labeled for 3 h with [35S]methionine as in Fig. 1 and then pretreated for 30 min with various glutamate receptor antagonists. The cells were then treated for 30 min with the control, 1 mm glutamate, the antagonist alone, or 1 mmglutamate + the" @default.
• W2016074103 created "2016-06-24" @default.
• W2016074103 creator A5002889060 @default.
• W2016074103 creator A5026286216 @default.
• W2016074103 creator A5040530244 @default.
• W2016074103 creator A5065852445 @default.
• W2016074103 date "1998-05-01" @default.
• W2016074103 modified "2023-09-27" @default.
• W2016074103 title "Regulation of Amyloid Precursor Protein Secretion by Glutamate Receptors in Human Ntera 2 Neurons (NT2N)" @default.
• W2016074103 cites W1605023308 @default.
• W2016074103 cites W1776914999 @default.
• W2016074103 cites W1964972074 @default.
• W2016074103 cites W1969810313 @default.
• W2016074103 cites W1978222372 @default.
• W2016074103 cites W1980803132 @default.
• W2016074103 cites W1990543766 @default.
• W2016074103 cites W1996663290 @default.
• W2016074103 cites W2005320724 @default.
• W2016074103 cites W2010262114 @default.
• W2016074103 cites W2015074272 @default.
• W2016074103 cites W2023646123 @default.
• W2016074103 cites W2024690774 @default.
• W2016074103 cites W2025041792 @default.
• W2016074103 cites W2026114501 @default.
• W2016074103 cites W2029205666 @default.
• W2016074103 cites W2033033457 @default.
• W2016074103 cites W2033745315 @default.
• W2016074103 cites W2034509535 @default.
• W2016074103 cites W2038012168 @default.
• W2016074103 cites W2039075247 @default.
• W2016074103 cites W2058110454 @default.
• W2016074103 cites W2060579161 @default.
• W2016074103 cites W2061798362 @default.
• W2016074103 cites W2064365351 @default.
• W2016074103 cites W2068761941 @default.
• W2016074103 cites W2071691905 @default.
• W2016074103 cites W2076195687 @default.
• W2016074103 cites W2080967195 @default.
• W2016074103 cites W2081998222 @default.
• W2016074103 cites W2083420532 @default.
• W2016074103 cites W2084972185 @default.
• W2016074103 cites W2090518053 @default.
• W2016074103 cites W2095745901 @default.
• W2016074103 cites W2097248117 @default.
• W2016074103 cites W2120236371 @default.
• W2016074103 cites W2120293242 @default.
• W2016074103 cites W2126800086 @default.
• W2016074103 cites W2162059739 @default.
• W2016074103 cites W2327752912 @default.
• W2016074103 cites W4234554078 @default.
• W2016074103 cites W4294216491 @default.
• W2016074103 doi "https://doi.org/10.1074/jbc.273.22.14015" @default.
• W2016074103 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9593752" @default.
• W2016074103 hasPublicationYear "1998" @default.
• W2016074103 type Work @default.
• W2016074103 sameAs 2016074103 @default.
• W2016074103 citedByCount "68" @default.
• W2016074103 countsByYear W20160741032012 @default.
• W2016074103 countsByYear W20160741032013 @default.
• W2016074103 countsByYear W20160741032014 @default.
• W2016074103 countsByYear W20160741032016 @default.
• W2016074103 countsByYear W20160741032020 @default.
• W2016074103 countsByYear W20160741032021 @default.
• W2016074103 countsByYear W20160741032023 @default.
• W2016074103 crossrefType "journal-article" @default.
• W2016074103 hasAuthorship W2016074103A5002889060 @default.
• W2016074103 hasAuthorship W2016074103A5026286216 @default.
• W2016074103 hasAuthorship W2016074103A5040530244 @default.
• W2016074103 hasAuthorship W2016074103A5065852445 @default.
• W2016074103 hasBestOaLocation W20160741031 @default.
• W2016074103 hasConcept C153911025 @default.
• W2016074103 hasConcept C170493617 @default.
• W2016074103 hasConcept C185592680 @default.
• W2016074103 hasConcept C49039625 @default.
• W2016074103 hasConcept C55493867 @default.
• W2016074103 hasConcept C61174792 @default.
• W2016074103 hasConcept C86803240 @default.
• W2016074103 hasConcept C95444343 @default.
• W2016074103 hasConceptScore W2016074103C153911025 @default.
• W2016074103 hasConceptScore W2016074103C170493617 @default.
• W2016074103 hasConceptScore W2016074103C185592680 @default.
• W2016074103 hasConceptScore W2016074103C49039625 @default.
• W2016074103 hasConceptScore W2016074103C55493867 @default.
• W2016074103 hasConceptScore W2016074103C61174792 @default.
• W2016074103 hasConceptScore W2016074103C86803240 @default.
• W2016074103 hasConceptScore W2016074103C95444343 @default.
• W2016074103 hasIssue "22" @default.
• W2016074103 hasLocation W20160741031 @default.
• W2016074103 hasOpenAccess W2016074103 @default.
• W2016074103 hasPrimaryLocation W20160741031 @default.
• W2016074103 hasRelatedWork W2115547927 @default.
• W2016074103 hasRelatedWork W2136621634 @default.
• W2016074103 hasRelatedWork W3044064086 @default.
• W2016074103 hasRelatedWork W4243182520 @default.
• W2016074103 hasRelatedWork W4295681336 @default.
• W2016074103 hasRelatedWork W4297386564 @default.
• W2016074103 hasRelatedWork W4307336491 @default.
• W2016074103 hasRelatedWork W4377093276 @default.

• next