FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016367715> ?p ?o ?g. }

• W2016367715 endingPage "402" @default.
• W2016367715 startingPage "401" @default.
• W2016367715 abstract "Lipiarmycin (Lprm) (8), a macrocyclic antibiotic also known as tiacumicin (2), is currently under development under the name of OPT-80 (Optimer Pharmaceuticals, Inc., San Diego, Calif.) as a narrow-spectrum antibacterial agent to treat Clostridium difficile-associated diarrhea (1, 7).Lprm is a transcription inhibitor, but unlike rifampin and streptolydigin, it preferentially inhibits holoenzyme transcription at a much greater rate than it inhibits transcription of the core enzyme (5, 6). Genetic mapping experiments in Bacillus subtilis indicate that mutants are located between loci determining rifampin resistance and streptolydigin resistance (6). To precisely identify the positions of the mutations, we selected lipiarmycin-resistant colonies and sequenced the domains of the RNA polymerase located between these two loci.Lprm was produced and purified by fermentation of Actinoplanes deccanensis (DSMZ 43806) by the method of Talpaert et al. (8). Mutant strains were isolated as spontaneous variants of Bacillus subtilis CIP 52.62 that were able to form colonies on nutrient agar plates containing Lprm (40 μg/liter). At this concentration the frequency of resistant colonies was less than 10−7. Among the 10 resistant colonies selected, 8 exhibited an increased MIC for several classes of antibiotics and were likely to be permeability mutants (Table ​(Table1).1). Two mutants (mut1 and mut2) were highly resistant to Lprm.TABLE 1.Antibiotic resistance and transcription activity of Lprm-resistant Bacillus subtilisTo correlate the resistance phenotypes with the activity of Lprm on the RNA polymerase, we tested enzymes from the wild-type and mutant colonies in an in vitro transcription assay by the method of Sonenshein et al. (6). The parent cells (CIP 52.62) and mutant cells specifically resistant to Lprm (mut1 and mut2) showed the same pattern of sensitivity to rifampin. In contrast, the transcription activity of the wild-type cells was more strongly affected by the addition of Lprm than was the activity of either mut1 or mut2. This confirmed the link between resistance to Lprm resistance and transcription. mut3 to mut10 strains were equally sensitive to rifampin and Lprm, suggesting that the resistance was not due to a mutation in the polymerase.After purification of the genomic DNA, we PCR amplified and sequenced the regions located between the loci determining rifampin and streptolydigin resistance. The following primers were used: 5′-1285CGTGTGGTTCGTGAGAGAATGT1306-3′, 5′-3257TAAGCTTCAAGTGCCCAAACCT3236-3′, and 5′-2524CTTGTTGGTAAAGTAACGCCTA2545-3′ for rpoB and 5′-1163CGTTTCGCACTCTTAATGTTGTG1141-3′, 5′-593CACAAGGACAACGCCGTAC611-3′, and 5′-2804GTTAACTGTGTACCAGGCTCACC2782-3′ for rpoC. A point mutation resulting in the substitution of the R326 of rpoC by L (CG[T/C]TT) was found in mut1 and mut2 in a highly conserved region; no mutation was detected in mut3 to mut10. When the PCR product harboring the R326L mutation was transfected into B. subtilis CIP 52.62, the frequency of lipiarmycin-resistant bacteria was 100-fold higher than the frequency observed for bacteria with the wild-type fragment.By analogy with the three-dimensional structure of the Thermus aquaticus enzyme (3), R326 is located in proximity to region 3.2 of σ, which in turn occupies the same space as the exiting RNA transcript (3). This could delineate a new binding site for transcription inhibitors." @default.
• W2016367715 created "2016-06-24" @default.
• W2016367715 creator A5000771904 @default.
• W2016367715 creator A5006369115 @default.
• W2016367715 creator A5042256682 @default.
• W2016367715 creator A5083125764 @default.
• W2016367715 creator A5085438218 @default.
• W2016367715 date "2006-01-01" @default.
• W2016367715 modified "2023-09-30" @default.
• W2016367715 title "Mutation in the <i>Bacillus subtilis</i> RNA Polymerase β′ Subunit Confers Resistance to Lipiarmycin" @default.
• W2016367715 cites W1501465764 @default.
• W2016367715 cites W1675887579 @default.
• W2016367715 cites W2000361882 @default.
• W2016367715 cites W2037461115 @default.
