FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016261254> ?p ?o ?g. }

• W2016261254 endingPage "38812" @default.
• W2016261254 startingPage "38803" @default.
• W2016261254 abstract "Epstein-Barr virus (EBV) expresses an immediate-early protein, Rta, to activate the transcription of EBV lytic genes and the lytic cycle. This work identifies Ubc9 and PIAS1 as binding partners of Rta in a yeast two-hybrid screen. These bindings are verified by glutathione S-transferase pull-down assay, coimmunoprecipitation, and confocal microscopy. The interactions appear to cause Rta sumoylation, because not only can Rta be sumoylated in vitro but also sumoylated Rta can be detected in P3HR1 cells following lytic induction and in 293T cells after transfecting plasmids that express Rta and SUMO-1. Moreover, PIAS1 stimulates conjugation of SUMO-1 to Rta, thus acting as an E3 ligase. Furthermore, transfecting plasmids that express Ubc9, PIAS1, and SUMO-1 increases the capacity of Rta to transactivate the promoter that includes an Rta response element, indicating that the modification by SUMO-1 increases the transactivation activity of Rta. This study reveals that Rta is sumoylated at the Lys-19, Lys-213, and Lys-517 residues and that SUMO-1 conjugation at the Lys-19 residue is crucial for enhancing the transactivation activity of Rta. These results indicate that sumoylation of Rta may be important in EBV lytic activation. Epstein-Barr virus (EBV) expresses an immediate-early protein, Rta, to activate the transcription of EBV lytic genes and the lytic cycle. This work identifies Ubc9 and PIAS1 as binding partners of Rta in a yeast two-hybrid screen. These bindings are verified by glutathione S-transferase pull-down assay, coimmunoprecipitation, and confocal microscopy. The interactions appear to cause Rta sumoylation, because not only can Rta be sumoylated in vitro but also sumoylated Rta can be detected in P3HR1 cells following lytic induction and in 293T cells after transfecting plasmids that express Rta and SUMO-1. Moreover, PIAS1 stimulates conjugation of SUMO-1 to Rta, thus acting as an E3 ligase. Furthermore, transfecting plasmids that express Ubc9, PIAS1, and SUMO-1 increases the capacity of Rta to transactivate the promoter that includes an Rta response element, indicating that the modification by SUMO-1 increases the transactivation activity of Rta. This study reveals that Rta is sumoylated at the Lys-19, Lys-213, and Lys-517 residues and that SUMO-1 conjugation at the Lys-19 residue is crucial for enhancing the transactivation activity of Rta. These results indicate that sumoylation of Rta may be important in EBV lytic activation. Small ubiquitin-like modifiers (SUMOs) 1The abbreviations used are: SUMO, small ubiquitin-like modifier; E2, ubiquitin carrier protein ligase; E3, ubiquitin-protein isopeptide ligase; PML, promyelocytic leukemia protein; CMV, cytomegalovirus; EBV, Epstein-Barr virus; TPA, 12-O-tetradecanoylphorbol 13-acetate; TSA, trichostatin A; HA, hemagglutinin; GST, glutathione S-transferase; RRE, Rta response element; DTT, dithiothreitol; PBS, phosphate-buffered saline; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; NEM, N-ethylmaleimide; TRITC, tetramethyl rhodamine isothiocyanate. are a group of proteins that conjugate a wide range of proteins in the cell (1Melchior F. Annu. Rev. Cell Dev. Biol. 2000; 16: 591-626Crossref PubMed Scopus (653) Google Scholar, 2Hay R.T. Trends Biochem. Sci. 2001; 26: 332-333Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 3Hochstrasser M. Cell. 2001; 107: 5-8Abstract Full Text Full Text PDF PubMed Scopus (239) Google Scholar). In human cells, three types of SUMO, i.e. SUMO-1, SUMO-2, and SUMO-3, have been identified (4Kamitani T. Kito K. Nguyen H.P. Fukuda-Kamitani T. Yeh E.T. J. Biol. Chem. 1998; 273: 11349-11353Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar, 5Saitoh H. Hinchey J. J. Biol. Chem. 2000; 275: 6252-6258Abstract Full Text Full Text PDF PubMed Scopus (690) Google Scholar, 6Su H. Li S. Gene (Amst.). 2002; 296: 65-73Crossref PubMed Scopus (129) Google Scholar, 7Mannen H. Tseng H.M. Cho C.L. Li S.S. Biochem. Biophys. Res. Commun. 