FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016211979> ?p ?o ?g. }

• W2016211979 endingPage "36551" @default.
• W2016211979 startingPage "36543" @default.
• W2016211979 abstract "Fungal infections arise frequently in immunocompromised patients, and sterol synthesis is a primary pathway targeted by antifungal drugs. In particular, the P450 protein Erg11/Cyp51 catalyzes a critical step in ergosterol synthesis, and the azole class of antifungal drugs inhibits Erg11. Dap1 is a heme-binding protein related to cytochrome b5 that activates Erg11, so that cells lacking Dap1 accumulate the Erg11 substrate and are hypersensitive to Erg11 inhibitors. Heme binding by Dap1 is crucial for its function, and point mutants in its heme-binding domain render Dap1 inactive for sterol biosynthesis and DNA damage resistance. Like Dap1, the human homologue, PGRMC1/Hpr6, also regulates sterol synthesis and DNA damage resistance. In the present study, we demonstrate that the Dap1 heme-1 domain is required for growth under conditions of low iron availability. Loss of Dap1 is suppressed by elevated levels of Erg11 but not by increased heme biosynthesis. Dap1 localizes to punctate cytoplasmic structures that co-fractionate with endosomes, and Dap1 contributes to the integrity of the vacuole. The results suggest that Saccharomyces cerevisiae Dap1 stimulates a P450-catalyzed step in sterol synthesis via a distinct localization from its homologues in Schizosaccharomyces pombe and mammals and that this function regulates iron metabolism. Fungal infections arise frequently in immunocompromised patients, and sterol synthesis is a primary pathway targeted by antifungal drugs. In particular, the P450 protein Erg11/Cyp51 catalyzes a critical step in ergosterol synthesis, and the azole class of antifungal drugs inhibits Erg11. Dap1 is a heme-binding protein related to cytochrome b5 that activates Erg11, so that cells lacking Dap1 accumulate the Erg11 substrate and are hypersensitive to Erg11 inhibitors. Heme binding by Dap1 is crucial for its function, and point mutants in its heme-binding domain render Dap1 inactive for sterol biosynthesis and DNA damage resistance. Like Dap1, the human homologue, PGRMC1/Hpr6, also regulates sterol synthesis and DNA damage resistance. In the present study, we demonstrate that the Dap1 heme-1 domain is required for growth under conditions of low iron availability. Loss of Dap1 is suppressed by elevated levels of Erg11 but not by increased heme biosynthesis. Dap1 localizes to punctate cytoplasmic structures that co-fractionate with endosomes, and Dap1 contributes to the integrity of the vacuole. The results suggest that Saccharomyces cerevisiae Dap1 stimulates a P450-catalyzed step in sterol synthesis via a distinct localization from its homologues in Schizosaccharomyces pombe and mammals and that this function regulates iron metabolism. Fungal infections are important clinically because they contribute to the mortality of patients with human immunodeficiency virus/AIDS, cancer, and other diseases associated with immunosuppression. Mammalian hosts combat fungal infections via the immune system and by sequestering free iron in the bloodstream. Fungal infections can be suppressed with the azole group of antifungal drugs, a commercially important group of drugs that includes fluconazole, itraconazole, and miconazole. These drugs inhibit Erg11/Cyp51/lanosterol demethylase (1Daum G. Lees N.D. Bard M. Dickson R. Yeast. 1998; 14: 1471-1510Crossref PubMed Scopus (529) Google Scholar, 2Lepesheva G.I. Waterman M.R. Biochim. Biophys. Acta. 2007; 1770: 467-477Crossref PubMed Scopus (333) Google Scholar), which catalyzes a critical step in the synthesis of ergosterol, a key component of the fungal cell membrane. Erg11 is one of a large class of monooxygenases that are called P450 proteins due to the spectral absorbance of a cysteine-linked heme molecule in their active site (3Hannemann F. Bichet A. Ewen K.M. Bernhardt R. Biochim. Biophys. Acta. 2007; 1770: 330-344Crossref PubMed Scopus (590) Google Scholar). In Saccharomyces cerevisiae, Erg11 is activated by Dap1 (damage resistance protein 1) (4Hand R.A. Jia N. Bard M. Craven