FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016403730> ?p ?o ?g. }

• W2016403730 endingPage "28822" @default.
• W2016403730 startingPage "28816" @default.
• W2016403730 abstract "Incubation of cells with insulin leads to a transient rise in Tyr phosphorylation of insulin receptor substrate (IRS) proteins, accompanied by elevation in their Ser(P)/Thr(P) content and their dissociation from the insulin receptor (IR). Wortmannin, a phosphatidylinositol 3-kinase inhibitor, selectively prevented the increase in Ser(P)/Thr(P) content of IRS-1, its dissociation from IR, and the decrease in its Tyr(P) content following 60 min of insulin treatment. Four conserved phosphorylation sites within the phosphotyrosine binding/SAIN domains of IRS-1 and IRS-2 served asin vitro substrates for protein kinase B (PKB), a Ser/Thr kinase downstream of phosphatidylinositol 3-kinase. Furthermore, PKB and IRS-1 formed stable complexes in vivo, and overexpression of PKB enhanced Ser phosphorylation of IRS-1. Overexpression of PKB did not affect the acute Tyr phosphorylation of IRS-1; however, it significantly attenuated its rate of Tyr dephosphorylation following 60 min of treatment with insulin. Accordingly, overexpression of IRS-14A, lacking the four potential PKB phosphorylation sites, markedly enhanced the rate of Tyr dephosphorylation of IRS-1, while inclusion of vanadate reversed this effect. These results implicate a wortmannin-sensitive Ser/Thr kinase, different from PKB, as the kinase that phosphorylates IRS-1 and acts as the feedback control regulator that turns off insulin signals by inducting the dissociation of IRS proteins from IR. In contrast, insulin-stimulated PKB-mediated phosphorylation of Ser residues within the phosphotyrosine binding/SAIN domain of IRS-1 protects IRS-1 from the rapid action of protein-tyrosine phosphatases and enables it to maintain its Tyr-phosphorylated active conformation. These findings implicate PKB as a positive regulator of IRS-1 functions. Incubation of cells with insulin leads to a transient rise in Tyr phosphorylation of insulin receptor substrate (IRS) proteins, accompanied by elevation in their Ser(P)/Thr(P) content and their dissociation from the insulin receptor (IR). Wortmannin, a phosphatidylinositol 3-kinase inhibitor, selectively prevented the increase in Ser(P)/Thr(P) content of IRS-1, its dissociation from IR, and the decrease in its Tyr(P) content following 60 min of insulin treatment. Four conserved phosphorylation sites within the phosphotyrosine binding/SAIN domains of IRS-1 and IRS-2 served asin vitro substrates for protein kinase B (PKB), a Ser/Thr kinase downstream of phosphatidylinositol 3-kinase. Furthermore, PKB and IRS-1 formed stable complexes in vivo, and overexpression of PKB enhanced Ser phosphorylation of IRS-1. Overexpression of PKB did not affect the acute Tyr phosphorylation of IRS-1; however, it significantly attenuated its rate of Tyr dephosphorylation following 60 min of treatment with insulin. Accordingly, overexpression of IRS-14A, lacking the four potential PKB phosphorylation sites, markedly enhanced the rate of Tyr dephosphorylation of IRS-1, while inclusion of vanadate reversed this effect. These results implicate a wortmannin-sensitive Ser/Thr kinase, different from PKB, as the kinase that phosphorylates IRS-1 and acts as the feedback control regulator that turns off insulin signals by inducting the dissociation of IRS proteins from IR. In contrast, insulin-stimulated PKB-mediated phosphorylation of Ser residues within the phosphotyrosine binding/SAIN domain of IRS-1 protects IRS-1 from the rapid action of protein-tyrosine phosphatases and enables it to maintain its Tyr-phosphorylated active conformation. These findings implicate PKB as a positive regulator of IRS-1 functions. Phosphorylation of insulin receptor substrate-1 (IRS-1) by protein kinase B positively regulates IRS-1 function.Journal of Biological ChemistryVol. 