1996; 222: 178-180Crossref PubMed Scopus (50) Google Scholar). These SUMO molecules conjugate to their target proteins through an isopeptide bond formed between the C-terminal glycine residue of SUMO and a lysine residue in the substrate, frequently found at a conserved ψKXE motif; where ψ represents a hydrophobic amino acid residue, including Leu, Ile, Val, or Phe (8Rodriguez M.S. Dargemont C. Hay R.T. J. Biol. Chem. 2001; 276: 12654-12659Abstract Full Text Full Text PDF PubMed Scopus (606) Google Scholar, 9Sampson D.A. Wang M. Matunis M.J. J. Biol. Chem. 2001; 276: 21664-21669Abstract Full Text Full Text PDF PubMed Scopus (396) Google Scholar). As is generally known, in a SUMO conjugation reaction, SUMO hydrolase first removes the four C-terminal amino acids of SUMO, exposing a glycine residue to facilitate SUMO conjugation. The SUMO molecule is then adenylated and covalently linked to a SUMO-activating E1 enzyme (10Desterro J.M. Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar, 11Okuma T. Honda R. Ichikawa G. Tsumagari N. Yasuda H. Biochem. Biophys. Res. Commun. 1999; 254: 693-698Crossref PubMed Scopus (183) Google Scholar). Subsequently, SUMO is transferred to the SUMO-conjugating E2 enzyme, Ubc9, which catalyzes the transfer of SUMO to its target proteins (12Desterro J.M. Thomson J. Hay R.T. FEBS Lett. 1997; 417: 297-300Crossref PubMed Scopus (303) Google Scholar, 13Gong L. Kamitani T. Fujise K. Caskey L.S. Yeh E.T. J. Biol. Chem. 1997; 272: 28198-28201Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar, 14Johnson E.S. Blobel G. J. Biol. Chem. 1997; 272: 26799-26802Abstract Full Text Full Text PDF PubMed Scopus (408) Google Scholar, 15Schwarz S.E. Matuschewski K. Liakopoulos D. Scheffner M. Jentsch S. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 560-564Crossref PubMed Scopus (189) Google Scholar). The E3 ligase, which stimulates SUMO-1 conjugation to target proteins, has only recently been identified. Three proteins, including PIAS, RanBP2, and Pc2, are currently known to participate in the process of sumoylation (16Kahyo T. Nishida T. Yasuda H. Mol. Cell. 2001; 8: 713-718Abstract Full Text Full Text PDF PubMed Scopus (391) Google Scholar, 17Pichler A. Gast A. Seeler J.S. Dejean A. Melchior F. Cell. 2002; 108: 109-120Abstract Full Text Full Text PDF PubMed Scopus (641) Google Scholar, 18Kagey M.H. Melhuish T.A. Wotton D. Cell. 2003; 113: 127-137Abstract Full Text Full Text PDF PubMed Scopus (452) Google Scholar, 19Kotaja N. Karvonen U. Janne O.A. Palvimo J.J. Mol. Cell. Biol. 2002; 22: 5222-5234Crossref PubMed Scopus (355) Google Scholar, 20Johnson E.S. Gupta A.A. Cell. 2001; 106: 735-744Abstract Full Text Full Text PDF PubMed Scopus (528) Google Scholar). Sumoylation may influence protein functions in many ways. An important function of SUMO is to stabilize its target proteins by acting as an antagonist to ubiquitin-mediated proteolysis (21Desterro J.M. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Abstract Full Text Full Text PDF PubMed Scopus (915) Google Scholar). For instance, SUMO modification blocks ubiquitination and destruction of IκB by the SCF(β-TrCP) E3 ubiquitin ligase complex (21Desterro J.M. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Abstract Full Text Full Text PDF PubMed Scopus (915) Google Scholar), thus stabilizing the ability of IκB to inhibit NF-κB. SUMO modification is also known to influence protein localization. For example, SUMO-1 modification not only targets promyelocytic leukemia protein (PML) to discrete subnuclear structures called PML nuclear bodies (22Muller S. Matunis M.J. Dejean A. EMBO J. 1998; 17: 61-70Crossref PubMed Scopus (580) Google Scholar) but also is necessary for RanGAP1 binding to a nuclear pore complex (23Lee G.W. Melchior F. Matunis M.J. Mahajan R. Tian Q. Anderson P. J. Biol. Chem. 1998; 273: 6503-6507Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar), which contains Ubc9 and RanBP2. Furthermore, both Ubc9 and RanBP2 are crucial for sumoylation, because Pichler et al. (17Pichler A. Gast A. Seeler J.S. Dejean A. Melchior F. Cell. 2002; 108: 109-120Abstract Full Text Full Text PDF PubMed Scopus (641) Google Scholar) and Zhang et al. (24Zhang H. Saitoh H. Matunis M.J. Mol. Cell. Biol. 2002; 22: 6498-6508Crossref PubMed Scopus (229) Google Scholar) demonstrated that proteins are sumoylated