FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016346332> ?p ?o ?g. }

• W2016346332 endingPage "19675" @default.
• W2016346332 startingPage "19667" @default.
• W2016346332 abstract "Agonist-mediated receptor phosphorylation by one or more of the members of the G-protein receptor kinase (GRK) family is an established model for G-protein-coupled receptor (GPCR) phosphorylation resulting in receptor desensitization. Our recent studies have, however, suggested that an alternative route to GPCR phosphorylation may be an operation involving casein kinase 1α (CK1α). In the current study we investigate the involvement of CK1α in the phosphorylation of the human m3-muscarinic receptor in intact cells. We show that expression of a catalytically inactive mutant of CK1α, designed to act in a dominant negative manner, inhibits agonist-mediated receptor phosphorylation by ∼40% in COS-7 and HEK-293 cells. Furthermore, we present evidence that a peptide corresponding to the third intracellular loop of the m3-muscarinic receptor (Ser345-Leu463) is an inhibitor of CK1α due to its ability to both act as a pseudo-substrate for CK1α and form a high affinity complex with CK1α. Expression of this peptide was able to reduce both basal and agonist-mediated m3-muscarinic receptor phosphorylation in intact cells. These results support the notion that CK1α is able to mediate GPCR phosphorylation in an agonist-dependent manner and that this may provide a novel mechanism for GPCR phosphorylation. The functional role of phosphorylation was investigated using a mutant of the m3-muscarinic receptor that showed an ∼80% reduction in agonist-mediated phosphorylation. Surprisingly, this mutant underwent agonist-mediated desensitization suggesting that, unlike many GPCRs, desensitization of the m3-muscarinic receptor is not mediated by receptor phosphorylation. The inositol (1,4,5)-trisphosphate response did, however, appear to be dramatically potentiated in the phosphorylation-deficient mutant indicating that phosphorylation may instead control the magnitude of the initial inositol phosphate response. Agonist-mediated receptor phosphorylation by one or more of the members of the G-protein receptor kinase (GRK) family is an established model for G-protein-coupled receptor (GPCR) phosphorylation resulting in receptor desensitization. Our recent studies have, however, suggested that an alternative route to GPCR phosphorylation may be an operation involving casein kinase 1α (CK1α). In the current study we investigate the involvement of CK1α in the phosphorylation of the human m3-muscarinic receptor in intact cells. We show that expression of a catalytically inactive mutant of CK1α, designed to act in a dominant negative manner, inhibits agonist-mediated receptor phosphorylation by ∼40% in COS-7 and HEK-293 cells. Furthermore, we present evidence that a peptide corresponding to the third intracellular loop of the m3-muscarinic receptor (Ser345-Leu463) is an inhibitor of CK1α due to its ability to both act as a pseudo-substrate for CK1α and form a high affinity complex with CK1α. Expression of this peptide was able to reduce both basal and agonist-mediated m3-muscarinic receptor phosphorylation in intact cells. These results support the notion that CK1α is able to mediate GPCR phosphorylation in an agonist-dependent manner and that this may provide a novel mechanism for GPCR phosphorylation. The functional role of phosphorylation was investigated using a mutant of the m3-muscarinic receptor that showed an ∼80% reduction in agonist-mediated phosphorylation. Surprisingly, this mutant underwent agonist-mediated desensitization suggesting that, unlike many GPCRs, desensitization of the m3-muscarinic receptor is not mediated by receptor phosphorylation. The inositol (1,4,5)-trisphosphate response did, however, appear to be dramatically potentiated in the phosphorylation-deficient mutant indicating that phosphorylation may instead control the magnitude of the initial inositol phosphate response. G-protein-coupled receptor casein kinase 1α G-protein-coupled receptor kinase 4,5)P3, inositol (1,4,5) trisphosphate Chinese hamster ovary polyacrylamide gel electrophoresis glutathioneS-transferase It is now well established that G-protein-coupled receptor (GPCR)1 phosphorylation is a general phenomenon that controls specific key signaling properties of receptors. Originally associated with receptor desensitization (1.Tobin A.B. Pharmacol. Ther. 1997; 75: 135-151Crossref PubMed Scopus (47) Google Scholar, 2.Pitcher J.A. Freedman N.J. Lefkowitz R.J. Annu. Rev. Biochem. 