FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016112110> ?p ?o ?g. }

• W2016112110 endingPage "1725" @default.
• W2016112110 startingPage "1717" @default.
• W2016112110 abstract "Procathepsin B from the parasitic trematode Schistosoma mansoni was expressed as a glycosylation-minus mutant in yeast cells and purified by means of a histidine affinity tag which was added to the carboxyl terminus of the recombinant protein. The purified zymogen underwent autoprocessing but required an assisting protease for activation. Pepsin-activated schistosomal cathepsin B was further characterized with the cathepsin B-specific substrates N-benzyloxycarbonyl (Z)-Arg-Arg-p-nitroanilide, Z-Arg-Arg-7-amido-4-methylcoumarin, and Z-Phe-Arg-7-amido-4-methylcoumarin. A proteolytic activity comparable to mammalian cathepsin B was observed. In addition, we analyzed the degradation of human hemoglobin by schistosomal cathepsin B, which has been suggested to be the physiological target of the protease. Procathepsin B from the parasitic trematode Schistosoma mansoni was expressed as a glycosylation-minus mutant in yeast cells and purified by means of a histidine affinity tag which was added to the carboxyl terminus of the recombinant protein. The purified zymogen underwent autoprocessing but required an assisting protease for activation. Pepsin-activated schistosomal cathepsin B was further characterized with the cathepsin B-specific substrates N-benzyloxycarbonyl (Z)-Arg-Arg-p-nitroanilide, Z-Arg-Arg-7-amido-4-methylcoumarin, and Z-Phe-Arg-7-amido-4-methylcoumarin. A proteolytic activity comparable to mammalian cathepsin B was observed. In addition, we analyzed the degradation of human hemoglobin by schistosomal cathepsin B, which has been suggested to be the physiological target of the protease. INTRODUCTIONThe trematode Schistosoma mansoni lives in human blood vessels, causing the parasitic disease bilharziosis. Approximately 200 million people in tropical countries are infected by the helminth. Infection with S. mansoni results in a life-long chronic disease which is marked by increasing tissue damage caused by eggs deposited throughout the body. With 750,000 deaths annually, bilharziosis is the second most deadly parasitic disease after malaria.Proteases are key components of the pathogenicity of parasites. They facilitate tissue penetration and determine nutritional sources of the parasite within intermediate and human hosts(1.McKerrow J.H. Exp. Parasitol. 1989; 68: 111-115Crossref PubMed Scopus (229) Google Scholar). Cathepsin B is the major thiol protease of adult worms of Schistosoma mansoni and may be a valuable target for therapeutic agents.Cathepsin B (EC 3.4.22.1) belongs to the family of cysteine proteases. On the basis of sequence analysis, cysteine proteases have recently been classified into ERFNIN and cathepsin B-like cysteine proteases (2.Karrer M.K.P. Stacia L. DiTomas M.E. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3063-3067Crossref PubMed Scopus (340) Google Scholar). Mammalian cathepsins B are lysosomal proteases involved in intracellular protein degradation. In addition, they are believed to play a role in tumor invasion and metastasis(3.Keppler D. Abramanson M. Sordat B. Biochem. Soc. Trans. 1994; 22: 43-49Crossref PubMed Scopus (28) Google Scholar).Only little is known about cathepsin B of helminths. The genes of cathepsin B from Haemonchus contortus (4, EMBL accession number M60212), Ostertagia ostertagi (5, EMBL accession number M88503), S. mansoni (6, EMBL accession number M21309), and Schistosoma japonicum (EMBL accession number X70968) and of the free-living nematode Caenorhabditis elegans (7, EMBL accession number M74797) have been determined, but the corresponding enzymes have not been well characterized. Among these enzymes, cathepsin B of S. mansoni has evoked most attention as it is believed to be a key enzyme in the degradation of host hemoglobin(8.Chappell C.L. Dresden M.H. Arch. Biochem. Biophys. 1987; 256: 560-568Crossref PubMed Scopus (31) Google Scholar), and as it is highly immunogenic in man.Early studies suggested that S. mansoni possesses a protease which specifically hydrolyzes human hemoglobin(9.Timms A.R. Bueding E. Br. J. Pharmacol. 