on the cytoplasm side of nuclear membrane by Ubc9, and the sumoylated proteins are then transported into the nucleus by RanBP2 after sumoylation (17Pichler A. Gast A. Seeler J.S. Dejean A. Melchior F. Cell. 2002; 108: 109-120Abstract Full Text Full Text PDF PubMed Scopus (641) Google Scholar). Additionally, SUMO modification of Sp100 and Daxx targets these transcription factors into the PML nuclear bodies (25Zhong S. Salomoni P. Ronchetti S. Guo A. Ruggero D. Pandolfi P.P. J. Exp. Med. 2000; 191: 631-640Crossref PubMed Scopus (193) Google Scholar, 26Sternsdorf T. Jensen K. Will H. J. Cell Biol. 1997; 139: 1621-1634Crossref PubMed Scopus (291) Google Scholar, 27Li H. Leo C. Zhu J. Wu X. O'Neil J. Park E.J. Chen J.D. Mol. Cell. Biol. 2000; 20: 1784-1796Crossref PubMed Scopus (307) Google Scholar). As is generally known, the interphase nucleus is organized into distinct domains, including nuclear matrix and the chromatin structures of the chromosomes. PML nuclear bodies are essential domains of nuclear matrix (28Zhong S. Muller S. Ronchetti S. Freemont P.S. Dejean A. Pandolfi P.P. Blood. 2000; 95: 2748-2752Crossref PubMed Google Scholar), possibly accounting for why the activity of Sp100 and Daxx is activated after sumoylation. SUMO modification also regulates the DNA-binding activities of the heat shock transcription factors HSF1 and HSF2 (29Goodson M.L. Hong Y. Rogers R. Matunis M.J. Park-Sarge O.K. Sarge K.D. J. Biol. Chem. 2001; 276: 18513-18518Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 30Hong Y. Rogers R. Matunis M.J. Mayhew C.N. Goodson M.L. Park-Sarge O.K. Sarge K.D. Goodson M. J. Biol. Chem. 2001; 276: 40263-40267Abstract Full Text Full Text PDF PubMed Scopus (205) Google Scholar). On the other hand, sumoylation may actually inhibit transactivation activity of some transcription factors (31Gill G. Curr. Opin. Genet. Dev. 2003; 13: 108-113Crossref PubMed Scopus (193) Google Scholar, 32Verger A. Perdomo J. Crossley M. EMBO Rep. 2003; 4: 137-142Crossref PubMed Scopus (375) Google Scholar). For example, SUMO modification inactivates the functions of Sp3 and changes its subnuclear localization (33Ross S. Best J.L. Zon L.I. Gill G. Mol. Cell. 2002; 10: 831-842Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 34Sapetschnig A. Rischitor G. Braun H. Doll A. Schergaut M. Melchior F. Suske G. EMBO J. 2002; 21: 5206-5215Crossref PubMed Scopus (226) Google Scholar). Moreover, sumoylation influences the functions of many viral proteins. For instance, SUMO conjugation of papillomavirus E1 increases its ability to enhance viral DNA replication (35Rangasamy D. Wilson V.G. J. Biol. Chem. 2000; 275: 30487-30495Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar); SUMO-1 modification also increases the transactivation activity of human cytomegalovirus (CMV) IE2 (36Ahn J.H. Xu Y. Jang W.J. Matunis M.J. Hayward G.S. J. Virol. 2001; 75: 3859-3872Crossref PubMed Scopus (83) Google Scholar, 51Hofmann H. Floss S. Stamminger T. J. Virol. 2000; 74: 2510-2524Crossref PubMed Scopus (147) Google Scholar). Although CMV IE1/IE72 is modified by SUMO-1, exactly how such modification affects the functions of IE1/IE72 remains unknown (37Spengler M.L. Kurapatwinski K. Black A.R. Azizkhan-Clifford J. J. Virol. 2002; 76: 2990-2996Crossref PubMed Scopus (50) Google Scholar, 61Muller S. Dejean A. J. Virol. 1999; 73: 5137-5143Crossref PubMed Google Scholar, 62Xu Y. Ahn J.H. Cheng M. apRhys C.M. Chiou C.J. Zong J. Matunis M.J. Hayward G.S. J. Virol. 2001; 75: 10683-10695Crossref PubMed Scopus (72) Google Scholar). Epstein-Barr virus (EBV) is normally maintained under latent conditions in B lymphocytes. However, EBV must enter a lytic phase to proliferate. During the immediate-early stage of the lytic cycle, the virus expresses two immediate-early proteins, i.e. Rta and Zta, to activate the viral early genes and the lytic cascade (38Chang L.K. Liu S.T. Nucleic Acids Res. 2000; 28: 3918-3925Crossref PubMed Scopus (89) Google Scholar, 39Chang P.J. Chang Y.S. Liu S.T. J. Virol. 1998; 72: 5128-5136Crossref PubMed Google Scholar, 40Biggin M. Bodescot M. Perricaudet M. Farrell P. J. Virol. 1987; 61: 3120-3132Crossref PubMed Google Scholar, 41Flemington E.K. Goldfeld A.E. Speck S.H. J. Virol. 