R.J. Eukaryot. Cell. 2003; 2: 306-317Crossref PubMed Scopus (58) Google Scholar), which is related to cytochrome b5 (5Mifsud W. Bateman A. Genome Biol. 2002; 3: 1-5Crossref Google Scholar), a heme-binding protein that activates P450 reactions (3Hannemann F. Bichet A. Ewen K.M. Bernhardt R. Biochim. Biophys. Acta. 2007; 1770: 330-344Crossref PubMed Scopus (590) Google Scholar, 6Schenkman J.B. Jansson I. Pharmacol. Ther. 2003; 97: 139-152Crossref PubMed Scopus (383) Google Scholar). Cells lacking Dap1 partially arrest sterol synthesis at the stage catalyzed by Erg11 (4Hand R.A. Jia N. Bard M. Craven R.J. Eukaryot. Cell. 2003; 2: 306-317Crossref PubMed Scopus (58) Google Scholar), and dap1Δ cells are hypersensitive to the Erg11 inhibitors itraconazole and fluconazole (4Hand R.A. Jia N. Bard M. Craven R.J. Eukaryot. Cell. 2003; 2: 306-317Crossref PubMed Scopus (58) Google Scholar). According to microarray databases, DAP1 expression is induced by azole antifungal drugs (7Hughes T.R. Marton M.J. Jones A.R. Roberts C.J. Stoughton R. Armour C.D. Bennett H.A. Coffey E. Dai H. He Y.D. Kidd M.J. King A.M. Meyer M.R. Slade D. Lum P.Y. Stepaniants S.B. Shoemaker D.D. Gachotte D. Chakraburtty K. Simon J. Bard M. Friend S.H. Cell. 2000; 102: 109-126Abstract Full Text Full Text PDF PubMed Scopus (2110) Google Scholar), but this has not been independently confirmed. Azole sensitivity in dap1Δ cells is suppressed by overexpressing Erg11 (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar), and dap1Δ cells have ∼4-fold lower levels of Erg11 than wild-type cells (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar), although this regulation occurs primarily at the post-transcriptional level. Notably, the effect of Dap1 on sterol synthesis is conserved with its human homologue (9Hughes A.L. Powell D.W. Bard M. Eckstein J. Barbuch R. Link A.J. Espenshade P.J. Cell Metab. 2007; 5: 143-149Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar), called PGRMC1 (for progesterone receptor membrane component 1) or Hpr6 (for heme-1 domain protein/human progesterone receptor) (10Gerdes D. Wehling M. Leube B. Falkenstein E. Biol. Chem. 1998; 379: 907-911PubMed Google Scholar). Dap1 binds to heme (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar, 11Ghosh K. Thompson A.M. Goldbeck R.A. Shi X. Whitman S. Oh E. Zhiwu Z. Vulpe C. Holman T.R. Biochemistry. 2005; 44: 16729-16736Crossref PubMed Scopus (49) Google Scholar), as does its homologues in Schizisaccharomyces pombe, mice, and humans (9Hughes A.L. Powell D.W. Bard M. Eckstein J. Barbuch R. Link A.J. Espenshade P.J. Cell Metab. 2007; 5: 143-149Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar, 12Min L. Takemori H. Nonaka Y. Katoh Y. Doi J. Horike N. Osamu H. Raza F.S. Vinson G.P. Okamoto M. Mol. Cell Endocrinol. 2004; 215: 143-148Crossref PubMed Scopus (66) Google Scholar, 13Crudden G. Chitti R.E. Craven R.J. J. Pharmacol. Exp. Ther. 2006; 316: 448-455Crossref PubMed Scopus (57) Google Scholar). The heme-binding activity of Dap1 is critical for its function, and heme-binding defective mutants are inactive in sterol synthesis or damage resistance (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar). Furthermore, the damage sensitivity and sterol synthesis phenotypes of dap1Δ mutants can be suppressed by adding exogenous heme (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar), suggesting a role for Dap1 in maintaining heme metabolism. One appealing model for Dap1 family proteins is that they utilize their heme-binding activity to directly activate P450 proteins. However, unlike cytochromes and related proteins, Dap1 homologues lack the histidine residues that coordinate heme binding in cytochrome b5 (5Mifsud W. Bateman A. Genome Biol. 2002; 3: 1-5Crossref Google Scholar), suggesting that Dap1 may participate in intracellular heme trafficking. In addition to regulating ergosterol synthesis, Dap1 is required for resistance to the alkylating agent methyl methanesulfonate, and dap1Δ cells have decreased mitochondrial function (4Hand R.A. Jia N. Bard M. Craven R.J. Eukaryot. Cell. 2003; 2: 306-317Crossref PubMed Scopus (58) Google Scholar). Heme (iron protoporphyrin IX) is synthesized in an eight-step pathway that is subject to regulation at various steps (14Mense S.M. Zhang L. Cell Res. 2006; 16: 681-692Crossref PubMed Scopus (212) Google Scholar). Two key steps in heme synthesis are catalyzed by Hem1/5-aminolevulinate synthase, a mitochondrial protein, and Hem2/δ-aminolevulinate dehydratase/porphobilinogen synthase, which localizes to the cytoplasm and nucleus. Heme and ergosterol share the same upstream precursors (15Weinstein J.D. Branchaud R. Beale S.I. Bement W.J. Sinclair P.R. Arch. Biochem. Biophys. 