274Issue 45PreviewDr. Quon's name was spelled incorrectly. The correct spelling is shown above. Full-Text PDF Open Access The insulin receptor (IR) 1The abbreviations used are:IRinsulin receptorIRSinsulin receptor substrateIRS-1insulin receptor substrate-1IRS-2insulin receptor substrate-2IRS-14AIRS-1 whose Ser residues 265, 302, 325, and 358 were mutated to AlaJMjuxtamembranePTBphosphotyrosine bindingPKBprotein kinase B, PI3K, phosphatidylinositol 3-kinasePTPprotein Tyr phosphatasePKCprotein kinase CCHOChinese hamster ovaryPAGEpolyacrylamide gel electrophoresisFPLCfast protein liquid chromatography 1The abbreviations used are:IRinsulin receptorIRSinsulin receptor substrateIRS-1insulin receptor substrate-1IRS-2insulin receptor substrate-2IRS-14AIRS-1 whose Ser residues 265, 302, 325, and 358 were mutated to AlaJMjuxtamembranePTBphosphotyrosine bindingPKBprotein kinase B, PI3K, phosphatidylinositol 3-kinasePTPprotein Tyr phosphatasePKCprotein kinase CCHOChinese hamster ovaryPAGEpolyacrylamide gel electrophoresisFPLCfast protein liquid chromatography is a heterotetrameric transmembrane glycoprotein composed of two extracellular α subunits and two transmembrane β subunits linked by disulfide bonds. The α subunits contain the insulin-binding domain, while the transmembrane β subunits function as Tyr-specific kinases (insulin receptor kinases). Insulin signaling utilizes the Tyr kinase activity of the receptor to phosphorylate docking proteins on multiple Tyr residues and further propagate insulin action (1Cheatham B. Kahn C.R. Endocr. Rev. 1995; 16: 117-142Crossref PubMed Google Scholar). insulin receptor insulin receptor substrate insulin receptor substrate-1 insulin receptor substrate-2 IRS-1 whose Ser residues 265, 302, 325, and 358 were mutated to Ala juxtamembrane phosphotyrosine binding protein kinase B, PI3K, phosphatidylinositol 3-kinase protein Tyr phosphatase protein kinase C Chinese hamster ovary polyacrylamide gel electrophoresis fast protein liquid chromatography insulin receptor insulin receptor substrate insulin receptor substrate-1 insulin receptor substrate-2 IRS-1 whose Ser residues 265, 302, 325, and 358 were mutated to Ala juxtamembrane phosphotyrosine binding protein kinase B, PI3K, phosphatidylinositol 3-kinase protein Tyr phosphatase protein kinase C Chinese hamster ovary polyacrylamide gel electrophoresis fast protein liquid chromatography The major substrates of insulin receptor kinase are Shc (2Pronk G.J. McGlade J. Pelicci G. Pawson T. Bos J.L. J. Biol. Chem. 1993; 268: 5748-5753Abstract Full Text PDF PubMed Google Scholar) and the IRS proteins, IRS-1 (3Sun X.J. Rothenberg P. Kahn C.R. Backer J.M. Araki E. Wilden P.A. Cahill D.A. Goldstein B.J. White M.F. Nature. 1991; 352: 73-77Crossref PubMed Scopus (1284) Google Scholar), IRS-2 (4Sun X.-J. Wang L.