1991; 65: 7073-7077Crossref PubMed Google Scholar, 42Takada K. Ono Y. J. Virol. 1989; 63: 445-449Crossref PubMed Google Scholar). Adamson and Kenney (43Adamson A.L. Kenney S. J. Virol. 2001; 75: 2388-2399Crossref PubMed Scopus (204) Google Scholar) demonstrated that Zta is modified by SUMO-1. Such modification may compete with PML for limited amounts of SUMO-1 in the nucleus, thus preventing the formation of PML nuclear bodies and resulting in a dispersion of PML nuclear bodies in the nucleus (43Adamson A.L. Kenney S. J. Virol. 2001; 75: 2388-2399Crossref PubMed Scopus (204) Google Scholar). In addition, the EBNA-3C protein of EBV is sumoylated, which appears to be crucial for activating the BNLF1 promoter by EBNA-3C (44Lin J. Johannsen E. Robertson E. Kieff E. J. Virol. 2002; 76: 232-242Crossref PubMed Scopus (75) Google Scholar, 45Rosendorff A. Illanes D. David G. Lin J. Kieff E. Johannsen E. J. Virol. 2004; 78: 367-377Crossref PubMed Scopus (54) Google Scholar). This investigation demonstrates that Rta is sumoylated by SUMO-1 and, in doing so, enhances the transactivation activity of Rta. Cell Lines and EBV Lytic Induction—P3HR1, Jurkat, and EBV-negative Akata cells were cultured in RPMI 1640 medium containing 10% fetal calf serum. 293T cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. To activate the EBV lytic cycle, P3HR1 cells were treated with 12-O-tetradecanoylphorbol 13-acetate (TPA) and sodium butyrate or trichostatin A (TSA) according to a method described elsewhere (38Chang L.K. Liu S.T. Nucleic Acids Res. 2000; 28: 3918-3925Crossref PubMed Scopus (89) Google Scholar, 46Luka J. Kallin B. Klein G. Virology. 1979; 94: 228-231Crossref PubMed Scopus (315) Google Scholar, 47Davies A.H. Grand R.J. Evans F.J. Rickinson A.B. J. Virol. 1991; 65: 6838-6844Crossref PubMed Google Scholar). Plasmids—Plasmid pCMV-R contains BRLF1 transcribed from the CMV immediate-early promoter (39Chang P.J. Chang Y.S. Liu S.T. J. Virol. 1998; 72: 5128-5136Crossref PubMed Google Scholar). Plasmid pCMV-3 is identical to pCMV-R except without BRLF1. Plasmids pcDNA-Ubc9 and pGEX-Ubc9, which express HA-tagged Ubc9 and GST-Ubc9, respectively, were provided by Van G. Wilson (35Rangasamy D. Wilson V.G. J. Biol. Chem. 2000; 275: 30487-30495Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Plasmid pCR-SUMO-1, which encodes FLAG-tagged SUMO-1, was constructed by inserting a PCR-amplified SUMO-1 DNA fragment into pCR3.1 (Invitrogen). Plasmid pGEX-4T1, which expresses GST, was purchased from Amersham Biosciences. Plasmid pET-SUMO-1, which expresses His-tagged SUMO-1 in Escherichia coli BL21(DE3), was constructed by inserting a SUMO-1 DNA fragment into the EcoRI and XhoI sites of pET-28a (Novagen, Madison, WI). Plasmids pCMV-PIAS1 and pGEX-PIAS1 were provided by Stefan Müller (48Schmidt D. Muller S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2872-2877Crossref PubMed Scopus (371) Google Scholar). Double-stranded DNA (5′-CCCAAGCTTCGGCTGACATGAATTCCTGGTCTTTTATCATGTCCCTCTATCATGGCGCAGACCCCGGGGGA), which contains an Rta response element (RRE) from the BMLF1 promoter and a TATA sequence, was synthesized and inserted into the HindIII and SmaI sites, upstream of a firefly luciferase gene (luc), in pGL2-Basic (Promega) to generate pRRE. To construct a plasmid (pET-Rta) expressing Rta in E. coli BL21(DE3), BRLF1 was amplified by PCR, using primers GST-5R (5′-CCGGAATTCCGGAGGCCTAAAAAGGATGGC) and GST-3R. The fragment was then inserted into the EcoRI and SalI sites in pET-32a(+) (Novagen). Plasmid pGEX-SUMO-1 (23Lee G.W. Melchior F. Matunis M.J. Mahajan R. Tian Q. Anderson P. J. Biol. Chem. 1998; 273: 6503-6507Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar), obtained from Frauke Melchior, encodes a GST-SUMO-1 fusion protein that lacks the four C-terminal amino acids of SUMO-1. A DNA fragment encoding Ubc9 was amplified by PCR, using U1 (5′-CGGGATCCACATGTCGGGGATCGCCCTCAGC) and U2 (5′-ACGCGTCGACTTATGAGGGCGCAAACTTCTTGGC) as primers and a human testis cDNA library as template. The fragment was digested with BamHI and SalI and inserted into the BamHI-SalI sites in pACT2 to generate pACT-Ubc9. Plasmid pACT-PIAS1 was isolated from a human testis cDNA library constructed in pACT2 (Clontech, Palo Alto, CA). A plasmid that expresses full-length