1959; 14: 68-73Crossref PubMed Scopus (83) Google Scholar), and two groups reported the purification of a hemoglobinolytic protease(10.Lindquist R.N. Senft A.W. Petitt M. McKerrow J. Exp. Parasitol. 1986; 61: 398-404Crossref PubMed Scopus (31) Google Scholar, 11.Dresden M.H. Deelder A.M. Exp. Parasitol. 1979; 48: 190-197Crossref PubMed Scopus (51) Google Scholar). The latter group described a cysteine protease with a molecular mass of 32 kDa and a substrate specifity similiar to mammalian cathepsin B. In contrast to the lysosomal localization of the mammalian cathepsin B, the schistosomal counterpart is secreted into the gut lumen, which is in line with its possible involvement in parasite nutrition(12.Chappell C.L. Dresden M.H. Exp. Parasitol. 1986; 61: 160-167Crossref PubMed Scopus (94) Google Scholar). Nevertheless, detailed studies of the protease were impossible due to the inavailability of sufficient amounts of purified protein from the obligate parasitic worm.The gene of schistosomal cathepsin B was isolated from a cDNA gene bank of adult worms(6.Klinkert M.-Q. Ruppel A. Beck E. Mol. Biochem. Parasitol. 1987; 25: 247-255Crossref PubMed Scopus (34) Google Scholar), taking advantage of the fact that this protease is highly immunogenic in man. The protease (also termed Sm31) has been suggested as an immunodiagnostic antigen of bilharziosis(13.Klinkert M.-Q. Bommert K. Moser D. Felleisen R. Link G. Doumbo O. Beck E. Trop. Med. Parasitol. 1991; 42: 319-324PubMed Google Scholar), which is at present diagnosed by laborious examination of feces and urine for eggs.In view of its participation in host hemoglobin degradation and its potential as a possible component of an immunoassay, several attempts to express active schistosomal cathepsin B have been undertaken in the past.Cathepsin B of S. mansoni has been expressed as a fusion protein with the amino-terminal region of the RNA replicase of the phage MS2 in Escherichia coli. However, the fusion protein aggregated in the cytoplasm and could only be solubilized with strong denaturants(14.Klinkert M.-Q. Ruppel A. Felleisen R. Link G. Beck E. Mol. Biochem. Parasitol. 1988; 27: 233-240Crossref PubMed Scopus (25) Google Scholar). We expressed procathepsin B in its unfused form in E. coli, but the recombinant protein was also found to be insoluble. ( 1G. Lipps, unpublished results.) In addition, cathepsin B has been expressed in insect cells, but the yield of soluble enzyme was too low for purification and enzyme characterization (15.Götz B. Klinkert M.-Q. Biochem. J. 1993; 290: 801-806Crossref PubMed Scopus (43) Google Scholar).Recently, we succeeded in expressing cathepsin B in Saccharomyces cerevisiae. Here we report on the construction of a plasmid which allowed efficient expression of procathepsin B. The coding region of the zymogen was fused to the mating factor α secretion signal, and the recombinant protein was secreted in the culture supernatant by the yeast cells. It was purified by taking advantage of a hexahistidine affinity tag which was added to the carboxyl terminus of the protein. The zymogen was subsequently processed to active cathepsin B in vitro by pepsin and characterized enzymatically.EXPERIMENTAL PROCEDURESMaterialsRestriction endonucleases and DNA-modifying enzymes were purchased from New England Biolabs. Radiochemicals were obtained from Amersham. Protease inhibitors were bought from Sigma. The substrates N-benzyloxycarbonyl-L-arginyl-L-arginine-p-nitroanilide (ZArg-Arg-pNA), ( 2The abbreviations used are: Z-Arg-Arg-pNAN-benzyloxycarbonyl-L-arginyl-L-arginine-p-nitroanilideZ-Arg-Arg-AMCN-benzyloxycarbonyl-L-arginyl-L-arginine-7-amido-4-methylcoumarinZ-Phe-Arg-AMCN-benzyloxycarbonyl-L-phenylalanyl-L-arginine-7-amido-4-methylcoumarinPCRpolymerase chain reactionPAGEpolyacrylamide gel electrophoresisHPLChigh performance liquid chromatographyMES4-morpholineethanesulfonic acidTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineDTTdithiothreitol.) N-benzyloxycarbonyl-L-arginyl-L-arginine-7-amido-4-methylcoumarin (Z-Arg-Arg-AMC), and N-benzyloxycarbonyl-L-phenylalanyl-L-arginine-7-amido-4-methylcoumarin (Z-Phe-Arg-AMC) were purchased from Bachem and Ni2+-NTA agarose was from Qiagen. All reagents were at least analytical grade.Plasmid ConstructionsDNA manipulations were carried out essentially as described by Sambrook et al.