-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (764) Google Scholar), IRS-3 (5Lavan B.E. Lane W.S. Lienhard G.E. J. Biol. Chem. 1997; 272: 11439-11443Abstract Full Text Full Text PDF PubMed Scopus (311) Google Scholar), and IRS-4 (6Lavan B.E. Fantin V.R. Chang E.T. Lane W.S. Keller S.R. Lienhard G.E. J. Biol. Chem. 1997; 272: 21403-21407Abstract Full Text Full Text PDF PubMed Scopus (288) Google Scholar). IRS proteins contain a conserved pleckstrin homology domain (7Haslam R.J. Kolde H.B. Hemmings B.A. Nature. 1993; 363: 309-310Crossref PubMed Scopus (387) Google Scholar, 8Mayer B.J. Ren R. Clark K.L. Baltimore D. Cell. 1993; 73: 629-630Abstract Full Text PDF PubMed Scopus (380) Google Scholar) located at the amino terminus, adjacent to a phosphotyrosine binding (PTB) domain. The PTB domain is present in a number of signaling molecules (9Pawson T. Nature. 1995; 373: 573-580Crossref PubMed Scopus (2224) Google Scholar) and shares 75% sequence identity between IRS-1 and IRS-2 (10Sawka V.D. Tartare D.S. White M.F. Van Obberghen E. J. Biol. Chem. 1996; 271: 5980-5983Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). This domain interacts with the NPXY motif of the juxtamembrane (JM) region of IR and promotes IR/IRS-1 interactions (11Wolf G. Trüb T. Ottinger E. Groninga L. Lynch A. White M.F. Miyazaki M. Lee J. Shoelson S.E. J. Biol. Chem. 1995; 270: 27407-27410Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 12Eck M.J. Dhe P.S. Trub T. Nolte R.T. Shoelson S.E. Cell. 1996; 85: 695-705Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). The C-terminal region of IRS proteins is poorly conserved. It contains multiple Tyr phosphorylation motifs that serve as docking sites for SH2 domain-containing proteins like the p85α regulatory subunit of PI3K, Grb2, Nck, Crk, Fyn, SHP-2, and others, which mediate the metabolic and growth-promoting functions of insulin (1Cheatham B. Kahn C.R. Endocr. Rev. 1995; 16: 117-142Crossref PubMed Google Scholar, 13White M.F. Diabetologia. 1997; 40: S2-S7Crossref PubMed Scopus (462) Google Scholar). The signaling pathways regulated by IRS proteins control glucose uptake and lipogenesis, protein synthesis, and cell survival (1Cheatham B. Kahn C.R. Endocr. Rev. 1995; 16: 117-142Crossref PubMed Google Scholar, 13White M.F. Diabetologia. 1997; 40: S2-S7Crossref PubMed Scopus (462) Google Scholar). The relative roles of the different IRS proteins in mediating insulin action are still unclear; however, studies of gene disruption revealed that IRS-2 compensates for the absence of IRS-1 in hepatocytes of IRS-1 null mice, while IRS-3 provides the major alternative pathway to PI3K activation in skeletal muscle and adipocytes of these animals (14Patti M.-E. Sun X.-J. Bruening J.C. Araki E. Lipes M.A. White M.F. Kahn C.R. J. Biol. Chem. 1995; 270: 24670-24673Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 15Yamauchi T. Tobe K. Tamemoto H. Ueki K. Kaburagi Y. Yamamoto H.R. Takahashi Y. Yoshizawa F. Aizawa S. Akanuma Y. Sonenberg N. Yazaki Y. Kadowaki T. Mol. Cell. Biol. 1996; 16: 3074-3084Crossref PubMed Scopus (249) Google Scholar, 16Smith H.J. Pons S. Patti M.E. Burks D.J. Yenush L. Sun X.J. Kahn C.R. White M.F. Biochemistry. 1997; 36: 8304-8310Crossref PubMed Scopus (76) Google Scholar, 17Kaburagi Y. Satoh S. Tamemoto H. Yamamoto-Honda R. Tobe K. Veki K. Yamauchi T. Kono-Sugita E. Sekihara H. Aizawa S. Cushman S.W. Akanuma Y. Yazaki Y. Kadowaki T. J. Biol. Chem. 1997; 272: 25839-25844Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). In contrast, IRS-2 null mice develop both insulin resistance and beta cell failure, which leads to their death (18Withers D.J. Gutierrez J.S. Towery H. Burks D.J. Ren J.M. Previs S. Zhang Y. Bernal D. Pons S. Shulman G.I. Bonner W.S. White M.F. Nature. 