FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016199502> ?p ?o ?g. }

• W2016199502 endingPage "14309" @default.
• W2016199502 startingPage "14297" @default.
• W2016199502 abstract "A variety of cellular factors participates in the HIV-1 life cycle. Among them is the well characterized cyclin T1 (CYCT1). CycT1 binds to cyclin-dependent kinase 9 (CDK9) and forms the positive transcription elongation factor-b (P-TEFb). P-TEFb is then recruited by HIV-1 TAT to the HIV-1 long terminal repeat (LTR) promoter and subsequently leads to phosphorylation of the C-terminal domain of RNA polymerase II (pol II), enhanced processivity of pol II, and transcription of a full-length HIV-1 RNA. In this study, we report the identification of a new CYCT1 splice variant, designated as CYCT1b, and accordingly we renamed CYCT1 as CYCT1a. CYCT1b was detected in several cell lines, including primary human CD4 T cells, and its expression was subject to cell cycle regulation. Similar to CYCT1a, CYCT1b was primarily localized in the nucleus. CYCT1b expression was found to be inversely correlated with HIV-1 gene expression and replication. This inverse correlation appeared to involve TAT transactivation, CDK9 binding, and subsequent recruitment of P-TEFb to the HIV-1 LTR promoter and pol II C-terminal domain phosphorylation. In agreement with these findings, CYCT1b expression led to direct inhibition of TAT-transactivated transcription of the HIV-1 LTR promoter. Taken together, these results show that the newly identified CYCT1b splice variant inhibits HIV-1 transcription and may provide new clues for the development of anti-HIV strategies. A variety of cellular factors participates in the HIV-1 life cycle. Among them is the well characterized cyclin T1 (CYCT1). CycT1 binds to cyclin-dependent kinase 9 (CDK9) and forms the positive transcription elongation factor-b (P-TEFb). P-TEFb is then recruited by HIV-1 TAT to the HIV-1 long terminal repeat (LTR) promoter and subsequently leads to phosphorylation of the C-terminal domain of RNA polymerase II (pol II), enhanced processivity of pol II, and transcription of a full-length HIV-1 RNA. In this study, we report the identification of a new CYCT1 splice variant, designated as CYCT1b, and accordingly we renamed CYCT1 as CYCT1a. CYCT1b was detected in several cell lines, including primary human CD4 T cells, and its expression was subject to cell cycle regulation. Similar to CYCT1a, CYCT1b was primarily localized in the nucleus. CYCT1b expression was found to be inversely correlated with HIV-1 gene expression and replication. This inverse correlation appeared to involve TAT transactivation, CDK9 binding, and subsequent recruitment of P-TEFb to the HIV-1 LTR promoter and pol II C-terminal domain phosphorylation. In agreement with these findings, CYCT1b expression led to direct inhibition of TAT-transactivated transcription of the HIV-1 LTR promoter. Taken together, these results show that the newly identified CYCT1b splice variant inhibits HIV-1 transcription and may provide new clues for the development of anti-HIV strategies. Human immunodeficiency virus type 1 (HIV-1) is the causative agent of acquired immunodeficiency syndrome (AIDS). Currently, there are an estimated 33.3 million people around the world under the threat of this virus, according to the annual reports from the World Health Organization. Currently, there is no practical vaccine available for HIV-1, and treatment of its infection is primarily based on antiretroviral drugs that include nucleoside/nucleotide reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, fusion or entry inhibitors, and integrase inhibitors. These drugs are designed to interfere with multiple steps during the HIV-1 life cycle by targeting the viral components of HIV-1. Alternatively, in the past 20 years a large number of host cellular factors were discovered to be involved in the regulation of its life cycle, thereby becoming potential targets for HIV-1 therapeutics. Subsequently, interactions between host cellular factors and viral proteins or DNA/RNA elements have recently been considered progressively more important in the regulation of HIV-1 replication. In latent HIV-1 infection, the genomic RNA is