1998; 67: 653-692Crossref PubMed Scopus (1070) Google Scholar), GPCR phosphorylation has now been implicated in a number of processes including receptor internalization (3.Tsuga H. Kameyama K. Haga T. Kurise H. Nagao T. J. Biol. Chem. 1994; 269: 32522-32527Abstract Full Text PDF PubMed Google Scholar, 4.Ruiz-Gomez A. Mayor Jr., F. J. Biol. Chem. 1997; 272: 9601-9604Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 5.Tsuga H. Okuno E. Kameyama K. Haga T. Mol. Pharmacol. 1998; 284: 1218-1226Google Scholar, 6.Tsuga H. Kameyama K. Haga T. Honma T. Lameh J. Sadee W. J. Biol. Chem. 1998; 273: 5323-5330Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar) and as a molecular switch that determines coupling to specific signaling pathways (7.Daaka Y. Luttrell L.M. Lefkowitz R.J. Nature. 1997; 390: 88-91Crossref PubMed Scopus (1073) Google Scholar, 8.Luttrell L.M. Ferguson S.S.G. Daaka Y. Miller W.E. Maudsley S. Della Rocca G.J. Lin F.-T. Kawakatsu H. Owada K. Luttrell D.K. Caron M.G. Lefkowitz R.J. Science. 1999; 283: 655-660Crossref PubMed Scopus (1264) Google Scholar). The receptor-specific kinases involved are generally considered to belong to the G-protein-coupled receptor kinase (GRK) family which are characterized by their sequence homology to rhodopsin kinase (GRK-1) and that include the extensively studied β-adrenergic receptor kinases 1 and 2 (GRK-2 and -3, respectively) (2.Pitcher J.A. Freedman N.J. Lefkowitz R.J. Annu. Rev. Biochem. 1998; 67: 653-692Crossref PubMed Scopus (1070) Google Scholar, 9.Lefkowitz R.J. Cell. 1993; 74: 409-412Abstract Full Text PDF PubMed Scopus (403) Google Scholar). Reconstitution experiments using purified, or partially purified, receptors have demonstrated that in addition to the β2-adrenergic receptor a number of GPCRs including muscarinic ((10–12), substance P (13.Kwatra M.M. Schwinn D.A. Schreurs J. Blank J.L. Kim C.M. Benovic J.L. Krausse J.E. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1993; 268: 9161-9164Abstract Full Text PDF PubMed Google Scholar), bradykinin B2 (14.Blaukat A. Alla S.A. Lohse M.J. Muller-Esterl W. J. Biol. Chem. 1996; 271: 32366-32374Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar), and adenosine A3receptors (15.Palmer T.M. Benovic J.L. Stiles G.L. J. Biol. Chem. 1995; 270: 29607-29613Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar) can act as GRK substrates. Furthermore, a GRK-2 dominant negative mutant (16.Kong G. Penn R. Benovic J.L. J. Biol. Chem. 1994; 269: 13084-13087Abstract Full Text PDF PubMed Google Scholar) has been widely employed to probe the role of endogenous GRK-2 in the regulation of GPCRs (3.Tsuga H. Kameyama K. Haga T. Kurise H. Nagao T. J. Biol. Chem. 1994; 269: 32522-32527Abstract Full Text PDF PubMed Google Scholar, 17.Diviani D. Lattion A.-L. Kunapuli P. Pronin A. Benovic J.L. Cotecchia S. J. Biol. Chem. 1996; 271: 5049-5058Abstract Full Text Full Text PDF PubMed Scopus (163) Google Scholar, 18.Oppermann M. Freedman N.J. Alexander W.R. Lefkowitz R.J. J. Biol. Chem. 1996; 271: 13266-13272Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar, 19.Freedman N.J. Ament A.S. Oppermann M. Stoffel R.H. Exum S.T. Lefkowitz R.J. J. Biol. Chem. 1997; 272: 17734-17743Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). These studies, and others, have led to the proposal that the GRKs, and in particular GRK-2, have a broad receptor substrate specificity and are able to phosphorylate and regulate GPCRs coupled to both adenylyl cyclase via Gs/i and those coupled to the phospholipase C pathway via Gq/11. In contrast to this model of GRK-mediated phosphorylation of GPCRs, our studies on the Gq/11-coupled m3-muscarinic receptor have suggested that there may be an alternative mechanism mediating agonist-dependent receptor phosphorylation. This receptor is rapidly phosphorylated on serine following agonist addition (20.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar) with a time course that closely correlates with receptor desensitization as measured by diminished inositol (1,4,5)-trisphosphate (Ins(1,4,5)P3) and intracellular calcium responses (21.Tobin A.B. Lambert D.G. Nahorski S.R. Mol. Pharmacol. 