(16.Sambrook J. Frisch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring, NY1989Google Scholar) using the E. coli strains HB101 and C600 as hosts. Site-directed mutagenesis was carried out by PCR using an automated thermocycler (ATAQ, Pharmacia). The cDNA of procathepsin B of S. mansoni was cloned into three expression cassettes.pUC8-Sm31AThe plasmid pMATA21/51/H-2 (a gift from E. F. Ernst, Düsseldorf) is a pUC8-based vector carrying the EcoRI-HindIII fragment of mating-factor α from S. cerevisiae (EMBL accession numbers J01340 and X15154) comprising the promoter and the prepropeptide of MFα. The MFα preprosequence was changed by site-directed mutagenesis and contained a new StuI restriction site immediately behind the recognition site (Lys-Arg) of the prohormone processing enzyme KEX2. This mutation allows easy in-frame blunt end ligation of heterologous DNA downstream from the preprosequence of MFα.After destruction of the unique EcoRI site of the vector pMATA21/51/H-2, the plasmid was cut with NarI, treated with Klenow's fragment, digested with HindIII, and subsequently ligated to a 1.4-kilobase fragment obtained by partial digestion of pSP-Cb1 (17.Felleisen R. Klinkert M.-Q. EMBO J. 1990; 9: 371-377Crossref PubMed Scopus (22) Google Scholar) with PvuII and HindIII. The 1.4-kilobase fragment contains the complete coding sequence of preprocathepsin B (EMBL accession number M21309). The resulting plasmid, referred to as intermediate, was cut with EcoRI and StuI and ligated to an EcoRI-restricted PCR fragment derived from pSP-Cb1 with a sense primer representing the amino terminus of procathepsin B plus the dipeptide Glu-Ala from the signal sequence (pCb5: GAAGCTCATATTTCAGTTAAG) and a reverse primer (pCb4: CCAACATGATCCACATCG) 280 bases further downstream. Clones containing the PCR fragment were detected by colony hybridization, and the correct in-frame fusion of preproMFα with the amino-terminal part of procathepsin B, as well as the integrity of PCR-generated stretches, were confirmed by DNA sequencing. This plasmid was cut with EcoRI and NdeI and ligated to a 1.2-kilobase DNA fragment coding for the carboxyl-terminal part of Sm31, obtained by partial digestion of the intermediate with EcoRI and NdeI. The resulting construction pUC8-Sm31A contained a complete expression cassette: a MFα promoter followed by the gene fusion coding for preproMFα-procathepsin B (Fig. 1A).pUC8-Sm31BUsing the mutagenesis primers Gly(P): ATTGTTACTGCAAGTTCGAAAGAACAGCACACCGGTGTG (BstBI site, glutamine codon, and BsrfI site underlined) and His(P): CTTTTATTTAAGTATTAGTATACTTAGTGATGGTGATGGTGATGGTTTATTCGACGC (AccI site and His-6-tail underlined) two point mutations were introduced and a hexahistidine affinity tag was appended to the carboxyl terminus of procathepsin B. The substitution of Asn-183 by Gln destroyed a consensus sequence for N-linked glycosylation, while the second point mutation introduced a diagnostic restriction site BsrFI. The fragment obtained by amplifying procathepsin B with the two mutagenesis primers was cut with BstBI and AccI and ligated to pUC8-Sm31A, which had been digested with the same enzymes. This construct, which allowed the expression of a nonglycosylated and affinity-tagged procathepsin B, was confirmed by DNA sequencing and named pUC8-Sm31B.pUC8-Sm31CA PCR fragment obtained by amplifying pUC8-Sm31B with the sense primer pMF: AAGAAGATCTAAAAGAATGAGATTTCC (BglII and start codon underlined) corresponding to the amino terminus of preproMFα, and the reverse primer pCb4: CCAACATGATCCACATCG was cut with BglII and AatII and ligated to pUC8-Sm31B, digested partially with the same restriction endonucleases. The resulting construction was a promoter-free expression cassette of mutated preproMFα-procathepsin B, which was confirmed by DNA sequencing and named pUC8-Sm31C.The expression cassettes of pUC8-Sm31A and pUC8-Sm31B were integrated into various S. cerevisiae shuttle vectors with different orgins of replication and resulted in expression vectors under the control of the constitutive MFα promoter.The construct we used for subsequent high level expression of recombinant procathepsin B was based on the yeast expression vector pEMBLyex2 (18.Baldari C. Murray J.A.H. Ghiara P. Cesareni G. Galeotti C.L. EMBO J. 1987; 6: 229-234Crossref PubMed Scopus (142) Google Scholar) which provides an inducible GAL10/CYC1 hybrid promoter (19.Guarante L. Yocum R.R. Gifford P. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 7410-7414Crossref PubMed Scopus (364) Google Scholar), a polylinker and signals for transcriptional termination and polyadenylation, as well as the two selection markers URA3 and leu2-d. To construct pEMBLyex2-Sm31 (Fig. 1B), an AccI (filled-in)/BglII fragment encoding the preproMFα-procathepsin B fusion was isolated from pUC8-Sm31C and cloned into the SalI (filled-in) and BamHI restrictions sites of the pEMBLyex2 polylinker.Expression and Purification of Procathepsin BCyropreserved competent yeast cells of strain HT393 (leu2, ura3, pra1, prb1, prc1, cps1, pre1) were prepared according to Dohmen et al.(20.Dohmen R.J. Strasser A.W.M. Höner C.B. Hollenberg C.P. Yeast. 1991; 7: 691-692Crossref PubMed Scopus (317) Google Scholar) and transformed with pEMBLyex2-Sm31. Ura+ transformants were detected on agar minimal plates (2% glucose, 0.67% yeast nitrogen base without amino acids (Difco), 20 mg/liter L-tryptophan, adenine, L-histidine, L-methionine, and L-lysine, 30 mg/liter L-leucine) grown at 30°C for 3 days and subsequently cultured on agar minimal plates. For large scale expression of procathepsin B, 20-200 ml of minimal medium without uracil and leucine were inoculated with transformed yeast cells and grown for 24 h on an orbital shaker. Expression was induced by inoculating the preculture into 10 volumes of complete medium (2% galactose, 1% yeast extracts (Difco), 2% tryptone (Difco), 100 mM sodium phosphate, pH 6.0). These shake-flask cultures were grown for 72 h at 30°C, 100 rpm.The cleared culture supernatant was brought to 0.3 M NaCl with 5 M NaCl, diluted with 1 volume of buffer A (50 mM sodium dihydrogen phosphate, 300 mM NaCl) and adjusted to pH 8. Then, 0.02-0.002 volume of Ni2+-NTA agarose previously equilibrated with buffer A was added, and the suspension was stirred overnight at 4°C. The agarose beads were collected by vacuum filtration and washed twice with 0.05 volume of buffer A and twice with buffer B (same as buffer A, but adjusted to pH 7). The matrix was poured in a C10 column or a C26 column (Pharmacia Biotech Inc.), and proteins were eluted with a pH step gradient (buffer A adjusted to pH 6, pH 5, pH 4, and pH 3, flow rate: 1 column volume/h). Procathepsin B eluted at pH 4. Alternatively, procathepsin B was eluted with 100 mM EDTA, 50 mM sodium phosphate, pH 6.3.SDS-PAGE and Western BlottingProteins were separated by SDS-PAGE according to Laemmli (21.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (206024) Google Scholar) or according to Schägger & von Jagow(22.Schägger H. von Jagow G. Anal. Biochem. 1987; 166: 368-379Crossref PubMed Scopus (10439) Google Scholar). The gels were stained with Coomassie Blue or electroblotted (Fast-Blot, Biometra, Göttingen, Germany) onto nitrocellulose membranes (Schleicher & Schüll). After transfer, the membranes were blocked for 30 min with 1% Tween 20 in Tris-buffered saline (TBS), incubated for 1 h with polyclonal anti-cathepsin B rabbit serum diluted 1:2000 into TBST (TBS + 0.05% Tween 20), washed with TBST, and incubated for 1 h with anti-rabbit goat antibodies coupled to alkaline phosphatase (Jackson Immunoresearch, 1:5000 in TBST). The membrane was washed again in TBST and stained with 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium.Amino-terminal Sequencing of ProteinsAfter separation by SDS-PAGE, proteins were blotted onto polyvinylidene difluoride membranes (23.Matsudaira P. J. Biol. Chem. 1987; 262: 10035-10038Abstract Full Text PDF PubMed Google Scholar) and stained with Coomassie Blue. Bands of interest were cut out and used directly for determination of amino-terminal amino acid residues with an Applied Biosystems model 477A protein Sequencer. Peptides (digestion fragments of human hemoglobin) were sequenced after HPLC purification.Determination of Procathepsin BDue to the lack of enzymatic activity of procathepsin B, the recombinant protein was detected by Western blotting, and the concentration was estimated from Coomassie Blue-stained gels of yeast culture medium concentrated by trichloroacetic acid precipitation. The concentration of purified zymogen was determined according to Bradford (24.Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (213377) Google Scholar) using bovine serum albumin as standard.Activation of Procathepsin B1 volume of procathepsin B solution (0.05-0.2 mg/ml) was combined with 0.5 volume of pepsin solution (5-20 μg/ml in 0.5 M sodium phosphate, pH 3.0) and incubated at 37°C for 10 to 60 min. The activation reaction was stopped by addition of 9 volumes of assay buffer (pH 6.0) or by adding pepstatin A to a final concentration of 1 μM.Enzyme Assay Z-Arg-Arg-pNAThe method of Hasnain et al.(25.Hasnain S. Hirama T. Tam A. Mort J.S. J. Biol. Chem. 1992; 267: 4713-4721Abstract Full Text PDF PubMed Google Scholar) was used. Hydrolysis of Z-Arg-Arg-pNA (∊405 = 10,400 M-1 cm-1) was monitored with a Hitachi U-3000 photometer or with a Bio-Rad UV-3550 microtiterplate photometer equipped with a 405 nm filter and controlled by the Kinetic Collector Software (Bio-Rad).AMC DerivatesThe hydrolysis of Z-Arg-Arg-AMC and Z-Phe-Arg-AMC was determined according to the methods of Barrett and Kirschke (44.Barrett A.J. Kirschke H. Methods Enzymol. 1981; 80: 535-561Crossref PubMed Scopus (1726) Google Scholar) and Barrett et al. (52.Barrett A.J. Kembhavi A.A. Brown M.A. Kirschke H. Knight C.G. Tamai M. Hananda K. Biochem. J. 1982; 201: 189-198Crossref PubMed Scopus (914) Google Scholar) which were modified slightly. The stock buffer was 60 mM MES, pH 5.9, 600 mM NaCl, 4 mM EDTA. Each assay tube contained 0.375 ml of stock buffer, 0.1 ml of 30 mM DTT, and 0.95 ml of 0.1% Brij 35. 37.5 μl of enzyme solution (approximately 2 pmol) were added, preincubated 2 min at 37°C, and equilibrated to room temperature. The reactions were started by the addition of 37.5 μl of 4 mM substrate solution in dimethyl sulfoxide and stopped, after an exactly 15-min incubation at 25°C, with 1.5 ml of 100 mM sodium monochloroacetate in 100 mM sodium acetate, pH 4.3. Fluorescence was determined by a fluorescence spectrometer (Model 3000, Perkin-Elmer Ltd., Beaconsfield, Buckinghamshire, United Kingdom) with the excitation wavelength at 370 nm and emission measured at 460 nm.Reduction of MethemoglobinReduction and oxygenation of commercial methemoglobin (Sigma) to oxyhemoglobin was performed in the cold as follows. Adapted from the procedure of Dixon and McIntosh(53.Dixon H.B.F. McIntosh R. Nature. 1967; 213: 399-400Crossref PubMed Scopus (35) Google Scholar), a column of 70 × 5 mm (Pasteur capillary pipette), filled with Sephadex G-25, was equilibrated with an oxygen-saturated buffer, containing 10 mM MES, pH 6.5, and 1 mM EDTA. 75 μl of a freshly prepared 10% (w/v) solution of sodium hydrosulfite in this buffer was run on the column and drained into the gel with 50 μl of the equilibration buffer. 100 μl of a saturated aqueous solution of methemoglobin was applied to the column and run in the same buffer. The peak fraction was re-equilibrated on a second column. Complete reduction and oxygenation of hemoglobin was checked spectrophotometrically(54.Winterbourn C. Methods Enzymol. 1990; 186: 265-272Crossref PubMed Scopus (396) Google Scholar).Isolation of PeptidesPeptides were separated by reversed-phase HPLC through a Vydac (Hesperia, CA) C4, 30-nm narrow bore (2.1 × 250 mm) column using 0.1% (v/v) aqueous trifluoroacetic acid with an acetonitrile gradient (0-60% in 45 min) and a flow rate of 200 μl/min at 45°C. About 1 nmol of cathepsin B-digested hemoglobin was applied on the column and monitored at 220 nm. For preparative runs, about 10 nmol of digested hemoglobin α/β-chains were applied, and individual peak fractions were collected manually.Mass SpectrometryPeptide masses were determined by matrix-assisted laser desorption/ionization time of flight mass spectrometry on a Vision 2000 (Finnigan MAT, Bremen, FRG) equipped with a nitrogen laser. For each analysis, 1 μl of a reversed-phase HPLC fraction (2-5 pmol of peptide) was mixed with 1 μl of 2,5-dihydroxybenzoic acid as matrix directly on a sample target. Spectra were composed of 10-20 laser shots and calibrated externally with angiotensin and insulin.RESULTSExpression of Procathepsin BOur attempts to express active cathepsin B in E. coli failed due to aggregation of the recombinant protein in the cytoplasm. Therefore, we decided to express procathepsin B as a secretory protein in yeast. We constructed several yeast expression plasmids, but most of them resulted in disappointingly