reverse-transcribed and integrated into the host genome. Upon activation by TAT/TAR 3The abbreviations used are TARtrans-activating response elementCTDC-terminal domainCycT1cyclin T1CDK9cyclin-dependent kinase 9ADactivation domainBDbinding domainpolpolymerasem.o.i.multiplicity of infectionP-TEFbpositive transcription elongation factor b./P-TEFb, the HIV-1 RNA is transcribed and introduced into the general RNA metabolism. However, this viral RNA is distinguishable from host RNA due to the presence of introns and other cis-elements, leading to occasional specific regulation by host factors. During the activation of HIV-1 transcription from the genome, several transcription factors are recruited to the LTR promoter to initiate basic transcription, including NFκB, often considered the most important factor (1Rohr O. Marban C. Aunis D. Schaeffer E. Regulation of HIV-1 gene transcription: from lymphocytes to microglial cells.J. Leukocyte Biol. 2003; 74: 736-749Crossref PubMed Scopus (112) Google Scholar, 2Hiscott J. Kwon H. Génin P. Hostile takeovers: viral appropriation of the NF-κB pathway.J. Clin. Invest. 2001; 107: 143-151Crossref PubMed Scopus (506) Google Scholar). Following sufficient induction of protein expression, TAT binds to the TAR RNA and recruits P-TEFb to stimulate viral transcription (3Wei P. Garber M.E. Fang S.M. Fischer W.H. Jones K.A. A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high affinity, loop-specific binding to TAR RNA.Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar). HIV-1 RNA is alternatively spliced into three groups as follows: 2 kb of fully spliced mRNAs, 4 kb of incompletely spliced mRNAs, and 9 kb of unspliced genomic RNA (4Purcell D.F. Martin M.A. Alternative splicing of human immunodeficiency virus type 1 mRNA modulates viral protein expression, replication, and infectivity.J. Virol. 1993; 67: 6365-6378Crossref PubMed Google Scholar). Cellular splicing factors, including SR proteins and heterogeneous nuclear ribonucleoprotein family members, are involved in this process and play alternative roles in the splicing of HIV-1 RNA (5Jablonski J.A. Caputi M. Role of cellular RNA processing factors in human immunodeficiency virus type 1 mRNA metabolism, replication, and infectivity.J. Virol. 2009; 83: 981-992Crossref PubMed Scopus (77) Google Scholar). Exports of unspliced or incompletely spliced mRNAs are usually blocked by cellular factors encoded by eukaryotic cells. The HIV-1 REV protein may recognize the REV response element on these “immature” mRNAs, allowing them to be exported to the cytoplasm through the CRM-1 pathway (6Bogerd H.P. Echarri A. Ross T.M. Cullen B.R. Inhibition of human immunodeficiency virus Rev and human T-cell leukemia virus Rex function, but not Mason-Pfizer monkey virus constitutive transport element activity, by a mutant human nucleoporin targeted to Crm1.J. Virol. 1998; 72: 8627-8635Crossref PubMed Google Scholar). Cellular factors, such as eIF5A, SAM68, DDX1, and DDX3, are implicated in the mRNA export process mediated by REV (7Bevec D. Jaksche H. Oft M. Wöhl T. Himmelspach M. Pacher A. Schebesta M. Koettnitz K. Dobrovnik M. Csonga R. Lottspeich F. Hauber J. Inhibition of HIV-1 replication in lymphocytes by mutants of the Rev cofactor eIF-5A.Science. 1996; 271: 1858-1860Crossref PubMed Scopus (182) Google Scholar, 8Fang J. Kubota S. Yang B. Zhou N. Zhang H. Godbout R. Pomerantz R.J. A DEAD box protein facilitates HIV-1 replication as a cellular co-factor of Rev.Virology. 2004; 330: 471-480Crossref PubMed Scopus (135) Google Scholar, 9Li J. Liu Y. Kim B.O. He J.J. Direct participation of Sam68, the 68-kilodalton Src-associated protein in mitosis, in the CRM1-mediated Rev nuclear export pathway.J. Virol. 2002; 76: 8374-8382Crossref PubMed Scopus (56) Google Scholar, 10Yedavalli V.S. Neuveut C. Chi Y.H. Kleiman L. Jeang K.T. Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function.Cell. 2004; 119: 381-392Abstract Full Text Full Text PDF PubMed Scopus (414) Google Scholar). When the mature and immature mRNAs are exported into the cytoplasm, cellular translation initiation factors and ribosomes bind to the m7-pppG structure resulting in ribosome scanning. A few cellular factors specifically regulate HIV-1 translation. For example, DDX3 has been reported to stimulate general translation through the interaction with the translation initiation factor eIF3, and it may also enhance HIV-1 internal ribosome entry site-mediated translation to a significantly higher level (11Lee C.S. Dias A.P. Jedrychowski M. Patel A.H. Hsu J.L. Reed R. Human DDX3 functions in translation and interacts with the translation initiation factor eIF3.Nucleic Acids Res. 2008; 36: 4708-4718Crossref PubMed Scopus (138) Google Scholar, 12Liu J. Henao-Mejia J. Liu H. Zhao Y. He J.J. Translational regulation of HIV-1 replication by HIV-1 Rev cellular cofactors Sam68, eIF5A, hRIP, and DDX3.J. Neuroimmune Pharmacol. 2011; 6: 308-321Crossref PubMed Scopus (53) Google Scholar). Our previous work on SAM68 has shown that it specifically enhances the translation of Nef mRNA and is involved in the genome-wide translation control of HIV-1 genes (12Liu J. Henao-Mejia J. Liu H. Zhao Y. He J.J. Translational regulation of HIV-1 replication by HIV-1 Rev cellular cofactors Sam68, eIF5A, hRIP, and DDX3.J. Neuroimmune Pharmacol. 2011; 6: 308-321Crossref PubMed Scopus (53) Google Scholar, 13Henao-Mejia J. Liu Y. Park I.W. Zhang J. Sanford J. He J.J. Suppression of HIV-1 Nef translation by Sam68 mutant-induced stress granules and nef mRNA sequestration.Mol. Cell. 2009; 33: 87-96Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). trans-activating response element C-terminal domain cyclin T1 cyclin-dependent kinase 9 activation domain binding domain polymerase multiplicity of infection positive transcription elongation factor b. P-TEFb is the key factor regulating eukaryotic mRNA transcription at the level of elongation (14Marshall N.F. Price D.H. Purification of P-TEFb, a transcription factor required for the transition into productive elongation.J. Biol. Chem. 1995; 270: 12335-12338Abstract Full Text Full Text PDF PubMed Scopus (422) Google Scholar, 15Marshall N.F. Peng J. Xie Z. Price D.H. Control of RNA polymerase II elongation potential by a novel carboxyl-terminal domain kinase.J. Biol. Chem. 1996; 271: 27176-27183Abstract Full Text Full Text PDF PubMed Scopus (525) Google Scholar). It is composed of CDK9 and one of the three cyclins as follows: T1, T2 (T2a and T2b), or K (16Peng J. Zhu Y. Milton J.T. Price D.H. Identification of multiple cyclin subunits of human P-TEFb.Genes Dev. 1998; 12: 755-762Crossref PubMed Scopus (450) Google Scholar), of which only the primary cyclin partner of CDK9, cyclin T1, is able to support HIV-1 TAT-mediated transactivation (3Wei P. Garber M.E. Fang S.M. Fischer W.H. Jones K.A. A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high affinity, loop-specific binding to TAR RNA.Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar). Once TAT protein is expressed through basic transcription and translation, it binds to the HIV-1 TAR structure and recruits P-TEFb to the viral promoter for transcriptional activation (17Mancebo H.S. Lee G. Flygare J. Tomassini J. Luu P. Zhu Y. Peng J. Blau C. Hazuda D. Price D. Flores O. P-TEFb kinase is required for HIV Tat transcriptional activation in vivoin vitro.Genes Dev. 1997; 11: 2633-2644Crossref PubMed Scopus (479) Google Scholar, 18Zhu Y. Pe'ery T. Peng J. Ramanathan Y. Marshall N. Marshall T. Amendt B. Mathews M.B. Price D.H. Transcription elongation factor P-TEFb is required for HIV-1 tat transactivation in vitro.Genes Dev. 1997; 11: 2622-2632Crossref PubMed Scopus (611) Google Scholar, 19Gold M.O. Yang X. Herrmann C.H. Rice A.P. PITALRE, the catalytic subunit of TAK, is required for human immunodeficiency virus Tat transactivation in vivo.J. Virol. 1998; 72: 4448-4453Crossref PubMed Google Scholar). The activated cyclin-dependent kinase complex, P-TEFb, then phosphorylates negative elongation factors, i.e. DSIF and NELF, and serine 2 on the C-terminal domain (CTD) of the RNA polymerase II (pol II) large subunit (20Price D.H. P-TEFb, a cyclin-dependent kinase controlling elongation by RNA polymerase II.Mol. Cell. Biol. 2000; 20: 2629-2634Crossref PubMed Scopus (568) Google Scholar, 21Kim J.B. Sharp P.A. Positive transcription elongation factor B phosphorylates hSPT5 and RNA polymerase II carboxyl-terminal domain independently of cyclin-dependent kinase-activating kinase.J. Biol. Chem. 2001; 276: 12317-12323Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). P-TEFb (CYCT1/CDK9) is incorporated into two super complex forms as follows: 1) the catalytically inactive form, 7SK snRNP, which also contains 7SK snRNA, HEXIM1/2, LARP7, and MePCE (22Nguyen V.T. Kiss T. Michels A.A. Bensaude O. 7SK small nuclear RNA binds to and inhibits the activity of CDK9/cyclin T complexes.Nature. 