1998; 391: 900-904Crossref PubMed Scopus (1334) Google Scholar). These data implicate different IRS proteins as mediators of insulin action in different tissues. IRS proteins contain over 30 potential Ser/Thr phosphorylation sites for kinases like protein kinase A, PKC, and mitogen-activated protein kinase (3Sun X.J. Rothenberg P. Kahn C.R. Backer J.M. Araki E. Wilden P.A. Cahill D.A. Goldstein B.J. White M.F. Nature. 1991; 352: 73-77Crossref PubMed Scopus (1284) Google Scholar, 4Sun X.-J. Wang L.-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (764) Google Scholar, 19Mothe I. Van Obberghen E. J. Biol. Chem. 1996; 271: 11222-11227Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar). In previous studies, we have demonstrated that Ser/Thr phosphorylation of IRS-1 and IRS-2 significantly reduces their ability to interact with the JM region of IR. Such impaired interactions abolish the ability of IRS-1 and IRS-2 to undergo insulin-induced Tyr phosphorylation and further propagate insulin signaling, thus providing a possible molecular mechanism for the induction of an insulin-resistant state (20Paz K. Voliovitch H. Hadari Y.R. Roberts Jr., C.T. LeRoith D. Zick Y. J. Biol. Chem. 1996; 271: 6998-7003Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 21Paz K. Hemi R. LeRoith R. Karasik A. Elhanany E. Kanety H. Zick Y. J. Biol. Chem. 1997; 272: 29911-29918Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar). Ser/Thr phosphorylation of IRS proteins seems to be a key mechanism to regulate their function and raises several questions: which residues within IRS proteins undergo Ser phosphorylation, which are the kinases involved, and how such phosphorylations affect insulin signal transduction. The PTB domain of IRS proteins, which interacts with the JM region of IR, is a likely candidate to undergo Ser/Thr phosphorylation. Indeed, alignment of the PTB domains of IRS proteins reveals the presence of 16 conserved Ser/Thr residues, four in consensus PKB phosphorylation sites, that could be targets for different Ser/Thr kinases, including PKB. PKB (Akt), a Ser/Thr kinase, has been shown to function in the IR signaling cascade downstream of PI3K (22Alessi D.R. Andjelkovic M. Caudwell B. Cron P. Morrice N. Cohen P. Hemmings B.A. EMBO J. 1996; 15: 6541-6551Crossref PubMed Scopus (2511) Google Scholar). PKB is activated by insulin in isolated adipocytes and plays a role in glucose metabolism (23Tanti J.F. Grillo S. Gremeaux T. Coffer P.J. Van Obberghen E. Le-Marchand Brustel Y. Endocrinology. 1997; 138: 2005-2010Crossref PubMed Google Scholar). Furthermore, expression of a constitutively active PKB in 3T3-L1 cells or primary adipocytes stimulates glucose uptake and Glut4 translocation (23Tanti J.F. Grillo S. Gremeaux T. Coffer P.J. Van Obberghen E. Le-Marchand Brustel Y. Endocrinology. 1997; 138: 2005-2010Crossref PubMed Google Scholar, 24Kohn A.D. Summers S.A. Birnbaum M.J. Roth R.A. J. Biol. Chem. 1996; 271: 31372-31378Abstract Full Text Full Text PDF PubMed Scopus (1089) Google Scholar). PKB is phosphorylated and activated by phosphatidylinositol 3-kinase-dependent kinases (25Stokoe D. Stephens L.R. Copeland T. Gaffney P.R. Reese C.B. Painter G.F. Holmes A.B. McCormick F. Hawkins P.T. Science. 1997; 277: 567-570Crossref PubMed Scopus (1046) Google Scholar, 26Alessi D.R. James S.R. Downes C.P. Holmes A.B. Gaffney P.R. Reese C.B. Cohen P. Curr. Biol. 1997; 7: 261-269Abstract Full Text Full Text PDF PubMed Google Scholar, 27Stephens L. Anderson K. Stokoe D. Erdjument-Bromage H. Painter G.F. Holmes A.B. Gaffney P.R.J. Reese C.B. McCormick F. Tempst P. Coadwell J. Hawkins P.T. Science. 