low yields of recombinant protein. Expression of procathepsin B using the constitutive MFα promoter on a yeast episomal plasmid resulted in approximately 20 μg of recombinant protein per liter of culture. In addition, analysis was hampered due to heterogeneous hyperglycosylation of the recombinant protein. Digestion with endoglycosidase F/N-glycosidase F (Boehringer Mannheim) was necessary to identify an immunoreactive band on Western blots (data not shown).In a second attempt, a glycosylation site of procathepsin B was destroyed. The primary structure of procathepsin B contains two consensus sequences for N-linked glycosylation, Asn-X-Ser/Thr/(Cys)(26.Marshall R.D. Annu. Rev. Biochem. 1972; 41: 673-702Crossref PubMed Scopus (511) Google Scholar). However, one of the consensus sequences is followed by a proline residue which often prevents N-glycosylation(27.Bause E. Biochem. J. 1983; 209: 331-336Crossref PubMed Scopus (515) Google Scholar). The native protein is most probably not modified at this site, as only one N-linked sugar chain has been determined experimentally(28.Felleisen, R. (1990) Molekular biologische Ansätze zur Immundiagnose der Bilharziose und Charakterisierung der hierfür verwendeten Antigene Sm31 und Sm32 von Schistosoma mansoni. Ph.D. thesis, University of Heidelberg, GermanyGoogle Scholar). The mutated recombinant protein was no longer glycosylated, but the expression rate of procathepsin B under the control of the constitutive MFα promoter remained low.Reducing the copy number of constitutive expression units can lead to an increase of secretion efficiency in yeast(29.Ernst J.F. DNA (NY). 1986; 5: 483-491Crossref PubMed Scopus (56) Google Scholar). Our attempts to improve expression using an integrating expression vector or an autonomously replicating expression plasmid, however, resulted in a decrease of expression. High level expression (up to 10 mg/liter) was finally achieved by expressing the preproMFα-procathepsin B fusion protein under the control of the inducible galactose promoter of the yeast episomal plasmid pEMBLyex2 (Fig. 1B). This plasmid has an inefficiently transcribed leu2 gene leading to an unusually high copy number under selective growth conditions.Expression was found to be optimal when the yeast strain HT393, which is deficient in several proteinases, was grown in complete medium, thus favoring high biomass accumulation. In Fig. 2A, the culture supernatant of HT393 (pEMBLyex2-Sm31) is compared with the supernatant of a control culture. A dominant 40-kDa protein is present in the culture medium of the expressing yeast strain, but not of the control culture. This protein corresponds to procathepsin B as demonstrated by the Western blot (Fig. 2A). In addition to the 40-kDa band, a protein of about 20 kDa is seen in the Western blot. This protein probably presents a degradation product of procathepsin B which seems to have lost the carboxyl-terminal hexahistidine affinity tag as it does not copurify with the intact zymogen (see below).Figure 2:Expression and purification of schistosomal procathepsin B. A, Coomassie Blue-stained gel (lanes 1 and 2) and Western blot (lanes 3 and 4) of yeast culture supernatants. Proteins contained in 0.1 ml of supernatant each were trichloroacetic acid-precipitated and analyzed by SDS-PAGE. Western blot analysis was performed with anti-cathepsin B serum. Lanes 1 and 3, HT393; lanes 2 and 4, HT393 transformed with pEMBLyex2-Sm31. B, elution profile of Ni2+-NTA agarose. Proteins from 250 ml of cell-free culture supernatant were batch-absorbed on 0.35-ml Ni2+-NTA-agarose. The matrix was washed and poured in a C10 column (Pharmacia), and proteins were eluted by applying pH-steps as indicated. The fractions containing the eluate at pH 4.0 were pooled (approximately 100 μg of procathepsin B). C, purified procathepsin B analyzed by SDS-PAGE and stained with Coomassie Blue. Lane 1, acidic elution protocol as in B; lane 2, EDTA elution protocol (see text for details).View Large Image Figure ViewerDownload Hi-res image Download (PPT)To accomplish secretion of procathepsin B, the gene was cloned behind the preproMFα peptide. This sequence promotes secretion of the mating factor α in yeast cells. Processing by the KEX2-protease has been reported to be a rate-limiting step in secretion(30.Hitzeman R.A. Chen C.Y. Dowbenko D.J. Renz M.E. Liu C. Pai R. Simpson N.J. Kohr W.J. Singh W.J. Chisholm V. Hamilton R. Chang C.N. Methods Enzymol. 