2001; 414: 322-325Crossref PubMed Scopus (553) Google Scholar, 23Yik J.H. Chen R. Nishimura R. Jennings J.L. Link A.J. Zhou Q. Inhibition of P-TEFb (CDK9/cyclin T) kinase and RNA polymerase II transcription by the coordinated actions of HEXIM1 and 7SK snRNA.Mol. Cell. 2003; 12: 971-982Abstract Full Text Full Text PDF PubMed Scopus (378) Google Scholar, 24Jeronimo C. Forget D. Bouchard A. Li Q. Chua G. Poitras C. Thérien C. Bergeron D. Bourassa S. Greenblatt J. Chabot B. Poirier G.G. Hughes T.R. Blanchette M. Price D.H. Coulombe B. Systematic analysis of the protein interaction network for the human transcription machinery reveals the identity of the 7SK capping enzyme.Mol. Cell. 2007; 27: 262-274Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar, 25He N. Jahchan N.S. Hong E. Li Q. Bayfield M.A. Maraia R.J. Luo K. Zhou Q. A La-related protein modulates 7SK snRNP integrity to suppress P-TEFb-dependent transcriptional elongation and tumorigenesis.Mol. Cell. 2008; 29: 588-599Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar); and 2) the active form, called the super elongation complex, which includes ELL2 and the transcription factors/activators ENL, AF9, AFF4, AFF1, and MLLT1/3 (26Dhillon S. Witteveldt J. Gatherer D. Owsianka A.M. Zeisel M.B. Zahid M.N. Rychl̸owska M. Foung S.K. Baumert T.F. Angus A.G. Patel A.H. Mutations within a conserved region of the hepatitis C virus E2 glycoprotein that influence virus-receptor interactions and sensitivity to neutralizing antibodies.J. Virol. 2010; 84: 5494-5507Crossref PubMed Scopus (55) Google Scholar, 27Lin C. Smith E.R. Takahashi H. Lai K.C. Martin-Brown S. Florens L. Washburn M.P. Conaway J.W. Conaway R.C. Shilatifard A. AFF4, a component of the ELL/P-TEFb elongation complex and a shared subunit of MLL chimeras, can link transcription elongation to leukemia.Mol. Cell. 2010; 37: 429-437Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar, 28Mueller D. Bach C. Zeisig D. Garcia-Cuellar M.P. Monroe S. Sreekumar A. Zhou R. Nesvizhskii A. Chinnaiyan A. Hess J.L. Slany R.K. A role for the MLL fusion partner ENL in transcriptional elongation and chromatin modification.Blood. 2007; 110: 4445-4454Crossref PubMed Scopus (293) Google Scholar, 29Shilatifard A. Duan D.R. Haque D. Florence C. Schubach W.H. Conaway J.W. Conaway R.C. ELL2, a new member of an ELL family of RNA polymerase II elongation factors.Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 3639-3643Crossref PubMed Scopus (108) Google Scholar, 30Sobhian B. Laguette N. Yatim A. Nakamura M. Levy Y. Kiernan R. Benkirane M. HIV-1 Tat assembles a multifunctional transcription elongation complex and stably associates with the 7SK snRNP.Mol. Cell. 2010; 38: 439-451Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 31Benedikt A. Baltruschat S. Scholz B. Bursen A. Arrey T.N. Meyer B. Varagnolo L. Müller A.M. Karas M. Dingermann T. Marschalek R. The leukemogenic AF4-MLL fusion protein causes P-TEFb kinase activation and altered epigenetic signatures.Leukemia. 2011; 25: 135-144Crossref PubMed Scopus (63) Google Scholar). A number of other P-TEFb-binding proteins were identified (30Sobhian B. Laguette N. Yatim A. Nakamura M. Levy Y. Kiernan R. Benkirane M. HIV-1 Tat assembles a multifunctional transcription elongation complex and stably associates with the 7SK snRNP.Mol. Cell. 2010; 38: 439-451Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar, 32Ramakrishnan R. Liu H. Donahue H. Malovannaya A. Qin J. Rice A.P. Identification of novel CDK9 and cyclin T1-associated protein complexes (CCAPs) whose siRNA depletion enhances HIV-1 Tat function.Retrovirology. 