1998; 279: 710-714Crossref PubMed Scopus (911) Google Scholar), but the detailed mechanism of this activation process is presently unknown. In the present study, we show that phosphorylation of Ser/Thr residues of IRS proteins has a dual function and serves either as a positive or as a negative modulator of insulin signal transduction. Our results implicate a wortmannin-sensitive Ser/Thr kinase, different from PKB, as the kinase that phosphorylates IRS-1 and acts as the negative feedback control regulator that turns off insulin signals by inducing the dissociation of IRS proteins from IR. In contrast, phosphorylation of Ser residues within the PTB domain of IRS-1 by insulin-stimulated PKB protects IRS proteins from the rapid action of protein Tyr phosphatases and enables the Ser-phosphorylated IRS proteins to maintain their Tyr-phosphorylated active conformation. These findings implicate PKB as a positive regulator of IRS-1 functions. Recombinant human insulin was a gift from Novo-Nordisc (Copenhagen, Denmark). Wortmannin and wheat germ agglutinin were purchased from Sigma. PD-98059, SB-202190, bisindolylmaleimide I (GF-109203X), and 12-(2-cyanoethyl)-6,7,2,13,-terahydro-13-methyl-5-oxo-5H-indolo[2,3-α] pyrrolo[3,4-c]carbazole (Go-6976) were purchased from Calbiochem. LipofectAMINE was obtained from Life Technologies, Inc. Monoclonal PY-20 antibodies were obtained from Transduction Laboratories (Lexington, KY). Polyclonal IRS-1 antibodies (anti-YR-1) were prepared as described (28Hadari Y.R. Paz K. Dekel R. Mestrovic T. Accili D. Zick Y. J. Biol. Chem. 1995; 270: 3447-3453Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). Polyclonal antibodies against native PKB and its Ser473-phosphorylated form were obtained from Sigma and New England Biolabs, respectively. Rat hepatoma Fao cells or CHO cells overexpressing the insulin receptor (CHO-T cells) were grown in RPMI or F-12 medium, respectively, supplemented with 10% fetal calf serum as described (21Paz K. Hemi R. LeRoith R. Karasik A. Elhanany E. Kanety H. Zick Y. J. Biol. Chem. 1997; 272: 29911-29918Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar, 29Voliovitch H. Schindler D. Hadari Y.R. Taylor S.I. Accili D. Zick Y. J. Biol. Chem. 1995; 270: 18083-18087Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). Confluent monolayers, grown in 60-mm dishes, were deprived of serum for 16 h prior to each experiment. The medium was aspirated, and the cells were incubated with the indicated inhibitors in serum-free medium for different time periods at 37 °C. Cells were then incubated with or without 100 nm insulin for 1 or 60 min at 37 °C. Cells were washed three times with phosphate-buffered saline and harvested in 300 μl (Fao cells) or 100 μl (CHO cells) of buffer A (25 mmTris-HCl, 2 mm sodium orthovanadate, 0.5 mmEGTA, 10 mm NaF, 10 mm sodium pyrophosphate, 80 mm β-glycerophosphate, 25 mm NaCl, protease inhibitor mixture (Sigma), 1:1000, pH 7.4). Following three cycles of freezing and thawing, the cell extracts were centrifuged at 12,000 × g for 20 min at 4 °C, and the supernatants were collected. Samples (100 μg) were resolved by means of SDS-PAGE and immunoblotted with the indicated antibodies. Insulin receptors were purified from liver plasma membranes of 10-week old rats. The preparation of membranes, solubilization in Triton X-100, and immobilization of IR on wheat germ agglutinin-coupled beads were carried out as described previously (30Zick Y. Kasuga M. Kahn C.R. Roth J. J. Biol. Chem. 1983; 258: 75-80Abstract Full Text PDF PubMed Google Scholar). The immobilized IR was washed with buffer A prior to use. Confluent monolayers of Fao or CHO-T cells, grown in 60-mm dishes, were incubated with 100 nm insulin for 1 or 60 min at 37 °C. Cells were washed three times with phosphate-buffered saline and harvested in 300 μl (Fao) or 100 μl (CHO-T) of buffer A. Following three cycles of freezing and thawing, the cell extracts were centrifuged at 12,000 × g for 30 min at 4 °C, and the supernatants were collected. Aliquots (300 μg) were incubated for 1 h with 30 μl of immobilized IR, with shaking, at 4 °C. Beads were washed four times with buffer A and boiled in 50 μl of Laemmli “sample buffer” (57Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207002) Google Scholar). Samples were resolved by means of SDS-PAGE and immunoblotted with IRS-1 antibodies. Site-directed mutagenesis was performed using a QuikChange kit (Stratagene) according to the manufacturer's instructions. pcDNA3-IRS-1 encoding mouse IRS-1 (29Voliovitch H. Schindler D. Hadari Y.R. Taylor S.I. Accili D. Zick Y. J. Biol. Chem. 1995; 270: 18083-18087Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar) served as a template. pcDNA3-IRS-14A, encoding for IRS-14A (whose Ser residues 265, 302, 325, and 358 were mutated to Ala), was generated sequentially using four sets of overlapping primers: (a) S265A,5′-GAGTTTCGCCCGCGGACGAAAGCCCAATCTTCATCCAG-3′ and 5′-CTGGATGAAGATTGGGCTTTCGTCCGCGGGCGAAACTC-3′ (an additional restriction site for SacII is underlined); (b) S302A, 5′-CTGACTCGGAGATCACGAACTGAGGCCATCACTGCCACCTC-3′ and 5′-GAGGTGGCAGTGATGGCCTCAGTTCGTGATCTCCGAGTCAG-3′ (a restriction site for BglII that was eliminated is underlined); (c) S325A, 5′-GGGTGCGTGCCTCCGCGGATGGCGAAGGCACC-3′ and 5′-GGTGCCTTCGCCATCCGCGGAGGCACGCACCC-3′ (an additional restriction site for SacII is underlined); and (d) S358A, 5′-GGCATCGAGGCAGCGCTAGGTTGCACCCCCC-3′ and 5′-GGGGGGTGCAACCTAGCGCTGCCTCGATGCC-3′ (an additional restriction site for Eco47III is underlined). The mutations were confirmed by restriction digestion and by DNA sequencing. pcDNA3-IRS-1 was digested with HindIII, and BspE-1 and a 9-base pair piece of IRS-1 DNA were deleted and replaced by double-stranded matching overhangs of synthetic oligonucleotide, containing Myc and the remaining IRS-1 sequence. M E Q K L I S E E D L N5′­AGCTTAAGATATCGATCATATGGAACAAAAGCTCATCTCAGAAGAAGATCTGAATGCGAGCCCT­3′3′­ATTCTATAGCTAGTATACCTTGTTTTCGAGTAGAGTCTTCTTCTAGACTTACGCTCGGGAGGCC­5′SEQUENCE 1 The Hind-III site, the initiation codon, and theBspE1 site, respectively, are indicated in boldface type. The correctness of the construct (pcDNA3-Myc-IRS1) was verified by restriction mapping. CHO-T cells (31Ellis L. Clausner E. Morgan D.O. Ederly M. Roth R.A. Rutter W.J. Cell. 1986; 45: 721-732Abstract Full Text PDF PubMed Scopus (696) Google Scholar) were transiently transfected using LipofectAMINE as described (32Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The constructs used for overexpression of IRS-1 or IRS-14A were pcDNA3-IRS-1 (29Voliovitch H. Schindler D. Hadari Y.R. Taylor S.I. Accili D. Zick Y. J. Biol. Chem. 1995; 270: 18083-18087Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar), pcDNA3-IRS-1-Myc, or pcDNA3-IRS-14A (described above). The constructs used to overexpress PKB were pCIS2-Akt-WT, pCIS2-Akt-K179A, or pCIS2-Akt-Myr (33Cong L.N. Chen H. Li Y. Zhou L. McGibbon M.A. Taylor S.I. Quon M.J. Mol. Endocrinol. 