Rta tagged with an HA sequence at the N terminus (HA-Rta) was constructed by inserting a PCR-amplified BRLF1 fragment into pcDNA3-HA at the EcoRI and SalI sites. Plasmids that expressed deleted HA-Rta were constructed in the same way. These Rta deletion mutants include RN122, RN190, and RN347, as well as RC351, which lacked the regions from amino acids 123 to 605, 191 to 605, and 348 to 605, and 1 to 254, respectively. Meanwhile, mutant R255/415 included the region between amino acids 255 and 415 of Rta. Lysine residues at amino acid positions 19, 213, and 517 on HA-Rta were mutagenized following a PCR mutagenesis method of Ho (49Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene. 1989; 77: 51-59Crossref PubMed Scopus (6833) Google Scholar). Yeast Two-hybrid Screen—To construct a bait plasmid for yeast two-hybrid screening, BRLF1 was amplified by PCR, using R1 (5′-CATGCCATGGCGATGAGGCCTAAAAAGGATGGC) and R2 (5′-CATGCCATGGCTAAAATAAGCTGGTGTCAAAA) as primers and pCMV-R as template. The fragment was digested with NcoI and inserted into the NcoI site of pAS2-1 (Clontech). The orientation of the insert was subsequently verified by DNA sequencing. The plasmid was then digested with BamHI to remove the 3′ region of BRLF1 to generate pR476, which encodes the Gal4 DNA-binding domain fused with the N-terminal 476 amino acids of Rta. A human testis cDNA library constructed in pACT2 (Clontech) was screened by cotransforming the bait (pR476) and the library plasmids into yeast strain, YRG-2 (Stratagene, La Jolla, CA). Positive clones were selected based on their ability to grow on Trp, Leu, and His dropout media supplemented with 3-aminotriazole and their blue colony color in β-galactosidase filter assay. These phenotypes were further confirmed in yeast strain Y190. β-Galactosidase activity was determined in Z buffer (150 mm phosphate buffer, pH 7.0, 10 mm KCl, and 1 mm MgSO4) containing 4 mg/ml O-nitrophenyl-β-d-galactopyranoside. Reactions were performed at 30 °C and stopped by adding 250 mm sodium carbonate. Enzyme activity was determined by measuring absorbance at 420 nm with a spectrophotometer (Model U2000, Hitachi, Japan). Purification of GST Fusion Proteins—To purify GST-Ubc9, 1 liter of E. coli BL21(DE3) (pGEX-Ubc9) was cultured to mid-log phase in 1 liter of LB medium. isopropyl-1-thio-β-d-galactopyranoside was then added to the medium to a final concentration of 1 mm. Cells were harvested 4 h after the treatment, suspended in ice-cold buffer A (50 mm Tris-HCl, pH 8.0, 500 mm NaCl, 1 mm DTT, 1 mm 4-(2-aminoethyl)benzenesulfonyl fluoride, and 1 mm leupeptin), and homogenized by sonication for 1 min. Cell lysate was then centrifuged at 6000 × g for 10 min at 4 °C. The supernatant was applied to a column containing 1 ml of glutathione-agarose beads (Amersham Biosciences). The column was washed with ten column volumes of buffer A. GST-Ubc9 was finally eluted from the column by adding buffer A containing 20 mm glutathione. The eluted GST-Ubc9 was dialyzed for 16 h against a dialysis buffer containing 50 mm Tris-HCl, pH 7.6, 100 mm NaCl, and 1 mm DTT. Dialyzed GST-Ubc9 was concentrated to 8 mg/ml with Centricon-100 (Millipore, Bedford, MA) and stored at -80 °C until use. GST, GST-PIAS1, and GST-SUMO-1 were purified by the same method. His-tagged SUMO-1 and His-tagged Rta expressed by E. coli BL21(DE3)(pET-SUMO-1) and E. coli BL21(DE3)(pET-Rta), respectively, were purified by a similar method, except that the protein was purified with a nickel-nitrilotriacetic acid column, eluted with 200 mm imidazole, and concentrated to a final concentration of 20 mg/ml. GST-pull-down Assay—GST, GST-Ubc9, GST-SUMO-1, or GSTPIAS1, at a concentration of 40 ng/ml in 500 μl of NETN buffer (20 mm Tris-HCl, pH 8.0, 100 mm NaCl, 1 mm EDTA, 0.5% Nonidet P-40) containing 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)-benzenesulfonyl fluoride, was added to 30 μl of glutathione-Sepharose 4B beads (Amersham Biosciences). The mixture was incubated under shaking for 1 h at 4 °C. The beads were washed three times with NETN buffer and added to the lysate (300 μl) prepared from E. coli BL21(DE3)(pET-Rta), P3HR1 cells, or 293T cells transfected with a plasmid that expresses Rta or its deletion derivatives. The reaction