1992; 42: 1042-1048PubMed Google Scholar). Initial characterization of the kinase involved in this phosphorylation event eliminated a role for protein kinase A, protein kinase C, and Ca2+/calmodulin-dependent protein kinase (20.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). Crude membranes prepared from CHO cells expressing recombinant m3-muscarinic receptor were also found to contain receptor kinase activity and that this activity was insensitive to inhibition by heparin and zinc at concentrations that were known to inhibit GRK-2 activity (22.Tobin A.B. Keys B. Nahorski S.R. FEBS Lett. 1993; 335: 353-357Crossref PubMed Scopus (22) Google Scholar). These were the first data suggesting that the m3-muscarinic receptor was phosphorylated by a kinase that was distinct from GRK-2. By using a bacterial fusion protein of the third intracellular loop of the m3-muscarinic receptor as a pseudo-substrate for the “putative” muscarinic receptor kinase, we were able to purify, from porcine cerebellum, a 40-kDa protein kinase that in membrane reconstitution experiments was able to phosphorylate the m3-muscarinic receptor in an agonist-dependent manner (23.Tobin A.B. Keys B. Nahorski S.R. J. Biol. Chem. 1996; 271: 3907-3916Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Amino acid sequence analysis identified this protein kinase as casein kinase 1α (CK1α) (24.Tobin A.B. Totty N.F. Sterlin A.E. Nahorski S.R. J. Biol. Chem. 1997; 272: 20844-20849Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Importantly, the ability of CK1α to drive receptor phosphorylation was not restricted to the m3-muscarinic receptor since both rhodopsin and the m1-muscarinic receptor were also shown to be in vitro substrates that were phosphorylated in a stimulus-dependent manner (24.Tobin A.B. Totty N.F. Sterlin A.E. Nahorski S.R. J. Biol. Chem. 1997; 272: 20844-20849Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 25.Waugh M.G. Challiss R.A.J. Berstein G. Nahorski S.R. Tobin A.B. J. Biochem. (Tokyo). 1999; 338: 175-183Crossref Google Scholar). These in vitro studies suggested that CK1α may act as a cellular kinase for specific GPCRs, thereby offering an alternative and distinct route to GPCR phosphorylation from that of the GRKs. In the present study we explore this hypothesis further by using a catalytically inactive mutant of CK1α and a peptide corresponding to the third intracellular loop of the m3-muscarinic receptor to inhibit endogenous CK1α activity. These experiments provide evidence for a cellular role of CK1α in the phosphorylation and regulation of the m3-muscarinic receptor. COS-7, HEK-293, and CHO cells were grown in medium consisting of α-minimum Eagle's medium supplemented with 10% fetal calf serum, 100 IU/ml penicillin, 100 μg/ml streptomycin, and 2.5 μg/ml fungizone. Cells were grown in a 5% CO2, 95% air, humidified incubator at 37 °C. Wild type bovine casein kinase 1α that had been tagged at the N terminus with the FLAG epitope (F-CK1α) and cloned into pcDNA-3 (Invitrogen, see Ref. 24.Tobin A.B. Totty N.F. Sterlin A.E. Nahorski S.R. J. Biol. Chem. 1997; 272: 20844-20849Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar) was used as a template for the Quikchange site-directed mutagenesis kit (Stratagene). The mutagenesis primer used was GAGGAGGTGGCAGTGCGACTAGAATCCCAGAAGGCGAGGCATCCCCAGTTG. This created a Lys-Arg change at position 46 in the amino acid sequence of CK1α. The resulting construct F-CK1αK46R was contained in pcDNA-3 and also possessed a FLAG epitope tag on the N terminus. The mutation was confirmed by DNA sequencing. The sequence encoding amino acids Ser345–Leu463 from the third intracellular loop of the m3-muscarinic receptor was amplified using the polymerase chain reaction primers, 5′ primer, GGGGGTACCGCCACCATGTCCCTGGAGAACTCCGCCTCCTCCGAC, and 3′ primer, GGGTCTAGACTACAGAGTGGCTTCCTTGAAGGACAGAGG, and cloned intoKpnI and XbaI sites in pcDNA-3. The resulting construct was then used in transient transfections of HEK-293 cells or COS-7 cells or used to make stably expressing CHO cell lines. The m3-muscarinic receptor coding sequence contained in pcDNA-3 was digested with HindIII and then religated. This removed the coding sequence for amino acids Lys370–Ser425inclusive but maintained the reading frame of the remaining cDNA. Generation of the GST bacterial fusion proteins used in this study have been described previously (23.Tobin A.B. Keys B. Nahorski S.R. J. Biol. Chem. 1996; 271: 3907-3916Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). Production and characterization of the m3-muscarinic receptor specific antiserum raised against residues Ser345–Leu463 in the third intracellular loop of the m3-muscarinic receptor has been previously described (20.