1997; 11: 1881-1890Crossref PubMed Google Scholar). Cells were solubilized at 4 °C in buffer B (25 mm Tris-HCl, 2 mm sodium orthovanadate, 0.5 mm EGTA, 10 mm NaF, 10 mm sodium pyrophosphate, 80 mmβ-glycerophosphate, 25 mm NaCl, 1% Triton X-100, protease inhibitor mixture (Sigma), 1:1000, pH 7.4). Cells were centrifuged at 12,000 × g for 15 min at 4 °C, and the supernatants were collected. Aliquots (0.5–1.0 mg) were incubated for 3 h at 4 °C with polyclonal IRS-1 or PKB antibodies or monoclonal Myc antibodies coupled to 60 μl of protein A-Sepharose beads (50%) or goat anti-mouse-Sepharose beads (50%), respectively. Immunocomplexes were washed three times with buffer B and once with 50 mm Hepes, pH 7.5. Immunocomplexes were resolved by means of SDS-PAGE and immunoblotted with the indicated antibodies. Alternatively, the complexes served as a source for either the enzyme (PKB) or the substrate (IRS-1) in the in vitro kinase assays described bellow. Chromatographic fractionation were carried out at 4 °C using an Amersham Pharmacia Biotech Mono-Q FPLC system, as described previously (34Ahn N.G. Seger R. Bratlien R.L. Diltz C.D. Tonks N.K. Krebs E., G. J. Biol. Chem. 1991; 266: 4220-4227Abstract Full Text PDF PubMed Google Scholar). Fao cells from two confluent 15-cm plates were extracted in 1 ml of buffer A, disrupted on ice by 2 × 10 s sonication (30 watts), and centrifuged at 100,000 × g for 30 min at 4 °C. Supernatants containing the cytosolic extracts were brought to a 10-ml volume with buffer C (50 mm β-glycerophosphate, 1.5 mm EGTA, 1 mm EDTA, 1 mmdithiothreitol, 0.1 mm sodium vanadate, pH 7.3) and were loaded at 0.5 ml/min on a Mono-Q column equilibrated with buffer C. Following a brief wash, 1-ml fractions were eluted at 1 ml/min with a 100-ml gradient from 0 to 0.4 m NaCl in buffer C. Fractions were stored at 4 °C, retaining activity for at least 3 weeks. Fao cells were treated for 20 min with a combination of 3 mm H2O2 and 1 mm sodium orthovanadate. Cell extracts were fractionated over Mono-Q FPLC (35Moule S.K. Welsh G.I. Edgell N.J. Foulstone E.J. Proud C.G. Denton R.M. J. Biol. Chem. 1997; 272: 7713-7719Abstract Full Text Full Text PDF PubMed Scopus (226) Google Scholar). Fractions containing the activated PKB, identified using antibodies against phosphorylated PKB, were pooled, and 50-μl aliquots were used to phosphorylate the immunoprecipitated IRS-1. Phosphorylation in a final volume of 100 μl was initiated with 50 μl of a “reaction mix” to yield the following final concentrations: 50 mm Hepes, pH 7.5, 50 μm[γ-32P]ATP, and 10 mm magnesium acetate. Reactions were allowed to proceed for different times at 22 °C and were terminated by adding 25 μl of 5× Laemmli sample buffer (57Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207002) Google Scholar). Samples were resolved by means of 7.5% SDS-PAGE and were subjected to autoradiography. We have previously shown that IRS-1 and IRS-2 selectively interact with immobilized peptides comprising the JM region of the IR (20Paz K. Voliovitch H. Hadari Y.R. Roberts Jr., C.T. LeRoith D. Zick Y. J. Biol. Chem. 1996; 271: 6998-7003Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 21Paz K. Hemi R. LeRoith R. Karasik A. Elhanany E. Kanety H. Zick Y. J. Biol. Chem. 1997; 272: 29911-29918Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar). Moreover, prolonged treatment of Fao cells with insulin or other Ser(P)/Thr(P)-elevating agents