1986; 245: 44-50Crossref PubMed Scopus (30) Google Scholar), and the synthesis of heme and ergosterol are closely synchronized. The Hap1 transcription factor (16Guarente L. Lalonde B. Gifford P. Alani E. Cell. 1984; 36: 503-511Abstract Full Text PDF PubMed Scopus (263) Google Scholar) is directly regulated by heme through a series of heme-regulated sequence motifs that control multiprotein complex formation and DNA binding (17Zhang L. Hach A. Cell Mol. Life Sci. 1999; 56: 415-426Crossref PubMed Scopus (152) Google Scholar). Heme is also required for the transcription of iron transport and sterol synthetic genes (18Crisp R.J. Pollington A. Galea C. Jaron S. Yamaguchi-Iwai Y. Kaplan J. J. Biol. Chem. 2003; 278: 45499-45506Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Iron levels, in turn, regulate the transcription, post-transcriptional stability, and post-translational levels of numerous genes and gene products (19Puig S. Askeland E. Thiele D.J. Cell. 2005; 120: 99-110Abstract Full Text Full Text PDF PubMed Scopus (321) Google Scholar, 20Shakoury-Elizeh M. Tiedeman J. Rashford J. Ferea T. Demeter J. Garcia E. Rolfes R. Brown P.O. Botstein D. Philpott C.C. Mol. Biol. Cell. 2004; 15: 1233-1243Crossref PubMed Scopus (168) Google Scholar, 21Felice M.R. De Domenico I. Li L. Ward D.M. Bartok B. Musci G. Kaplan J. J. Biol. Chem. 2005; 280: 22181-22190Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). One of the iron-regulated transcripts is DAP1, which is post-transcriptionally regulated by proteins that respond to low iron conditions (19Puig S. Askeland E. Thiele D.J. Cell. 2005; 120: 99-110Abstract Full Text Full Text PDF PubMed Scopus (321) Google Scholar). Because of the close relationship between iron metabolism and the synthesis of heme and ergosterol, we have examined the role of Dap1 in these processes. We have found that Dap1 regulates growth under low iron conditions through a mechanism that requires its heme-1 domain, and Dap1-mediated growth on low iron is mediated by Erg11. We have also shown that Dap1 localizes to endosomes and regulates the structure of the vacuole, which is characteristic of other sterol biosynthetic proteins. The results represent a novel function for the Dap1 family proteins, which include homologues in mammals that are important for sterol synthesis and in cancer. Yeast Strains and Growth Conditions—All strains were isogenic with W303 (leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 rad5-535) (22Thomas B.J. Rothstein R. Cell. 1989; 56: 619-630Abstract Full Text PDF PubMed Scopus (1355) Google Scholar). The rad5-535 allele was replaced with the wild-type RAD5 gene by crossing and tested by PCR as described (23Craven R.J. Petes T.D. Genetics. 2001; 158: 145-154PubMed Google Scholar). Cells were maintained yeast-peptone-dextrose (YPD) 2The abbreviations used are:YPDyeast-peptone-dextroseHAhemagglutininMOPS4-morpholinepropanesulfonic acidBPSbathophenanthroline disulfonic acidMMSmethyl methanesulfonate. or synthetic dextrose plates. Methyl methanesulfonate (Sigma) and bathophenanthroline disulfonic acid (Fisher) were added to plates at the indicated doses. For expression studies, log phase cultures were treated with itraconazole, methyl methanesulfonate, or hydroxyurea (all from Sigma) at the indicated doses. yeast-peptone-dextrose hemagglutinin 4-morpholinepropanesulfonic acid bathophenanthroline disulfonic acid methyl methanesulfonate The strains RCY409-2a (DAP1) and RCY409-4b (dap1Δ:: LEU2) and the RCY409-2a and RCY409-4b derivatives harboring the control (pRS313, YEplac181, or YEplac195), DAP1 (pRC41), DAP1-D91G (pRC39), or ERG11 (pRH4) plasmids have been described previously (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar). The pSCCC1 plasmid has also been described previously (24Chen O.S. Kaplan J. J. Biol. Chem. 2000; 275: 7626-7632Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). The dap1Δ::HIS3 strain RCY456 was constructed by one-step transplacement of the entire DAP1 gene with a PCR product containing HIS3 and DAP1-flanking homology. Oligonucleotide sequences are available as supplemental Fig. 1. For Dap1 expression studies, the DAP1 open reading frame was fused in frame with three copies of the HA epitope tag sequence by one-step integration of the epitope tag fused to the KanMX reporter gene. The HA tag sequence was amplified by PCR with the primers DAP1-TAGF and DAP1-TAGR, using the plasmid pFA6a-3HA-KanMX6 (25Longtine M.S. McKenzie 3rd, A. Demarini D.J. Shah N.G. Wach A. Brachat A. Philippsen P. Pringle J.R. Yeast. 1998; 14: 953-961Crossref PubMed Scopus (4193) Google Scholar) as a template. W303a cells were transformed with the resulting PCR product, and Geneticin-resistant isolates were tested for insertion of the epitope tag by PCR. The resulting strain, RCY172, was crossed to the strain RCY308-7b (α mec1-21 CAN1 RAD5) (26Craven R.J. Greenwell P.W. Dominska M. Petes T.D. Genetics. 2002; 161: 493-507Crossref PubMed Google Scholar), and the resulting diploid strain, RCY408, was sporulated and dissected, yielding the wild-type progeny RCY408-1d (α DAP1 CAN1 RAD5) and RCY408-4b (a DAP1 CAN1 RAD5) and the DAP1-HA derivatives RCY408-1b (a DAP1::3HA-KanMX CAN1 RAD5) and RCY408-5b (α DAP1::3HA-KanMX CAN1 RAD5). The two former strains were mated to produce the wild-type diploid RCY410, and the two latter strains produced the DAP1-HA diploid RCY411, which were used for immunofluorescence. For Erg11-Myc staining, RCY411 was transformed with pRH7 (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar), which encodes Erg11 fused to a single Myc epitope tag. All genetic manipulations were performed using standard conditions. Plasmids—The plasmid pJM63, encoding HEM1, was prepared by amplifying the entire HEM1 gene using the primers HEM1-300F-Bam and HEM1+1722R-Eco and subcloning the product into the plasmid YEplac195. Similarly, HEM2 was amplified with the primers HEM2-300F-Hind and HEM2+1028R-Eco and subcloned into YEplac195, forming the plasmid pJM64. For NSG1 overexpression, the entire NSG1 gene was amplified using the primers NSG1-300F and NSG1+873R-Myc and was initially subcloned into the PCR cloning plasmid pCR2.1, forming the plasmid pJM76. The NSG1 fragment was the liberated as a XhoI-BamHI fragment and subcloned into the SalI and BamHI sites of YEplac195, forming the plasmid pJM77. FET3 Promoter Assays—The FET3-lacZ plasmid, consisting of the FET3 promoter fused to lacZ in the plasmid YEp354, was the kind gift of Dr. Jerry Kaplan and has been described previously (27Li L. Kaplan J. J. Biol. Chem. 2001; 276: 5036-5043Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). For lacZ measurement, cells were grown in synthetic medium, with or without 100 μm bathophenanthroline disulfonic acid (BPS) for 3 h. The A600 was measured, and the cells were centrifuged and lysed with 250 μl of the Y-PER solution (Pierce), and the lysate was incubated with 700 μl of Z buffer (60 mm Na2HPO4-7H2O, 40 mm NaH2PO4-H2O, 10 mm KCl, 1 mm MgSO4, and 50 mm β-mercaptoethanol) containing 1 mg/ml o-nitrophenyl β-d-galactopyranoside. The reaction was stopped with 500 μl of 1 m Na2CO3, clarified by centrifugation, and measured at 420 nm, using the same concentrations of Y-PER, Z buffer, and Na2CO3 as a blank. Miller units ((A420 × 1000)/(A600/min/ml)) were calculated for each point. FET3 transcription was assayed independently by reverse transcription-PCR as described previously (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar) with the FET3 primers FET3+100F (ACAGGAACGTTGATGGGCTA) and FET3+380R (GAATGGTACCAGTAGGTGCC). Primers for the SCS2 transcript (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar) served as a control for loading and were included in the same reaction as for FET3, and the products were separated in 2% agarose. Assays