2012; 9: 90Crossref PubMed Scopus (16) Google Scholar, 33Chou S. Upton H. Bao K. Schulze-Gahmen U. Samelson A.J. He N. Nowak A. Lu H. Krogan N.J. Zhou Q. Alber T. HIV-1 Tat recruits transcription elongation factors dispersed along a flexible AFF4 scaffold.Proc. Natl Acad. Sci. U.S.A. 2013; 110: E123-E131Crossref PubMed Scopus (60) Google Scholar). HIV-1 TAT triggers the release of P-TEFb from the 7SK snRNP in vitro and in vivo, resulting in the activation of P-TEFb by TAT (34Schulte A. Czudnochowski N. Barboric M. Schönichen A. Blazek D. Peterlin B.M. Geyer M. Identification of a cyclin T-binding domain in Hexim1 and biochemical analysis of its binding competition with HIV-1 Tat.J. Biol. Chem. 2005; 280: 24968-24977Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 35Sedore S.C. Byers S.A. Biglione S. Price J.P. Maury W.J. Price D.H. Manipulation of P-TEFb control machinery by HIV: recruitment of P-TEFb from the large form by Tat and binding of HEXIM1 to TAR.Nucleic Acids Res. 2007; 35: 4347-4358Crossref PubMed Scopus (119) Google Scholar). Other than HIV-1 TAT, several other sequence-specific activators, such as BRD4, NFκB, c-Myc, and CIITA, have been reported to interact with P-TEFb and contribute to the activation of transcription elongation (36Barboric M. Nissen R.M. Kanazawa S. Jabrane-Ferrat N. Peterlin B.M. NF-κB binds P-TEFb to stimulate transcriptional elongation by RNA polymerase II.Mol. Cell. 2001; 8: 327-337Abstract Full Text Full Text PDF PubMed Scopus (355) Google Scholar, 37Eberhardy S.R. Farnham P.J. c-Myc mediates activation of the cad promoter via a post-RNA polymerase II recruitment mechanism.J. Biol. Chem. 2001; 276: 48562-48571Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar, 38Kanazawa S. Okamoto T. Peterlin B.M. Tat competes with CIITA for the binding to P-TEFb and blocks the expression of MHC class II genes in HIV infection.Immunity. 2000; 12: 61-70Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 39Jang M.K. Mochizuki K. Zhou M. Jeong H.S. Brady J.N. Ozato K. The bromodomain protein Brd4 is a positive regulatory component of P-TEFb and stimulates RNA polymerase II-dependent transcription.Mol. Cell. 2005; 19: 523-534Abstract Full Text Full Text PDF PubMed Scopus (917) Google Scholar). Currently, three cyclin T isoforms (CYCT1, CYCT2a, and CYCT2b) have been identified to be associated with CDK9 to constitute the P-TEFb complex (16Peng J. Zhu Y. Milton J.T. Price D.H. Identification of multiple cyclin subunits of human P-TEFb.Genes Dev. 1998; 12: 755-762Crossref PubMed Scopus (450) Google Scholar). CYCT1 is an approximate 86-kDa protein, found in 80% of human P-TEFb heterodimers, and is the only cyclin that can bind to TAT to support HIV-1 transcription (3Wei P. Garber M.E. Fang S.M. Fischer W.H. Jones K.A. A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high affinity, loop-specific binding to TAR RNA.Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar, 20Price D.H. P-TEFb, a cyclin-dependent kinase controlling elongation by RNA polymerase II.Mol. Cell. Biol. 2000; 20: 2629-2634Crossref PubMed Scopus (568) Google Scholar). P-TEFb is believed to play a general role in transcription, because its inhibition affects a vast majority of cellular genes in uninfected cells (40Chao S.H. Price D.H. Flavopiridol inactivates P-TEFb and blocks most RNA polymerase II transcription in vivo.J. Biol. Chem. 2001; 276: 31793-31799Abstract Full Text Full Text PDF PubMed Scopus (543) Google Scholar). P-TEFb, containing CYCT1 or CYCT2, is recruited by different transcriptional activators to stimulate the expression of various genes (38Kanazawa S. Okamoto T. Peterlin B.M. Tat competes with CIITA for the binding to P-TEFb and blocks the expression of MHC class II genes in HIV infection.Immunity. 2000; 12: 61-70Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 41Lee D.K. Duan H.O. Chang C. Androgen receptor interacts with the positive elongation factor P-TEFb and enhances the efficiency of transcriptional elongation.J. Biol. Chem. 2001; 276: 9978-9984Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 42Simone C. Stiegler P. Bagella L. Pucci B. Bellan C. De Falco G. De Luca A. Guanti G. Puri P.L. Giordano A. Activation of MyoD-dependent transcription by cdk9/cyclin T2.Oncogene. 