• W2016367715 cites W2044370864 @default.
• W2016367715 cites W2104141482 @default.
• W2016367715 cites W2143641256 @default.
• W2016367715 doi "https://doi.org/10.1128/aac.50.1.401-402.2006" @default.
• W2016367715 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1346796" @default.
• W2016367715 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16377724" @default.
• W2016367715 hasPublicationYear "2006" @default.
• W2016367715 type Work @default.
• W2016367715 sameAs 2016367715 @default.
• W2016367715 citedByCount "40" @default.
• W2016367715 countsByYear W20163677152012 @default.
• W2016367715 countsByYear W20163677152013 @default.
• W2016367715 countsByYear W20163677152015 @default.
• W2016367715 countsByYear W20163677152016 @default.
• W2016367715 countsByYear W20163677152017 @default.
• W2016367715 countsByYear W20163677152018 @default.
• W2016367715 countsByYear W20163677152019 @default.
• W2016367715 countsByYear W20163677152020 @default.
• W2016367715 countsByYear W20163677152023 @default.
• W2016367715 crossrefType "journal-article" @default.
• W2016367715 hasAuthorship W2016367715A5000771904 @default.
• W2016367715 hasAuthorship W2016367715A5006369115 @default.
• W2016367715 hasAuthorship W2016367715A5042256682 @default.
• W2016367715 hasAuthorship W2016367715A5083125764 @default.
• W2016367715 hasAuthorship W2016367715A5085438218 @default.
• W2016367715 hasBestOaLocation W20163677151 @default.
• W2016367715 hasConcept C104292427 @default.
• W2016367715 hasConcept C104317684 @default.
• W2016367715 hasConcept C2776449523 @default.
• W2016367715 hasConcept C2777272437 @default.
• W2016367715 hasConcept C2777932965 @default.
• W2016367715 hasConcept C501734568 @default.
• W2016367715 hasConcept C523546767 @default.
• W2016367715 hasConcept C54355233 @default.
• W2016367715 hasConcept C552990157 @default.
• W2016367715 hasConcept C67705224 @default.
• W2016367715 hasConcept C82381507 @default.
• W2016367715 hasConcept C86803240 @default.
• W2016367715 hasConcept C89423630 @default.
• W2016367715 hasConceptScore W2016367715C104292427 @default.
• W2016367715 hasConceptScore W2016367715C104317684 @default.
• W2016367715 hasConceptScore W2016367715C2776449523 @default.
• W2016367715 hasConceptScore W2016367715C2777272437 @default.
• W2016367715 hasConceptScore W2016367715C2777932965 @default.
• W2016367715 hasConceptScore W2016367715C501734568 @default.
• W2016367715 hasConceptScore W2016367715C523546767 @default.
• W2016367715 hasConceptScore W2016367715C54355233 @default.
• W2016367715 hasConceptScore W2016367715C552990157 @default.
• W2016367715 hasConceptScore W2016367715C67705224 @default.
• W2016367715 hasConceptScore W2016367715C82381507 @default.
• W2016367715 hasConceptScore W2016367715C86803240 @default.
• W2016367715 hasConceptScore W2016367715C89423630 @default.
• W2016367715 hasIssue "1" @default.
• W2016367715 hasLocation W20163677151 @default.
• W2016367715 hasLocation W20163677152 @default.
• W2016367715 hasLocation W20163677153 @default.
• W2016367715 hasLocation W20163677154 @default.
• W2016367715 hasOpenAccess W2016367715 @default.
• W2016367715 hasPrimaryLocation W20163677151 @default.
• W2016367715 hasRelatedWork W1499736710 @default.
• W2016367715 hasRelatedWork W1572438202 @default.
• W2016367715 hasRelatedWork W1581659372 @default.
• W2016367715 hasRelatedWork W1631492904 @default.
• W2016367715 hasRelatedWork W1979252251 @default.
• W2016367715 hasRelatedWork W2087165666 @default.
• W2016367715 hasRelatedWork W2131907796 @default.
• W2016367715 hasRelatedWork W2145059589 @default.
• W2016367715 hasRelatedWork W3092030771 @default.
• W2016367715 hasRelatedWork W4235773025 @default.
• W2016367715 hasVolume "50" @default.
• W2016367715 isParatext "false" @default.
• W2016367715 isRetracted "false" @default.
• W2016367715 magId "2016367715" @default.
• W2016367715 workType "article" @default.