for ferric reductase activity were performed as described previously (28Dancis A. Klausner R.D. Hinnebusch A.G. Barriocanal J.G. Mol. Cell Biol. 1990; 10: 2294-2301Crossref PubMed Scopus (257) Google Scholar). Protein Analysis—Log phase yeast cultures were lysed in Y-PER lysis solution (Pierce) containing 1 mm phenylmethylsulfonyl fluoride and 10 μg/ml aprotinin and analyzed essentially as described (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar). The antibody to HA (HA11) was from BabCo, and the antibody to α-tubulin was developed by J. Frankel and was obtained from the Developmental Studies Bank at the University of Iowa under the auspices of the NICHD, National Institutes of Health. For cell fractionation, cell fractions were separated by sucrose gradient essentially as described (29Kagiwada S. Hosaka K. Murata M. Nikawa J. Takatsuki A. J. Bacteriol. 1998; 180: 1700-1708Crossref PubMed Google Scholar). Briefly, 500 ml of log phase cells were arrested with the addition of 10 mm sodium azide, chilled on ice water, and then centrifuged at 4000 × g for 10 min. Cells were resuspended in spheroplasting buffer (1 m sorbitol, 100 mm Tris, pH 7.8, 10 mm EDTA, and 0.3 mg/ml zymolase) and incubated at 30 °C for 40 min. Spheroplasts were then centrifuged at 700 × g for 10 min and resuspended in 5 ml of lysis buffer (0.8 m sorbitol, 10 mm MOPS, pH 7.2, and 1 mm EGTA) containing 1 mm phenylmethylsulfonyl fluoride. The cells were then lysed with three 10-s pulses from a Polytron PT1200 homogenizer, and the homogenate was centrifuged at 2500 × g for 10 min to remove unlysed cells. One ml of the lysate was separated on a discontinuous 12-60% sucrose gradient by centrifugation at 100,000 × g for 16 h. at 4 °C. Fractions were collected and analyzed by Western blot using antibodies to the peroxisome marker Ypt7 (a kind gift from Dr. William Wickner), the mitochondrial marker Por1 (Molecular Probes), the lipid particle marker Erg6 (a kind gift from Dr. Gunther Daum), the endosomal marker Pep12 (Molecular Probes), the plasma membrane ATPase Pma1 (a kind gift from Dr. Ramon Serrano), and Erg11 (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar). Fluorescence—Staining was performed largely as described (29Kagiwada S. Hosaka K. Murata M. Nikawa J. Takatsuki A. J. Bacteriol. 1998; 180: 1700-1708Crossref PubMed Google Scholar). Log phase diploid cells were fixed with 3.7% formaldehyde at 37 °C for 30 min, centrifuged, resuspended in 1 m sorbitol containing 3.7% formaldehyde, and rotated at 4 °C overnight. Cells were spheroplasted in 1 m sorbitol containing 10 μg/ml zymolase and 70 mm β-mercaptoethanol at 30 °C for 1 h, washed once in PBS, and applied to a poly-l-lysine-coated slide. Cells were then permeabilized with ice-cold methanol, blocked with phosphate-buffered saline containing 1 mg/ml bovine serum albumin, and stained with the HA11 monoclonal antibody (BabCo) for Dap1-HA and an anti-Myc tag antibody (Genscript) for Erg11-Myc, followed by fluorescein isothiocyanate-conjugated secondary antibodies. For FM4-64 staining, cells were incubated with 20 μm FM4-64 (Molecular Probes) in YPD medium for 10 min, washed, and incubated for an additional 10 min in YPD before microscopic analysis. In all cases, cells were examined using a Zeiss microscope, and images were captured using Axioskop software. Sterol Analysis—200 ml of early log phase cells were grown in YPD medium and treated with 100 μm BPS for 3 h. Cells were pelleted and washed once with distilled water and extracted with potassium hydroxide-ethanol. Sterols were subsequently extracted with hexane, as described previously (4Hand R.A. Jia N. Bard M. Craven R.J. Eukaryot. Cell. 2003; 2: 306-317Crossref PubMed Scopus (58) Google Scholar, 8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar), and analyzed by gas chromatography at the University of Kentucky Mass Spectrometry Facility. Strains Lacking Dap1 Are Sensitive to Iron Depletion—Wild-type and dap1Δ strains were maintained on iron-depleted medium by culturing in 100 μm BPS. Wild-type cells grew normally, whereas the dap1Δ strains did not (Fig. 1A, columns 3 and 4). A small zone of residual growth in the dap1Δ strain was dark red and consisted of nonbudded cells with a disrupted morphology. The BPS sensitivity of dap1Δ cells was complemented by the wild-type DAP1 gene (Fig. 1B, row 7) but not by the DAP1-D91G mutant (Fig. 1B, row 8), which does not bind to heme (8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar). The results suggest that the heme binding function of Dap1 is required for growth under iron-depleted conditions. The expression of the multicopper oxidase Fet3 is induced under iron-depleted conditions (30Van Ho A. Ward D.M. Kaplan J. Annu. Rev. Microbiol. 