2002; 21: 4137-4148Crossref PubMed Scopus (99) Google Scholar, 43Tian Y. Ke S. Chen M. Sheng T. Interactions between the aryl hydrocarbon receptor and P-TEFb. Sequential recruitment of transcription factors and differential phosphorylation of C-terminal domain of RNA polymerase II at cyp1a1 promoter.J. Biol. Chem. 2003; 278: 44041-44048Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). It was revealed by microarray analysis that there was limited redundancy in the genes regulated by either CYCT1 or CYCT2 (44Ramakrishnan R. Yu W. Rice A.P. Limited redundancy in genes regulated by cyclin T2 and cyclin T1.BMC Res. Notes. 2011; 4: 260Crossref PubMed Scopus (11) Google Scholar). The human CYCT1 gene has been mapped to human chromosome 12, with four transcripts of different sizes detected by Northern blot analysis, indicating that CYCT1 mRNA may be alternatively transcribed or spliced (3Wei P. Garber M.E. Fang S.M. Fischer W.H. Jones K.A. A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high affinity, loop-specific binding to TAR RNA.Cell. 1998; 92: 451-462Abstract Full Text Full Text PDF PubMed Scopus (1048) Google Scholar, 16Peng J. Zhu Y. Milton J.T. Price D.H. Identification of multiple cyclin subunits of human P-TEFb.Genes Dev. 1998; 12: 755-762Crossref PubMed Scopus (450) Google Scholar). However, there are no data yet available on the alternative splicing product of CYCT1 or the post-transcriptional regulation of CYCT1 variants. In this study, we identified a novel transcript of CYCT1, which we named CYCT1b. This novel transcript is an antagonist of CYCT1a (formerly CYCT1), resulting in inhibition of TAT-mediated LTR transactivation. Mechanistically, we demonstrate that CYCT1b competes with CYCT1a for binding to CDK9, thereby interfering with the hyperphosphorylation of RNA polymerase II, resulting in the suppression of transcriptional elongation. 293T, HeLa, and Jurkat cells were obtained from American Tissue Culture Collection (ATCC, Manassas, VA) and maintained in Dulbecco's modified Eagle's medium (DMEM) or Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% fetal bovine serum (Hyclone, Logan, UT) and 1% (v/v) penicillin and streptomycin (CellGro, Manassas, VA) at 37 °C with 5% CO2. For transfection with DNA only, 293T cells were transfected by the standard calcium phosphate method as described previously (45Liu Y. Li J. Kim B.O. Pace B.S. He J.J. HIV-1 Tat protein-mediated transactivation of the HIV-1 long terminal repeat promoter is potentiated by a novel nuclear Tat-interacting protein of 110 kDa, Tip110.J. Biol. Chem. 2002; 277: 23854-23863Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar); for transfection with RNA only or together with DNA, 293T cells were transfected with Lipofectamine 2000, according to the manufacturer's instructions (Invitrogen). Transfection medium was replaced with fresh medium containing the same supplements 6 h post-transfection and the cells were harvested for the following: protein analysis by Western blot or immunoprecipitation followed by Western blot; analysis of luciferase reporter gene activity; or isolation of total RNA and RNA analysis by reverse transcription-PCR (RT-PCR). In all transfections, pcDNA3 was used to equalize the amount of total transfected DNA. Plasmids pNL4-3, pLTR.luc, pMyc.Tat, HIVdGless have been described elsewhere (46Liu Y. Jones M. Hingtgen C.M. Bu G. Laribee N. Tanzi R.E. Moir R.D. Nath A. He J.J. Uptake of HIV-1 Tat protein mediated by low-density lipoprotein receptor-related protein disrupts the neuronal metabolic balance of the receptor ligands.Nat. Med. 2000; 6: 1380-1387Crossref PubMed Scopus (330) Google Scholar, 47Montanuy I. Torremocha R. Hernández-Munain C. Suñé C. Promoter influences transcription elongation: TATA-box element mediates the assembly of processive transcription complexes responsive to cyclin-dependent kinase 9.J. Biol. Chem. 2008; 283: 7368-7378Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). pMyc.CycT1b was constructed using standard cloning methods with the primers (Myc.CycT1b5, 5′-GCG AAT TCT GGA GGG AGA GAG GAA GAA C-3′, EcoRI site underlined; Myc.CycT1b3, 5′-GCG GTA CCT CAT GTG TCA GTT CTG TTG G-3′, KpnI site underlined) to amplify the CYCT1b coding sequence to insert into pCMV-myc (Clontech). pGFP.CycT1b was constructed by creating a single mutated site in the CYCT1b coding