1990; 185: 421-440Crossref PubMed Scopus (39) Google Scholar). In order to best mimic the authentic KEX2-processing site (Lys-Arg↓Glu-Ala), the Glu-Ala dipeptide which belongs to the signal sequence of preprocathepsin B was not deleted during construction of the fusion protein. Indeed, the fusion proMFα-procathepsin B was never observed in the culture supernatant of transformed yeast cells.Purification of Secreted Recombinant Procathepsin BThe addition of a hexahistidine affinity tag to the carboxyl terminus of procathepsin B enabled a purification using Ni2+-chelate affinity chromatography introduced by Hochuli et al.(31.Hochuli E. Bannwarth W. Döbeli H. Gentz R. Stüber D. Bio/Technology. 1988; 6: 1321-1325Crossref Scopus (957) Google Scholar) for the purification of recombinant E. coli proteins. We adapted this chromatographic method to the purification of recombinant histidine-tagged proteins secreted into the culture supernatant. The culture supernatant was batch-adsorbed onto Ni2+-NTA agarose, which was subsequently loaded onto a column and eluted by applying pH steps (Fig. 2B). Alternatively, the procathepsin B can be eluted from the column using the competitor imidazole or the chelator EDTA.The eluant of the metal chelate chromatography depended on the elution method applied (Fig. 2C). When using EDTA to desorb the protein from the matrix, a single protein of about 40 kDa (theoretical molecular mass of procathepsin B, 38 kDa) was observed. When the protein was eluted by low pH, two immunoreactive proteins (40 kDa and 35 kDa) appeared in the eluant.It was first considered that the 35-kDa protein is a degradation product of cathepsin B caused by a contaminating protease which is active either at low pH or in the absence of EDTA. However, when purified procathepsin B obtained by EDTA elution (pH 6.3) was incubated at pH 5, the 35-kDa protein was observed even in the presence of protease inhibitors (Fig. 3). The 35-kDa protein was absent when the thiol protease inhibitor E-64 was included in the incubation mixture.Figure 3:Autoprocessing of procathepsin B. 20 pmol of procathepsin B (final concentration 1 μM) were incubated in 50 mM sodium phosphate, 300 mM NaCl, 10 mM DTT, pH 5.0, at 37°C for 16 h in the presence and absence of protease inhibitors as indicated. M, molecular weight standards, E-64, addition of 1 μM E-64; PMSF, 2 mM phenylmethylsulfonyl fluoride; PepA, 1 μM pepstatin A; φ, no addition of protease inihibitor. The samples were analyzed by SDS-PAGE and Coomassie Blue staining.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Since no vacuolar cysteine protease has been detected in S. cerevisiae(32.Jones E.W. Methods Enzymol. 1991; 194: 428-453Crossref PubMed Scopus (363) Google Scholar) and since the yeast strain used for expression is deficient in a subunit of yscE, the only known cellular cysteine protease of S. cerevisiae(33.Hirsch H.H. Rendueles P.S. Wolf D.H. Walton E.F. Yarranton G.T. Molecular and Cell Biology of Yeast. Blackie, Glasgow1989: 134-200Google Scholar), the 35-kDa protein is probably an autoprocessing product of procathepsin B. It is noteworthy that autocatalytic processing has also been described for mammalian cathepsin B (34.Rowan A.D. Mason P. Mach L. Mort J.S. J. Biol. Chem. 1992; 267: 15993-15999Abstract Full Text PDF PubMed Google Scholar, 35.Mach L. Mort J.S. Glössl J. J. Biol. Chem. 1994; 269: 13030-13055Abstract Full Text PDF PubMed Google Scholar) and for papain(36.Vernet T. Khouri H.E. Laflamme P. Tessier D.C. Musil R. Gour-Salin B.J. Storer A.C. Thomas D.Y. J. Biol. Chem. 1991; 266: 21451-21457Abstract Full Text PD" @default.
• W2016112110 created "2016-06-24" @default.
• W2016112110 creator A5015095736 @default.
• W2016112110 creator A5039594754 @default.
• W2016112110 creator A5059998786 @default.
• W2016112110 date "1996-01-01" @default.
• W2016112110 modified "2023-10-16" @default.
• W2016112110 title "Cathepsin B of Schistosoma mansoni" @default.
• W2016112110 cites W1164428528 @default.
• W2016112110 cites W1484675846 @default.
• W2016112110 cites W1547781918 @default.
• W2016112110 cites W1548119734 @default.
• W2016112110 cites W1574152255 @default.