2002; 56: 237-261Crossref PubMed Scopus (181) Google Scholar). A construct containing the FET3 promoter fused to the bacterial lacZ gene was used to measure FET3 expression. FET3 increased 22-fold in wild-type cells and 31-fold in dap1Δ cells following iron depletion (Fig. 1C), a difference that was statistically significant (p = 5 × 10-6, two-tailed t test). The difference in FET3 transcription in BPS-treated wild-type and dap1Δ cells was confirmed using using reverse transcription-PCR, where we reproducibly detected a 25% increase in FET3 levels (Fig. 1D). Despite increased FET3 transcription, we did not detect any change in the uptake of radiolabeled iron or iron reductase activity (50.5 ± 2.8 nmol of Fe2+/min/A600 for wild type versus 52.6 ± 5.0 for dap1Δ). The results suggest a disparity between iron-regulated transcription and iron uptake in dap1Δ cells. Because Dap1 regulates sterol synthesis, we tested the effect of the Dap1 mutation on sterol biosynthesis under low iron conditions. As expected, dap1Δ cells had elevated lanosterol and episterol relative to wild-type cells (Fig. 2, compare A and C). Treatment of wild-type cells with BPS caused a modest accumulation of episterol (Fig. 2B), whereas dap1Δ cells accumulated increased levels of squalene (Fig. 2D), suggesting an iron-related defect in Erg1 function in dap1Δ cells. The sterol synthetic pathway is diagrammed in Fig. 2E. Although the Erg1 substrate was elevated under iron-depleted conditions, multicopy expression of Erg1 did not suppress BPS sensitivity in dap1Δ cells (Fig. 2F, bottom, compare bottom rows), indicating that altered Erg1 function is not directly related to iron metabolic defects in dap1Δ cells. Erg11 Suppresses the Requirement for Dap1 in Iron Metabolism—Because Dap1 requires heme binding for sterol synthesis, damage resistance, and viability in low iron, we developed a genetic system for increasing heme levels. The HEM1/δ-aminolevulinate synthase and HEM2/δ-aminolevulinate dehydratase genes were expressed at high copy numbers using the multiple copy plasmid YEplac195, and this suppressed the elevated susceptibility of dap1Δ cells to the alkylating agent methyl methanesulfonate (MMS) (Fig. 3A). The effect was more pronounced for HEM2 than HEM1 (Fig. 3A, rows 11 and 12). However, HEM1 and HEM2 high copy expression did not suppress itraconazole sensitivity, suggesting that the expression of these genes is not limiting for sterol synthesis (Fig. 3A, rows 17 and 18). Nsg1 is the yeast homologue of the human Insig-1 protein, which binds to the human Dap1 homologue (31Suchanek M. Radzikowska A. Thiele C. Nat. Methods. 2005; 2: 261-267Crossref PubMed Scopus (376) Google Scholar). However, a high dosage of NSG1 did not suppress MMS, itraconazole, or BPS susceptibility in dap1Δ cells (data not shown). Although the heme-binding domain of Dap1 was required for MMS resistance, high dose expression of HEM2 did not suppress BPS sensitivity in dap1Δ cells (Fig. 3B, row 11). In contrast, high dosage of ERG11 completely suppressed BPS sensitivity (Fig. 3B, row 12). This effect was not generalized to other sterol biosynthetic genes, because high dosage of ERG1 and ERG5 had no effect on BPS sensitivity in dap1Δ strains (data not shown). Dap1 binds to heme and is related to cytochrome b5, encoded by CYB5 in S. cerevisiae, but high copy expression of CYB5 did not suppress loss of Dap1 (data not shown). Because ERG11 suppressed loss of DAP1, we tested the extent to which Erg11 inhibitors affected growth on iron-depleted medium. We detected partial growth of wild-type cells on 2 μm itraconazole