sequence, by deletion of the 10th base (guanine in italics) in the primer Myc.CycT1b5, and inserting it into the EcoRI and KpnI sites of peGFP-C1 (Clontech). pET.CycT1b was constructed by inserting CYCT1b coding sequence into EcoRI and SalI sites of pET28a (Clontech) vector using primers 5′-GCG AAT TCG AGG GAG AGA GGA AGA AC-3′ and 5′-GCG TCG ACT CAT GTG TCA GTT CTG TTG G-3′. To construct pLL.GFP-CycT1b, overlapping PCR was performed to obtain GFP.CYCT1b fusion coding sequence with primers 5′-CTA GCT AGC GCT ACC GGT CG-3′, 5′-GTT CTT CCT CTC TCC CTC CTT GTA CAG CTC GTC CAT GC-3′, 5′-GCA TGG ACG AGC TGT ACA AGG AGG GAG AGA GGA AGA AC-3′, and 5′-GCG AAT TCT CAT GTG TCA GTT CTG TTG G-3′; then the coding sequence was inserted into the NheI and EcoRI sites of pLentilox3.7 (Invitrogen). pLL.GFP was constructed on the pLentilox3.7 backbone to express GFP and was included as the control. GFP-CYCT1b-expressing lentiviruses were packaged in 293T cells by co-transfection with pLL.GFP-CycT1b (4 μg)/pLentilox3.7 (4 μg) and pLP1 (2 μg), pLP2 (2 μg), and pVSV-G (2 μg) helper plasmids. Forty eight hours post-medium change, cell culture supernatants were collected, filtered, and saved as lentivirus stock. GFP-expressing lentiviruses were similarly prepared using pLL.GFP plasmid. HIV-1 NL4-3 viruses were prepared in 293T cells as described previously (48He J. Chen Y. Farzan M. Choe H. Ohagen A. Gartner S. Busciglio J. Yang X. Hofmann W. Newman W. Mackay C.R. Sodroski J. Gabuzda D. CCR3 and CCR5 are co-receptors for HIV-1 infection of microglia.Nature. 1997; 385: 645-649Crossref PubMed Scopus (818) Google Scholar). Viruses were titered by infecting 293T or Ghost.CXCR4 cell lines. Jurkat cells were first transduced with lentiviruses (m.o.i. = 0.5) for 30 h and then infected with HIV-1 NL4-3 virus (m.o.i. = 1). The cultures were cultured for 7 more days and then harvested for cell lysates and Western blotting. Cell culture supernatants were collected for p24 ELISA. All transductions and infections were performed in the presence of 8 μg/ml Polybrene. Total RNA was extracted from 293T cells or HeLa cells using the TRIzol reagent (Invitrogen), according to the manufacturer's instructions. For CycT1 transcript amplification, 200 ng of total mRNA was used as a template for RT-PCR with primers 5′-GCG AAT TCA TGG AGG GAG AGA GGA AGA ACA A-3′ and 5′-GCG TCG ACT TAC TTA GGA AGG GGT GGA AT-3′. For simultaneous detection of CycT1a/CycT1b transcripts, 50 ng of total RNA was reverse-transcribed and PCR-amplified with the CycT1 primers (5′-CTT CAC ACA GTT CCC TGG AAA TTC TG and 5′-AGG CAC TGC ACT TGT GGT AG-3′) using the Titan One Tube RT-PCR system (Roche Diagnostics). For CycT1a detection, primers used were as follows: 5′-CCT GCA TTT GAC CAC ATT TAG C-3′ and 5′-CAT CTA AAA GTT CCA AGG TCA CA-3′. For CycT1b detection, primers were 5′-CTT ACT TCA TGG CAA CCA ACA GAA C-3′ and 5′-CTT GTG GTA GAA GTT GAC ATG CTC-3′. For analysis with the HIV-1 LTR-driven G-less transcription cassette, 200 ng of total RNA was used as the original template for RT-PCR, with the corresponding PCR primers as follows: 5′-CCC GAA TTC GGG TCT CTC TGG TTA GAC CAG ATC TGA GCC TGG GAG CTC-3′ and 5′-AAA ACC AAA CCC TGC GCT CCA TCG CCA-3′; 5′-GCG AGG CAT AAA GTT GCG TGT-3′ and 5′-AGG AGG GAG TGA GGA GAG GAT-3′. The GAPDH mRNA level was detected by RT-PCR in each experiment to normalize the total mRNA input, with the primers 5′-GAA AGG TGA AGG TCG GAG T-3′ and 5′-GAA GAT GGT GAT GGG ATT TC-3′. The expression level of CycT1-dependent genes was detected by SYBR Green (Roche Applied Science) qRT-PCR with primers listed in Table 1.TABLE 1Sequences of primers used for qRT-PCR analysisPrimersSequence (5′–3′)Cyp1a1-RT, FGTCATCTGTGCCATTTGCTTTGCyp1a1-RT, RCAACCACCTCCCCGAAATTATTBAMB1-RT, FCGCCACTCCAGCTACATCTTBAMB1-RT, RCAGATGTCTGTCGTGCTTGCIL-8-RT, FGCCATAAAGTCAAATTTAGCTGGAAIL-8-RT, RGTGCTTCCACATGTCCTCACAEIF4EBP2-RT, FCGCAGCTACCTCATGACTATEIF4EBP2-RT, RTGTCATAAATGATTCGAGTTCCCAD-RT, FTAGTCCTTGGCTCTGGCGTCTACAD-RT, RTAGTCGGTGCTGACTGTCTCTGPSA-RT, FACTTCCTGTCCAAGCCAGTGGAPSA-RT, RCTGCACCTTGTATTCCAGGACC Open table in a new tab Briefly, cells were washed tw" @default.
• W2016199502 created "2016-06-24" @default.
• W2016199502 creator A5019190678 @default.