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). The pan-M antiserum was raised against a peptide (DRYFSVTRPLSYRAKRTPRC) corresponding to amino acids Asp122–Arg140 of the m1-muscarinic receptor. This sequence is conserved in the muscarinic receptor family, and the resulting antiserum would be expected to cross-react with all of the muscarinic receptor subtypes. The peptide was conjugated to Keyhole Limpet hemocyanin and injected into New Zealand White rabbits using standard protocols. Characterization of the antiserum using Western blots showed that the pan-M antiserum cross-reacted with the m1 and m3 muscarinic receptors. This antibody was used in immunoprecipitations where the phosphorylation of the Lys370–Ser425 deletion mutant was investigated. The CK1α-specific antiserum was raised against a peptide corresponding to the N terminus of bovine CK1α (MASSSGSKAEFIVGGKYKLC). Characterization of the antiserum using Western blots showed that it was able to cross-react with purified recombinant bovine CK1α and endogenous CK1α present in CHO, HEK-293, COS-7 cells, and rat brain. Cells were plated onto 12-well dishes 24 h before transfection (cells were 40–60% confluent at the start of transfection). Cells were transfected with m3-muscarinic receptor cDNA (contained in pcDNA-3) or co-transfected with m3-muscarinic receptor plus F-CK1αK46R or 3i loop peptide constructs. The transfection reagent used was Fugene (Roche Molecular Biochemicals) using a total DNA concentration of 0.5 μg/well. In experiments to determine inositol (1,4,5)-trisphosphate levels, HEK-293 cells were plated onto 24-well dishes, and each well was transfected with 0.25 μg of DNA. Cells were used 48–72 h after transfection. CHO-K1 cells were transfected with the 3i loop peptide construct (described above) using the Fugene method. Clones expressing the peptide were selected in G418 (200 μg/ml) and screened for expression by Western blot using the m3-muscarinic receptor antiserum that was raised against this peptide (20.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). The resulting stably transfected clones were then used in experiments where the m3-muscarinic receptor was transiently transfected. Cells plated onto 12-well dishes were washed in phosphate-free Krebs/HEPES buffer (10 mmHEPES, 118 mm NaCl, 4.3 mm KCl, 1.17 mm MgSO4·7H2O, 1.3 mmCaCl2, 25.0 mm NaHCO3, 11.7 mm glucose, pH 7.4) and incubated in phosphate-free Krebs/HEPES supplemented with [32P]orthophosphate (50 μCi/ml) for 1–2 h at 37 °C. Either vehicle or the cholinergic agonist, carbachol (0.1 mm), was added, and incubations were continued for a further 5 min. Reactions were terminated by rapid aspiration of the drug-containing media and application of 1 ml of ice-cold solubilization buffer (10 mm Tris, 10 mm EDTA, 500 mm NaCl, 1% Nonidet P-40, 0.5% deoxycholate, pH 7.4). Samples were left on ice for 15 min and then cleared by microcentrifugation. Antiserum (0.2 μg) was added, and the samples were left on ice for 60–90 min. Immune complexes were isolated on protein A-Sepharose beads, and the beads were washed three times with TE buffer (10 mm Tris-HCl, 10 mm EDTA, pH 7.4). In the case of receptor immunoprecipitations, the protein A-Sepharose pellet was then resuspended in 1 ml of TE, and an aliquot of the protein A slurry was removed corresponding to a known quantity of receptors as determined by radioreceptor assay (see below). This ensured that for each experiment the same number of receptors from each transfection was run on the gel. Isolated immune complexes were then resolved on 8% SDS-PAGE gels in the case of muscarinic receptors or 15% gels for the 3i loop peptide. The gels were dried and subjected to autoradiography, and the level of phosphorylation was assessed with a Bio-Rad model GS 