mixture was incubated on ice for 1 h. The beads were subsequently washed with NETN buffer. An equal volume of 2× electrophoresis sample buffer was added to the mixture, and proteins were extracted from the beads by heating at 95 °C for 5 min. Proteins were finally separated by SDS-polyacrylamide gel electrophoresis (50Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: a Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Immunoblot Analysis—Proteins resolved by SDS-polyacrylamide gel were electrotransferred to a Hybond C membrane (Amersham Biosciences) at 90 V for 1 h and probed with the appropriate antibodies. SuperSignal West Pico chemiluminescent substrate (Pierce) was used to visualize the proteins on the membrane. Immunoprecipitation—P3HR1 cells (1 × 107) transfected with pCMV-R, pcDNA-Ubc9, pCMV-PIAS1, or pCR-SUMO-1 were washed with phosphate-buffered saline (PBS). The lysate was prepared by adding 1 ml of radioimmune precipitation assay buffer (50 mm Tris-HCl, pH 7.8, 150 mm NaCl, 5 mm EDTA, 0.5% Triton X-100, 0.5% Nonidet P-40, 0.1% deoxycholate, and 10 μg/ml each of leupeptin, aprotinin, and 4-(2-aminoethyl)benzenesulfonyl fluoride) to the cells. Then the lysate was centrifuged with a microcentrifuge at 10,000 × g for 20 min. The supernatant was added with anti-Rta (1:500 dilution) (Argene, Varilhes, France) or anti-HA (1:500 dilution) (Roche Applied Science) antibody at 4 °C for 1 h. Protein-A/G-agarose beads (30 μl) (Oncogene, Boston, MA) were added to the lysate, and the mixture was incubated under shaking for 1 h at 4 °C. The beads were finally collected by centrifugation and washed three times with radioimmune precipitation assay buffer. Proteins binding to the beads were eluted by adding 20 μl of 2× electrophoresis sample buffer and analyzed by immunoblotting with anti-HA antibody. For MALDI-TOF mass spectrometry analysis, Rta was immunoprecipitated from the lysate prepared from 6 × 107 P3HR1 cells transfected with 120 μg of pCMV-R. Immunoprecipitation was performed in four tubes. After immunoprecipitation, proteins were pooled and separated by SDS-polyacrylamide gel electrophoresis. To detect sumoylated Rta after transfection, cells (1 × 107) were lysed according to a method described elsewhere (51Hofmann H. Floss S. Stamminger T. J. Virol. 2000; 74: 2510-2524Crossref PubMed Scopus (147) Google Scholar). To examine Rta sumoylation in cell lysate after lytic induction, 1 × 107 of P3HR1 cells were treated with 100 nm TSA for 24 h before immunoprecipitation. MALDI-TOF Mass Spectrometry Analysis of Rta—An 88-kDa protein immunoprecipitated by anti-Rta antibody was excised from an SDS-polyacrylamide gel and analyzed by MALDI-TOF mass spectrometry analysis by Accelerating Biodigital Era Inc. (Taipei, Taiwan). In Vitro SUMO Conjugation—Bacterially expressed Rta, SUMO-1 lacking the four C-terminal amino acids, GST-PIAS1, and SUMO-activating E1 enzyme (LAE Biotechnology Co., Taipei, Taiwan) were used to examine Rta sumoylation in vitro. Each SUMO conjugation reaction (16 μl) contained 1 μg of purified Rta, 500 ng each of GST-Ubc9 and SUMO-1, 15 ng of SUMO-activating E1 enzyme, and 4 μl of a buffer containing 200 mm Tris-HCl, pH 7.8, 20 mm MgCl2, 20 mm ATP, 4 mm DTT, and 800 μm NEM. Meanwhile, one-tenth of the amount of E1 and E2 was used to study the enhancement of Rta sumoylation by PIAS1. Reaction mixtures were incubated at 37 °C for 1 h. After incubation, 16 μl of 2× electrophoresis sample buffer was added to the reaction mixtures, which were then heated at 95 °C for 5 min. Proteins in the mixtures were immediately separated by SDS-polyacrylamide gel electrophoresis. Rta was then detected by immunoblotting with anti-Rta antibody. Transient Transfection Assay—Plasmids were purified from E. coli by CsCl-gradient centrifugation (50Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: a Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Plasmids (10 μg) were transfected into EBV-negative Akata and Jurkat cells by electroporation with a Bio-Rad Gene-Pulser electroporator (39Chang P.J. Chang Y.S. Liu S.T. J. Virol. 1998; 72: 5128-5136Crossref PubMed Google Scholar). A luciferase assay was performed, using a luminometer (model LB593, Berthod, Bad Wildbad, Germany), according to a method described elsewhere (39Chang P.J. Chang Y.S. Liu S.T. J. Virol. 