• W2016199502 creator A5023916267 @default.
• W2016199502 creator A5038329820 @default.
• W2016199502 creator A5069259820 @default.
• W2016199502 creator A5075711154 @default.
• W2016199502 creator A5087249396 @default.
• W2016199502 date "2013-05-01" @default.
• W2016199502 modified "2023-10-07" @default.
• W2016199502 title "Inhibition of HIV-1 Transcription and Replication by a Newly Identified Cyclin T1 Splice Variant" @default.
• W2016199502 cites W1593508376 @default.
• W2016199502 cites W1676133928 @default.
• W2016199502 cites W1880169023 @default.
• W2016199502 cites W1963855922 @default.
• W2016199502 cites W1971017211 @default.
• W2016199502 cites W1972674519 @default.
• W2016199502 cites W1973000551 @default.
• W2016199502 cites W1975799898 @default.
• W2016199502 cites W1977121504 @default.
• W2016199502 cites W1979316039 @default.
• W2016199502 cites W1991749307 @default.
• W2016199502 cites W1992127633 @default.
• W2016199502 cites W1997057200 @default.
• W2016199502 cites W2000832682 @default.
• W2016199502 cites W2001859214 @default.
• W2016199502 cites W2002626257 @default.
• W2016199502 cites W2003168089 @default.
• W2016199502 cites W2014017310 @default.
• W2016199502 cites W2019264370 @default.
• W2016199502 cites W2020329201 @default.
• W2016199502 cites W2020911849 @default.
• W2016199502 cites W2023340785 @default.
• W2016199502 cites W2033680244 @default.
• W2016199502 cites W2037131892 @default.
• W2016199502 cites W2045090138 @default.
• W2016199502 cites W2046854154 @default.
• W2016199502 cites W2049972435 @default.
• W2016199502 cites W2051598492 @default.
• W2016199502 cites W2051789054 @default.
• W2016199502 cites W2054621186 @default.
• W2016199502 cites W2063738914 @default.
• W2016199502 cites W2068880841 @default.
• W2016199502 cites W2071324073 @default.
• W2016199502 cites W2077827918 @default.
• W2016199502 cites W2078188527 @default.
• W2016199502 cites W2079489048 @default.
• W2016199502 cites W2081567150 @default.
• W2016199502 cites W2082788072 @default.
• W2016199502 cites W2085593164 @default.
• W2016199502 cites W2088744356 @default.
• W2016199502 cites W2089566716 @default.
• W2016199502 cites W2090077122 @default.
• W2016199502 cites W2092340900 @default.
• W2016199502 cites W2101696954 @default.
• W2016199502 cites W2108422586 @default.
• W2016199502 cites W2109664852 @default.
• W2016199502 cites W2117789816 @default.
• W2016199502 cites W2119747629 @default.
• W2016199502 cites W2120285997 @default.
• W2016199502 cites W2122380318 @default.
• W2016199502 cites W2124620363 @default.
• W2016199502 cites W2126730534 @default.
• W2016199502 cites W2128431731 @default.
• W2016199502 cites W2129313145 @default.
• W2016199502 cites W2135736528 @default.
• W2016199502 cites W2136823193 @default.
• W2016199502 cites W2139119391 @default.
• W2016199502 cites W2144838583 @default.
• W2016199502 cites W2145848202 @default.
• W2016199502 cites W2147884941 @default.
• W2016199502 cites W2148330261 @default.
• W2016199502 cites W2149232113 @default.
• W2016199502 cites W2155388660 @default.
• W2016199502 cites W2158433313 @default.
• W2016199502 cites W2158834742 @default.
• W2016199502 cites W2161041868 @default.
• W2016199502 cites W2163828429 @default.
• W2016199502 cites W2164609974 @default.
• W2016199502 cites W2165085742 @default.
• W2016199502 cites W2166586255 @default.
• W2016199502 cites W2168244966 @default.
• W2016199502 cites W2169117131 @default.
• W2016199502 cites W2322237813 @default.
• W2016199502 cites W4237014973 @default.
• W2016199502 doi "https://doi.org/10.1074/jbc.m112.438465" @default.
• W2016199502 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3656286" @default.
• W2016199502 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/23569210" @default.
• W2016199502 hasPublicationYear "2013" @default.
• W2016199502 type Work @default.
• W2016199502 sameAs 2016199502 @default.
• W2016199502 citedByCount "8" @default.
• W2016199502 countsByYear W20161995022015 @default.
• W2016199502 countsByYear W20161995022017 @default.
• W2016199502 countsByYear W20161995022018 @default.
• W2016199502 countsByYear W20161995022020 @default.
• W2016199502 countsByYear W20161995022022 @default.
• W2016199502 crossrefType "journal-article" @default.

• next