670 densitometer. m3-Muscarinic receptor expression for each transfection was determined by incubating cells plated down onto 12-well dishes with 0.5 ml of Krebs/HEPES buffer (as above but containing KH2PO4 1.17 mm) containing a saturating concentration of muscarinic receptor antagonist [3H]N-methylscopolamine (∼0.5 nm) for 60 min at 37 °C. Cells were washed with ice-cold Krebs/HEPES buffer (3 times), and bound [3H]N-methylscopolamine was determined by liquid scintillation counting of cell extracts solubilized in solubilization buffer. Nonspecific binding was determined in the presence of 10 μm atropine and was <3% of the total binding. Cells grown in 24-well dishes were washed with Krebs/HEPES buffer and challenged with agonist for the appropriate times. Incubations were terminated by rapid aspiration, addition of ice-cold 0.5 m trichloroacetic acid, and transfer to an ice bath. After 15 min the supernatant was removed and neutralized by addition of EDTA and Freon/tri-N-octylamine as described previously (21.Tobin A.B. Lambert D.G. Nahorski S.R. Mol. Pharmacol. 1992; 42: 1042-1048PubMed Google Scholar). Extracts were brought to pH 7 by addition of NaHCO3 and stored at 4 °C until analysis. Ins(1,4,5)P3 mass measurements were performed using a radioreceptor assay described previously (26.Challiss R.A.J. Batty I.H. Nahorski S.R. Biochem. Biophys. Res. Commun. 1988; 157: 684-691Crossref PubMed Scopus (162) Google Scholar). The hippocampus and cerebral cortex from one rat was homogenized in 15 ml of TE buffer (10 mm Tris-HCl, 2.5 mm EDTA, pH 7.4) by a 5-s pulse in a Polytron (maximum setting). A soluble brain fraction was prepared by centrifugation at 50,000 × g for 15 min. The supernatant was taken and used in the pull down experiment. GST-m3-muscarinic receptor fusion proteins (5 μg) were incubated with soluble rat brain extract (50 μg) for 1 h at 4 °C. GST fusion protein complexes were isolated on glutathione-Sepharose beads and washed three times in TE buffer. Beads were resuspended in Laemmli buffer and resolved by 12% SDS-PAGE. The presence of CK1α was then determined by Western blot using the casein kinase 1α-specific antibody. HEK-293 cells were transiently transfected with either recombinant bovine FLAG-tagged F-CK1α, FLAG-tagged F-CK1αK46R, or vehicle. 72 h after transfection cells were lysed with 1 ml of ice-cold lysis buffer (20 mmTris-HCl, 0.5% Nonidet P-40, 250 mm NaCl, 3 mmEDTA, 3 mm EGTA, 2 mmNa3VO4, 1 mm dithiothreitol, 1 mm phenylmethylsulfonyl fluoride, pH 7.6). The lysate was centrifuged at 21,000 × g for 5 min at 4 °C and the pellet discarded. To the lysate was added mouse M2 anti-FLAG antibody (0.1 μg) for 1 h at 4 °C followed by rabbit anti-mouse IgG (1 μg) for 20 min at 4 °C. The immune complexes isolated on protein A-Sepharose beads and washed twice with lysis buffer and twice with kinase buffer (10 mm Tris-HCl, 1 mmMgCl2, pH 7.4). The immune complex was then used in a kinase assay by resuspending the protein A beads in kinase buffer containing 20 μm [γ-32P]ATP (2.5 μCi/nmol), 5 μg of α-casein (total volume = 30 μl). The reactions were allowed to proceed for 15 min at 37 °C and were terminated by the addition of Laemmli buffer (10 μl). Samples were resolved on a 12% SDS-PAGE gel which were then stained with Coomassie Blue to visualize α-casein, and an autoradiograph was obtained. To investigate whether the cellular kinase responsible for m3-muscarinic receptor phosphorylation was CK1α, we tested the ability of a catalytically inactive form of CK1α to inhibit agonist-mediated m3-muscarinic receptor phosphorylation. Lysine 46 in bovine CK1α corresponds to the conserved lysine found at the ATP-binding site of all protein kinases (27.Carrera A.C. Alexandrov K. Roberts T.