and 100 μm BPS (Fig. 3C, rows 2 and 3, respectively) but essentially no growth when the two compounds were combined (Fig. 3C, row 4). Taken together, the results suggest that sterol synthesis mediated by Erg11 and Dap1 is required for survival in iron-depleted medium, and this Dap1 function is not a general property of cytochrome-like proteins. Characterization of Dap1—We fused three copies of the HA epitope tag sequence through one-step integration to the 3′ end of the DAP1 gene. As a result, DAP1 was transcribed from its own promoter and synthesized from a single copy of its gene. The tagged Dap1 protein was readily detected as a 25-kDa protein by Western blot (Fig. 4A, top, lanes 2 and 3). In contrast, strains lacking the in frame epitope tag did not have a detectable 27-kDa protein (Fig. 4A, top, lane 1). Thus, the migration of Dap1 was similar to that of related rat and human proteins. In all cases, blots were probed with an antibody to tubulin as a control for protein loading (Fig. 4A, bottom). Dap1 expression was reported previously to change upon treatment with the antifungal triazole drug itraconazole (7Hughes T.R. Marton M.J. Jones A.R. Roberts C.J. Stoughton R. Armour C.D. Bennett H.A. Coffey E. Dai H. He Y.D. Kidd M.J. King A.M. Meyer M.R. Slade D. Lum P.Y. Stepaniants S.B. Shoemaker D.D. Gachotte D. Chakraburtty K. Simon J. Bard M. Friend S.H. Cell. 2000; 102: 109-126Abstract Full Text Full Text PDF PubMed Scopus (2110) Google Scholar), and dap1Δ mutants are sensitive to itraconazole (4Hand R.A. Jia N. Bard M. Craven R.J. Eukaryot. Cell. 2003; 2: 306-317Crossref PubMed Scopus (58) Google Scholar, 8Mallory J.C. Crudden G. Johnson B.L. Mo C. Pierson C.A. Bard M. Craven R.J. Mol. Cell Biol. 2005; 25: 1669-1679Crossref PubMed Scopus (74) Google Scholar). The expression of Dap1 increased 14-fold in cells treated with 0.1-1 μm itraconazole in a dose-dependent manner (Fig. 4B). In contrast, Dap1 expression did not change significantly following treatment with MMS, heat shock, or hydroxyurea (supplemental Fig. 2A). In addition, we did not detect any changes in Dap1 expression following treatment with BPS (supplemental Fig. 2B) or in strains with elongated or shortened telomeres (tel1Δ or rif1Δ rif2Δ, respectively; supplemental Fig. 2C) or in strains with acute damage sensitivity (mec1-21, rad9Δ, or dun1Δ). Dap1 Localizes to Punctate Cytoplasmic Sites and Co-fractionates with Endosomal Markers—A diploid strain expressing the tagged Dap1 protein (Fig. 4A, lane 4), which was not expressed in the control untagged diploid strain (Fig. 4A, top, lane 5) was stained by immunofluorescence with the HA antibody. Dap1 localized to bright, clearly defined spots within the cytoplasm (Fig. 4C; bright field in Fig. 4D). The spots varied in size and number between the cells and were detectable in both mother and daughter cells. There was no evidence for Dap1 staining within the mother-bud neck, within the nucleus, or at the cell periphery. In contrast, the control diploid strain did not stain with the HA antibody after the same procedure (Fig. 4E; bright field shown in Fig. 4F). Similar spots of Dap1 staining were detected in haploid strains but were more difficult to visualize due to the smaller cell size. Punctate cytoplasmic staining is characteristic of several types of subcellular structures. Thus, the subcellular fractions of a Dap1-tagged strain were separated on a sucrose gradient and probed for Dap1 or various markers. Dap1 co-fractionated with Ypt7 (Fig. 5, A and B), a GTP-binding protein that regulates vacuolar transport (32Wichmann H. Hengst L. Gallwitz D. Cell. 1992; 71: 1131-1142Abstract Full Te" @default.
• W2016211979 created "2016-06-24" @default.
• W2016211979 creator A5030967404 @default.
• W2016211979 creator A5039960048 @default.
• W2016211979 creator A5041300271 @default.
• W2016211979 date "2007-12-01" @default.
• W2016211979 modified "2023-10-12" @default.
• W2016211979 title "Regulation of Iron Homeostasis Mediated by the Heme-binding Protein Dap1 (Damage Resistance Protein 1) via the P450 Protein Erg11/Cyp51" @default.
• W2016211979 cites W1488907063 @default.
• W2016211979 cites W1555821924 @default.