1998; 72: 5128-5136Crossref PubMed Google Scholar). Each transfection experiment was performed three times, and each sample in the experiment was prepared in duplicate. Immunofluorescence Analysis—P3HR1 cells were treated with 30 ng/ml TPA and 3 mm sodium butyrate for 24 h to induce the expression of Rta. Cells were then harvested by centrifugation, plated on poly-l-lysine (Sigma)-coated coverslips, and fixed with 4% paraformaldehyde in PBS for 30 min. The cells were then incubated for 1 h with anti-Rta monoclonal antibody, goat anti-Ubc9 polyclonal antibody, goat anti-PIAS1 polyclonal antibody (Santa Cruz Biotechnology Inc.), or rabbit anti-SUMO-1 polyclonal antibody (Santa Cruz Biotechnology Inc.) and then treated with fluorescein isothiocyanate-conjugated goat anti-mouse IgG polyclonal antibody (KPL Inc., Gaithersburg, MD), fluorescein isothiocyanate-conjugated rabbit anti-mouse IgG polyclonal antibody (DAKO, Glostrup, Denmark), TRITC-conjugated rabbit anti-goat IgG polyclonal antibody (KPL, Inc.), or TRITC-conjugated goat anti-rabbit IgG polyclonal antibody (KPL Inc.). Finally, cells were washed with PBS, mounted in CITIFLOUR (Agar Inc., Essex, England), and examined with a Model LSM510 Zeiss confocal laser scanning microscope (Oberkochen, Germany). Identification of Ubc9 and PIAS1 as Rta-binding Proteins—Yeast two-hybrid screening was performed in strain YRG2, with a bait plasmid, pR476, which expresses a protein (RN476) that contains the Gal4 DNA-binding domain fused with the N-terminal 476 amino acids of Rta. RN476 lacks an intact transactivation domain, preventing it from activating the reporter genes and changing the phenotypes of yeast strain YRG2. Strain YRG2(pR476) was subsequently transformed with a human testes cDNA library constructed in pACT2 to screen the proteins that interact with Rta. This study screened ∼6 × 105 transformants and identified 24 plasmids that encode seven cellular proteins. Sequencing analysis revealed that, among the 24 clones, cDNA that encodes Ubc9 and PIAS1 was isolated seven times and twice, respectively. β-Galactosidase assay revealed that yeast strain Y190(pR476) transformed with a yeast two-hybrid cloning vector, pACT2, produced 25 units of β-galactosidase activity. However, this value increased to 1190 or 810 units when the strain was transformed with pACT-Ubc9 or pACT-PIAS1, respectively, indicating that RN476 interacts with Ubc9, and PIAS1. Binding of Rta to Ubc9, PIAS1, and SUMO-1 in Vitro—GST fusion pull-down assays were performed with bacterially expressed GST-Ubc9 and GST-PIAS1, respectively, to investigate whether Rta interacts with Ubc9 and PIAS1 in a context other than in yeast. Furthermore, because interaction between Rta and Ubc9 or PIAS1 in yeasts implies that Rta is conjugated by SUMO-1, this study also investigated whether Rta interacted with SUMO-1. GST or GST-Ubc9 bound to glutathione-Sepharose beads was added to the lysate prepared from P3HR1 cells transfected with pCMV-R (Fig. 1, lanes 2 and 3). After extensive washing, proteins bound to the beads were precipitated and analyzed by immunoblotting with anti-Rta antibody. Results indicated that Rta in the lysate (Fig. 1, lane 1) was retained by GST-Ubc9-glutathione-Sepharose beads (Fig. 1, lane 3) but was not retained by GST-glutathione-Sepharose beads (Fig. 1, lane 2). A similar study also revealed that His-tagged Rta expressed by E. coli (Fig. 1, lane 8) was retained by GST-Ubc9-(Fig. 1, lane 10) but not by GST-glutathione-Sepharose beads (Fig. 1, lane 9), confirming the interaction between Rta and Ubc9. Meanwhile, using GST-PIAS1 and GST-SUMO-1 also produced similar results; i.e. Rta in P3HR1 lysate or in E. coli lysate was retained by GST-PIAS1-(Fig. 1, lanes 5 and 11) and GST-SUMO-1-glutathione-Sepharose beads (Fig. 1, lanes 7 and 12) but not retained by GST-glutathione-Sepharose beads (Fig. 1, lanes 4, 6, and 9), indicating that Rta interacts with PIAS1 and SUMO-1. Determination of the Domains in Rta That Interact with Ubc9 and PIAS1—Plasmids that express deleted Rta (Fig. 2A) were transfected into 293T cells. GST-Ubc9- or GST-PIAS1-glutatione-Sepharose" @default.
• W2016261254 created "2016-06-24" @default.