• W2016112110 cites W1577834054 @default.
• W2016112110 cites W1589290041 @default.
• W2016112110 cites W1634873152 @default.
• W2016112110 cites W1670133851 @default.
• W2016112110 cites W1750871115 @default.
• W2016112110 cites W176537008 @default.
• W2016112110 cites W1787891616 @default.
• W2016112110 cites W1812339273 @default.
• W2016112110 cites W1932052686 @default.
• W2016112110 cites W1939366980 @default.
• W2016112110 cites W1966669442 @default.
• W2016112110 cites W1975085160 @default.
• W2016112110 cites W1976569360 @default.
• W2016112110 cites W1981626133 @default.
• W2016112110 cites W1989163142 @default.
• W2016112110 cites W2004643730 @default.
• W2016112110 cites W2007376825 @default.
• W2016112110 cites W2011899941 @default.
• W2016112110 cites W2013127767 @default.
• W2016112110 cites W2023893656 @default.
• W2016112110 cites W2027468734 @default.
• W2016112110 cites W2031796366 @default.
• W2016112110 cites W2036243377 @default.
• W2016112110 cites W2041923914 @default.
• W2016112110 cites W2047219099 @default.
• W2016112110 cites W2052413028 @default.
• W2016112110 cites W2057331661 @default.
• W2016112110 cites W2060888487 @default.
• W2016112110 cites W2073957352 @default.
• W2016112110 cites W2087936545 @default.
• W2016112110 cites W2091556637 @default.
• W2016112110 cites W2100837269 @default.
• W2016112110 cites W2127112944 @default.
• W2016112110 cites W2134760874 @default.
• W2016112110 cites W2143404508 @default.
• W2016112110 cites W2145352278 @default.
• W2016112110 cites W2220795605 @default.
• W2016112110 cites W2231614804 @default.
• W2016112110 cites W2332470647 @default.
• W2016112110 cites W2344863420 @default.
• W2016112110 cites W4239669946 @default.
• W2016112110 cites W4242257013 @default.
• W2016112110 cites W4293247451 @default.
• W2016112110 cites W971382953 @default.
• W2016112110 doi "https://doi.org/10.1074/jbc.271.3.1717" @default.
• W2016112110 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/8576174" @default.
• W2016112110 hasPublicationYear "1996" @default.
• W2016112110 type Work @default.
• W2016112110 sameAs 2016112110 @default.
• W2016112110 citedByCount "46" @default.
• W2016112110 countsByYear W20161121102012 @default.
• W2016112110 countsByYear W20161121102013 @default.
• W2016112110 countsByYear W20161121102015 @default.
• W2016112110 countsByYear W20161121102016 @default.
• W2016112110 countsByYear W20161121102019 @default.
• W2016112110 countsByYear W20161121102020 @default.
• W2016112110 countsByYear W20161121102021 @default.
• W2016112110 countsByYear W20161121102023 @default.
• W2016112110 crossrefType "journal-article" @default.
• W2016112110 hasAuthorship W2016112110A5015095736 @default.
• W2016112110 hasAuthorship W2016112110A5039594754 @default.
• W2016112110 hasAuthorship W2016112110A5059998786 @default.
• W2016112110 hasBestOaLocation W20161121101 @default.
• W2016112110 hasConcept C165901193 @default.
• W2016112110 hasConcept C181199279 @default.
• W2016112110 hasConcept C185592680 @default.
• W2016112110 hasConcept C203014093 @default.
• W2016112110 hasConcept C2776225656 @default.
• W2016112110 hasConcept C2776863245 @default.
• W2016112110 hasConcept C2778491710 @default.
• W2016112110 hasConcept C28021979 @default.
• W2016112110 hasConcept C55493867 @default.
• W2016112110 hasConcept C86803240 @default.
• W2016112110 hasConcept C89423630 @default.
• W2016112110 hasConceptScore W2016112110C165901193 @default.
• W2016112110 hasConceptScore W2016112110C181199279 @default.
• W2016112110 hasConceptScore W2016112110C185592680 @default.
• W2016112110 hasConceptScore W2016112110C203014093 @default.
• W2016112110 hasConceptScore W2016112110C2776225656 @default.
• W2016112110 hasConceptScore W2016112110C2776863245 @default.
• W2016112110 hasConceptScore W2016112110C2778491710 @default.
• W2016112110 hasConceptScore W2016112110C28021979 @default.
• W2016112110 hasConceptScore W2016112110C55493867 @default.
• W2016112110 hasConceptScore W2016112110C86803240 @default.
• W2016112110 hasConceptScore W2016112110C89423630 @default.

• next