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 442-445Crossref PubMed Scopus (163) Google Scholar). By point mutagenesis we constructed a lysine to arginine mutation at position 46 (called F-CK1αK46R) that would be predicted to result in a catalytically inactive kinase. Expression of F-CK1αK46R was confirmed in transiently transfected HEK-293 cells by Western blotting for the FLAG epitope that was engineered at the N terminus (Fig.1 A). Due to the epitope tag the recombinant mutant ran at a slightly higher molecular mass than the endogenous CK1α. Hence by Western blotting with a polyclonal CK1α antiserum that detected both endogenous CK1α and recombinant mutant kinase, we estimated that F-CK1αK46R and endogenous CK1α were expressed at approximately equivalent levels (Fig. 1 B). Similar results were obtained for F-CK1αK46R expressed in COS-7 cells (data not shown). In order to determine enzymatic activity, HEK-293 cells were transiently transfected with recombinant bovine F-CK1α or F-CK1αK46R, both of which were tagged at the N terminus with the FLAG epitope. In vitro kinases assays on FLAG antiserum immunoprecipitates revealed that the F-CK1αK46R had no detectable kinase activity (Fig. 1 C). Human m3-muscarinic receptors transfected into HEK-293 or COS-7 cells were phosphorylated in an agonist-dependent manner by endogenous protein kinase(s) (Fig. 2). Co-transfection of the m3-muscarinic receptor with F-CK1αK46R resulted in a decrease in agonist-mediated receptor phosphorylation by 40.1 ± 2.0% (n = 3, ±S.E.) and 43.1 ± 3.5% (n = 3, ±S.E.) in HEK-293 cells and COS-7 cells, respectively (Fig. 2). In these experiments cells were stimulated with a maximum concentration of agonist (carbachol; 100 μm) for 5 min, conditions that we have previously reported results in maximum phosphorylation of the receptor (20.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar). In each experiment receptor expression was determined, and the amount of receptor applied to the gel was adjusted so that equal receptor numbers were run on the gel. Co-expression of the F-CK1αK46R with the receptor did not influence the level of m3-muscarinic receptor expression. Any differences we observed in the level of receptor expression between control and co-transfected cells (usually <30%) were probably due to experimental variations in transfection efficiencies. Earlier studies from our laboratory demonstrated that a bacterial fusion protein containing a portion of the third intracellular loop of the m3-muscarinic receptor (Ser345–Leu463) was able to inhibit CK1α-mediated muscarinic receptor phosphorylation in membranes (Ref. 23.Tobin A.B. Keys B. Nahorski S.R. J. Biol. Chem. 1996; 271: 3907-3916Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar; also see “Discussion”). Here we tested the ability of this peptide to inhibit m3-muscarinic receptor phosphorylation in intact cells. Expression of the transfected peptide, of ∼12.5 kDa, corresponding to amino acids Ser345–Leu463 (3i loop peptide) of the m3-muscarinic receptor was detected by Western blotting using an m3-muscarinic receptor antiserum that was raised against this peptide (20.Tobin A.B. Nahorski S.R. J. Biol. Chem. 1993; 268: 9817-9823Abstract Full Text PDF PubMed Google Scholar) (Fig. 3). Transient co-expression of m3-muscarinic receptors with the 3i loop peptide in COS-7 cells resulted in a decrease in agonist-mediated m3-muscarinic receptor phosphorylation by 72.0 ± 5.9% (n = 3, ±S.E.) (Fig. 4). Interestingly, the basal phosphorylation seen in COS-7 cells was also reduced (∼60%) by the 3i loop peptide (Fig. 4). In HEK-293 cells m3-muscarinic receptor phosphorylation was also inhibited by expression of the 3i loop peptide, in this case by 45.9 ± 2.9% (n = 3, ±S.E.) (Fig. 4).Figure 4Expression of the 3i loop peptide reduces basal and agonist-mediated phosphorylation of the m3-muscarinic receptor. Cells expressing the m3-muscarinic receptor alone (CNT) or co-transfected with the 3i loop peptide (3i-P) were prelabeled with [32P]orthophosphate and stimulated with 0.1 mm carbachol (CCh) for 5 min. m3-muscarinic receptor phosphorylation was then determined by immunoprecipitation using an m3-muscarinic receptor antiserum. An equal number of muscarinic receptors was then applied to an 8% SDS-PAGE gel, and an autoradiograph was obtained. A, a representative gel from an experiment using transiently transfected COS-7 cells. In this example m3-muscarinic receptor levels were ∼1.7 pmol/mg protein.B, a representative gel from an experiment using transiently transfected HEK-293 cells. In this example m3-muscarinic receptor levels were ∼1.2 pmol/mg protein. C, a representative gel from an experiment where native CHO-K1 cells (CNT) or cells that were stably expressing the 3i loop peptide (3i-P) were transiently transfected with the m3-muscarinic receptor. In the experiment shown m3-muscarinic receptor