• W2016211979 cites W1802190303 @default.
• W2016211979 cites W1896630930 @default.
• W2016211979 cites W1914512945 @default.
• W2016211979 cites W1927096570 @default.
• W2016211979 cites W1927241094 @default.
• W2016211979 cites W1966072209 @default.
• W2016211979 cites W1968917541 @default.
• W2016211979 cites W1975732952 @default.
• W2016211979 cites W1983653026 @default.
• W2016211979 cites W1988735506 @default.
• W2016211979 cites W1989584376 @default.
• W2016211979 cites W1990008865 @default.
• W2016211979 cites W1991379214 @default.
• W2016211979 cites W1998277030 @default.
• W2016211979 cites W2001174541 @default.
• W2016211979 cites W2001202526 @default.
• W2016211979 cites W2003105919 @default.
• W2016211979 cites W2006836034 @default.
• W2016211979 cites W2012714287 @default.
• W2016211979 cites W2019215631 @default.
• W2016211979 cites W2019570733 @default.
• W2016211979 cites W2020782079 @default.
• W2016211979 cites W2022034355 @default.
• W2016211979 cites W2026162518 @default.
• W2016211979 cites W2026577542 @default.
• W2016211979 cites W2036523243 @default.
• W2016211979 cites W2037036397 @default.
• W2016211979 cites W2039122836 @default.
• W2016211979 cites W2048312779 @default.
• W2016211979 cites W2055714119 @default.
• W2016211979 cites W2073461422 @default.
• W2016211979 cites W2074469961 @default.
• W2016211979 cites W2078007825 @default.
• W2016211979 cites W2082283219 @default.
• W2016211979 cites W2092899154 @default.
• W2016211979 cites W2094489008 @default.
• W2016211979 cites W2106327666 @default.
• W2016211979 cites W2106360060 @default.
• W2016211979 cites W2107451370 @default.
• W2016211979 cites W2109995176 @default.
• W2016211979 cites W2111499388 @default.
• W2016211979 cites W2113125568 @default.
• W2016211979 cites W2114588455 @default.
• W2016211979 cites W2115436253 @default.
• W2016211979 cites W2117199571 @default.
• W2016211979 cites W2117853791 @default.
• W2016211979 cites W2118541683 @default.
• W2016211979 cites W2127570240 @default.
• W2016211979 cites W2135314879 @default.
• W2016211979 cites W2141781497 @default.
• W2016211979 cites W2143258863 @default.
• W2016211979 cites W2146264532 @default.
• W2016211979 cites W2149797789 @default.
• W2016211979 cites W2158345992 @default.
• W2016211979 cites W2160219184 @default.
• W2016211979 cites W2165265474 @default.
• W2016211979 cites W2167063768 @default.
• W2016211979 cites W2168034944 @default.
• W2016211979 cites W2169805130 @default.
• W2016211979 cites W2471472906 @default.
• W2016211979 cites W4247610110 @default.
• W2016211979 doi "https://doi.org/10.1074/jbc.m706770200" @default.
• W2016211979 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17954932" @default.
• W2016211979 hasPublicationYear "2007" @default.
• W2016211979 type Work @default.
• W2016211979 sameAs 2016211979 @default.
• W2016211979 citedByCount "55" @default.
• W2016211979 countsByYear W20162119792012 @default.
• W2016211979 countsByYear W20162119792013 @default.
• W2016211979 countsByYear W20162119792014 @default.
• W2016211979 countsByYear W20162119792015 @default.
• W2016211979 countsByYear W20162119792016 @default.
• W2016211979 countsByYear W20162119792017 @default.
• W2016211979 countsByYear W20162119792018 @default.
• W2016211979 countsByYear W20162119792019 @default.
• W2016211979 countsByYear W20162119792020 @default.
• W2016211979 countsByYear W20162119792021 @default.
• W2016211979 countsByYear W20162119792022 @default.
• W2016211979 countsByYear W20162119792023 @default.
• W2016211979 crossrefType "journal-article" @default.
• W2016211979 hasAuthorship W2016211979A5030967404 @default.
• W2016211979 hasAuthorship W2016211979A5039960048 @default.
• W2016211979 hasAuthorship W2016211979A5041300271 @default.
• W2016211979 hasBestOaLocation W20162119791 @default.
• W2016211979 hasConcept C181199279 @default.
• W2016211979 hasConcept C185592680 @default.
• W2016211979 hasConcept C2776217839 @default.
• W2016211979 hasConcept C2911035656 @default.

• next