• W2016261254 creator A5010400831 @default.
• W2016261254 creator A5012264926 @default.
• W2016261254 creator A5026945051 @default.
• W2016261254 creator A5032497109 @default.
• W2016261254 creator A5036046574 @default.
• W2016261254 creator A5040933687 @default.
• W2016261254 creator A5044968009 @default.
• W2016261254 creator A5054326705 @default.
• W2016261254 creator A5065077517 @default.
• W2016261254 creator A5079157409 @default.
• W2016261254 date "2004-09-01" @default.
• W2016261254 modified "2023-09-27" @default.
• W2016261254 title "Post-translational Modification of Rta of Epstein-Barr Virus by SUMO-1" @default.
• W2016261254 cites W1517778647 @default.
• W2016261254 cites W1638141956 @default.
• W2016261254 cites W1743579359 @default.
• W2016261254 cites W1744223828 @default.
• W2016261254 cites W1760923416 @default.
• W2016261254 cites W1795567655 @default.
• W2016261254 cites W1797342183 @default.
• W2016261254 cites W1970042886 @default.
• W2016261254 cites W1971656831 @default.
• W2016261254 cites W1980447566 @default.
• W2016261254 cites W1981785841 @default.
• W2016261254 cites W1986326295 @default.
• W2016261254 cites W1989142722 @default.
• W2016261254 cites W1991189921 @default.
• W2016261254 cites W1993602761 @default.
• W2016261254 cites W1995456120 @default.
• W2016261254 cites W1996811697 @default.
• W2016261254 cites W2001029086 @default.
• W2016261254 cites W2003015138 @default.
• W2016261254 cites W2004722555 @default.
• W2016261254 cites W2012734297 @default.
• W2016261254 cites W2024935012 @default.
• W2016261254 cites W2031668046 @default.
• W2016261254 cites W2040624923 @default.
• W2016261254 cites W2040825545 @default.
• W2016261254 cites W2041968244 @default.
• W2016261254 cites W2044808061 @default.
• W2016261254 cites W2045893413 @default.
• W2016261254 cites W2046037983 @default.
• W2016261254 cites W2058746315 @default.
• W2016261254 cites W2060913542 @default.
• W2016261254 cites W2067371211 @default.
• W2016261254 cites W2070052000 @default.
• W2016261254 cites W2070163476 @default.
• W2016261254 cites W2073148985 @default.
• W2016261254 cites W2080253509 @default.
• W2016261254 cites W2081302775 @default.
• W2016261254 cites W2083312621 @default.
• W2016261254 cites W2085671161 @default.
• W2016261254 cites W2086438431 @default.
• W2016261254 cites W2094209629 @default.
• W2016261254 cites W2112441454 @default.
• W2016261254 cites W2116988305 @default.
• W2016261254 cites W2117909268 @default.
• W2016261254 cites W2120765611 @default.
• W2016261254 cites W2121059558 @default.
• W2016261254 cites W2121428233 @default.
• W2016261254 cites W2121779606 @default.
• W2016261254 cites W2122044343 @default.
• W2016261254 cites W2122825731 @default.
• W2016261254 cites W2123375391 @default.
• W2016261254 cites W2123669269 @default.
• W2016261254 cites W2125723193 @default.
• W2016261254 cites W2127707170 @default.
• W2016261254 cites W2127791051 @default.
• W2016261254 cites W2131517280 @default.
• W2016261254 cites W2143883087 @default.
• W2016261254 cites W2148514834 @default.
• W2016261254 cites W2151896618 @default.
• W2016261254 cites W2154307789 @default.
• W2016261254 cites W2166043441 @default.
• W2016261254 doi "https://doi.org/10.1074/jbc.m405470200" @default.
• W2016261254 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15229220" @default.
• W2016261254 hasPublicationYear "2004" @default.
• W2016261254 type Work @default.
• W2016261254 sameAs 2016261254 @default.
• W2016261254 citedByCount "85" @default.
• W2016261254 countsByYear W20162612542012 @default.
• W2016261254 countsByYear W20162612542013 @default.
• W2016261254 countsByYear W20162612542014 @default.
• W2016261254 countsByYear W20162612542015 @default.
• W2016261254 countsByYear W20162612542016 @default.
• W2016261254 countsByYear W20162612542017 @default.
• W2016261254 countsByYear W20162612542018 @default.
• W2016261254 countsByYear W20162612542019 @default.
• W2016261254 countsByYear W20162612542020 @default.
• W2016261254 countsByYear W20162612542021 @default.
• W2016261254 countsByYear W20162612542022 @default.
• W2016261254 countsByYear W20162612542023 @default.
• W2016261254 crossrefType "journal-article" @default.
• W2016261254 hasAuthorship W2016261254A5010400831 @default.
• W2016261254 hasAuthorship W2016261254A5012264926 @default.
• W2016261254 hasAuthorship W2016261254A5026945051 @default.

• next