levels were ∼0.5 pmol/mg protein. The data shown are representative of at least three experiments. The position of molecular mass markers are shown in kilodaltons.View Large Image Figure ViewerDownload Hi-res image Download (PPT) We also developed a stable CHO cell line that expressed the 3i loop peptide constitutively. This cell line was transiently transfected with the m3-muscarinic receptor and receptor phosphorylation compared with native CHO-K1 cells transiently transfected with the receptor. In these experiments expression of the 3i loop peptide reduced agonist-mediated phosphorylation of the m3-muscarinic receptor by 75.2 ± 3.4% (n = 4, ±S.E.). Furthermore, basal phosphorylation was also reduced in the presence of the 3i loop peptide (by ∼50%). The 3i loop peptide expressed in CHO cells was itself phosphorylated, but this phosphorylation was not altered by m3-muscarinic receptor stimulation (Fig. 5). The same results were obtained in COS-7 and HEK-293 cells (data not shown). CK1α contained in a crude soluble rat brain fraction specifically associated with the muscarinic receptor portion of a glutathione S-transferase (GST) bacterial fusion protein that contains the third intracellular loop sequence Ser345–Leu463, designated Ex-m3 (Fig.6). This interaction appeared particularly strong since washes in salt (KCl) up to a concentration of 2 m was not sufficient to disrupt binding of CK1α (data not shown). Deletion mutants of Ex-m3 were used to map the binding site of CK1α (Fig. 7 A). Truncation at the N- and C-terminals of Ex-m3 did not affect the ability of the fusion protein to interact with CK1α present in rat brain supernatant (Fig. 7 B) or recombinant bovine CK1α partially purified from infected sf-9 cells (data not shown). However, deletion of the region Lys370–Ser425(ΔLys370–Ser425) resulted in no detectable binding of CK1α (Fig. 7 B). A smaller deletion of 18 amino acids (His374–Val391) also resulted in a fusion protein that was unable to associate with CK1α (Fig.7 B). (Note, the identity of the doublet in the Ex-m3 pull down (lane 2, Fig. 7 C) is likely to be CK1α running at its correct molecular mass (the lower band) and CK1α that is still associated with Ex-m3 (upper band). The doublet in lane 5 (Fig. 7 C) is likely to be CK1α (the upper band) and an unknown protein that cross-reacts with the CK1α antiserum (lower band).)Figure 7Determination of the site of interaction between CK1α and the third intracellular loop of the m3-muscarinic receptor. A, diagrammatic representation of the muscarinic receptor portion of the GST fusion proteins showing deleted regions. Also shown in trianglesare the positions of the serine residues. B, Coomassie Blue stain of the fusion proteins used in the GST fusion protein pull down assay. C, immunodetection of CK1α isolated from pull down experiments where fusion proteins (5 μg) were incubated with rat brain lysate (50 μg of protein). The data shown are representative of four experiments. The position of molecular mass markers are shown in kilodaltons. Key to lanes, lane CK1α, purified recombinant F-CK1α standard; lane B, no fusion protein added; lane 1, GST; lane 2, Ex-m3; lane 3, ΔLys370–Ser425; lane 4,Ex-345–427; lane 5, Ex-376–463; lane 6,ΔHis376–Val391.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Our previous studies have demonstrated that CK1α-mediated phosphorylation of the bacterial fusion protein ΔLys370–Ser425 is reduced fr" @default.
• W2016346332 created "2016-06-24" @default.
• W2016346332 creator A5014033382 @default.
• W2016346332 creator A5035925879 @default.
• W2016346332 creator A5056696512 @default.
• W2016346332 date "2000-06-01" @default.
• W2016346332 modified "2023-10-18" @default.
• W2016346332 title "Phosphorylation and Regulation of a Gq/11-coupled Receptor by Casein Kinase 1α" @default.
• W2016346332 cites W1496517521 @default.
• W2016346332 cites W1501279556 @default.
• W2016346332 cites W1503310668 @default.
• W2016346332 cites W1504684037 @default.
• W2016346332 cites W1504756577 @default.
• W2016346332 cites W1517012554 @default.
• W2016346332 cites W1532095908 @default.
• W2016346332 cites W1538620682 @default.
• W2016346332 cites W1576437832 @default.
• W2016346332 cites W1593834989 @default.
• W2016346332 cites W1622227958 @default.
• W2016346332 cites W1769585641 @default.
• W2016346332 cites W1963640930 @default.
• W2016346332 cites W1969728996 @default.
• W2016346332 cites W1970057376 @default.
• W2016346332 cites W1986284688 @default.
• W2016346332 cites W1987282836 @default.
• W2016346332 cites W1991863849 @default.
• W2016346332 cites W1997049897 @default.
• W2016346332 cites W1998132966 @default.
• W2016346332 cites W2000519199 @default.
• W2016346332 cites W2008795750 @default.
• W2016346332 cites W2013967645 @default.
• W2016346332 cites W2026532782 @default.
• W2016346332 cites W2031610113 @default.
• W2016346332 cites W2032058654 @default.
• W2016346332 cites W2035293723 @default.
• W2016346332 cites W2037212988 @default.
• W2016346332 cites W2053949782 @default.
• W2016346332 cites W2073404673 @default.
• W2016346332 cites W2076156732 @default.
• W2016346332 cites W2114164301 @default.
• W2016346332 cites W2114511731 @default.
• W2016346332 cites W2122412269 @default.
• W2016346332 cites W2151312020 @default.
• W2016346332 cites W2184365627 @default.
• W2016346332 cites W2614496215 @default.
• W2016346332 doi "https://doi.org/10.1074/jbc.m000492200" @default.
• W2016346332 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10777483" @default.
• W2016346332 hasPublicationYear "2000" @default.
• W2016346332 type Work @default.
• W2016346332 sameAs 2016346332 @default.
• W2016346332 citedByCount "67" @default.
• W2016346332 countsByYear W20163463322012 @default.
• W2016346332 countsByYear W20163463322013 @default.
• W2016346332 countsByYear W20163463322015 @default.
• W2016346332 countsByYear W20163463322016 @default.
• W2016346332 countsByYear W20163463322017 @default.
• W2016346332 countsByYear W20163463322019 @default.
• W2016346332 countsByYear W20163463322020 @default.
• W2016346332 countsByYear W20163463322022 @default.
• W2016346332 countsByYear W20163463322023 @default.
• W2016346332 crossrefType "journal-article" @default.
• W2016346332 hasAuthorship W2016346332A5014033382 @default.
• W2016346332 hasAuthorship W2016346332A5035925879 @default.
• W2016346332 hasAuthorship W2016346332A5056696512 @default.
• W2016346332 hasBestOaLocation W20163463321 @default.
• W2016346332 hasConcept C11960822 @default.
• W2016346332 hasConcept C135285700 @default.
• W2016346332 hasConcept C143910341 @default.
• W2016346332 hasConcept C160110348 @default.
• W2016346332 hasConcept C185592680 @default.
• W2016346332 hasConcept C62478195 @default.
• W2016346332 hasConcept C66135807 @default.
• W2016346332 hasConcept C86803240 @default.
• W2016346332 hasConcept C90934575 @default.
• W2016346332 hasConcept C95444343 @default.
• W2016346332 hasConcept C97029542 @default.
• W2016346332 hasConceptScore W2016346332C11960822 @default.
• W2016346332 hasConceptScore W2016346332C135285700 @default.
• W2016346332 hasConceptScore W2016346332C143910341 @default.
• W2016346332 hasConceptScore W2016346332C160110348 @default.
• W2016346332 hasConceptScore W2016346332C185592680 @default.
• W2016346332 hasConceptScore W2016346332C62478195 @default.
• W2016346332 hasConceptScore W2016346332C66135807 @default.
• W2016346332 hasConceptScore W2016346332C86803240 @default.
• W2016346332 hasConceptScore W2016346332C90934575 @default.
• W2016346332 hasConceptScore W2016346332C95444343 @default.
• W2016346332 hasConceptScore W2016346332C97029542 @default.
• W2016346332 hasIssue "26" @default.
• W2016346332 hasLocation W20163463321 @default.
• W2016346332 hasOpenAccess W2016346332 @default.
• W2016346332 hasPrimaryLocation W20163463321 @default.
• W2016346332 hasRelatedWork W1640595204 @default.
• W2016346332 hasRelatedWork W1997721198 @default.
• W2016346332 hasRelatedWork W2016589632 @default.
• W2016346332 hasRelatedWork W2063847108 @default.
• W2016346332 hasRelatedWork W2067225628 @default.
• W2016346332 hasRelatedWork W2067652401 @default.
• W2016346332 hasRelatedWork W2071735058 @default.

• next