significantly reduced the ability of the IRS proteins to interact with the receptor and impaired their competence to undergo insulin-induced Tyr phosphorylation (21Paz K. Hemi R. LeRoith R. Karasik A. Elhanany E. Kanety H. Zick Y. J. Biol. Chem. 1997; 272: 29911-29918Abstract Full Text Full Text PDF PubMed Scopus (449) Google Scholar). To determine the nature of the kinase(s) that catalyze this reaction, Fao or CHO-T cells were incubated with different kinase inhibitors prior to their incubation with insulin. Consistent with our previous findings (20Paz K. Voliovitch H. Hadari Y.R. Roberts Jr., C.T. LeRoith D. Zick Y. J. Biol. Chem. 1996; 271: 6998-7003Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar) incubation of CHO-T or Fao cells (Fig. 1, top) with 100 nm insulin rapidly stimulated Tyr phosphorylation of the IRS proteins. Phosphorylation was maximal 1 min following insulin treatment and then gradually declined over a 60-min incubation with the hormone. This was accompanied by a decrease in the electrophoretic mobility of the IRS proteins and an acute (>50%) reduction in their ability to interact in vitro with the IR (Fig. 1,bottom). Preincubation of the cells with wortmannin, a potent inhibitor of PI3K, eliminated both the mobility shift and the reduction in Tyr phosphorylation of IRS proteins observed following a 60-min treatment with insulin. In contrast, PD-98059, a specific mitogen-activated protein kinase/extracellular signal-regulated kinase kinase inhibitor (36Pang L. Sawada T. Decker S.J. Saltiel A.R. J. Biol. Chem. 1995; 270: 13585-13588Abstract Full Text Full Text PDF PubMed Scopus (895) Google Scholar), SB-202190, a specific inhibitor of p38 mitogen-activated protein kinase, and the PKC inhibitors Go-6976 and GF-109203X had no such protective effect (Fig. 1, top). Furthermore, IRS-1, derived from wortmannin and insulin-treated cells, interacted with IR to a higher extent when compared with IRS-1 derived from cells that were incubated with insulin only for 60 min (Fig. 1,bottom). These findings suggest that IRS-1 serves as a substrate for an insulin-stimulated and wortmannin-sensitive Ser/Thr kinase, whose activity reduces the ability of IRS-1 to interact with the IR. Several studies have indicated that the PTB domain of IRS proteins interacts with an NPEY motif within the JM region of IR (11Wolf G. Trüb T. Ottinger E. Groninga L. Lynch A. White M.F. Miyazaki M. Lee J. Shoelson S.E. J. Biol. Chem. 1995; 270: 27407-27410Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 12Eck M.J. Dhe P.S. Trub T. Nolte R.T. Shoelson S.E. Cell. 1996; 85: 695-705Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). Alignment of the PTB domains of mouse IRS-1 (amino acids 155–309) and mouse IRS-2 (amino acids 191–350) (4Sun X.-J. Wang L.-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (764) Google Scholar) (Table I) revealed the presence of two conserved Ser residues (Ser265 and Ser302 in mouse IRS-1) that conform to a consensus PKB phosphorylation site (RXRXX(S/T)) (37Alessi D.R. Caudwell F.B. Andjelkovic M. Hemmings B.A. Cohen P. FEBS Lett. 1996; 399: 333-338Crossref PubMed Scopus (550) Google Scholar). Two additional Ser residues (Ser325 and Ser358 in mouse IRS-1) were found in a consensus PKB phosphorylation sequence within a conserved region of IRS-1 and IRS-2, named SAIN, located ∼50 amino acids C-terminal to the PTB domain (4Sun X.-J. Wang L.-M. Zhang Y. Yenush L. Myers Jr., M.G. Glasheen E. Lane W.S. Pierce J.H. White M.F. Nature. 1995; 377: 173-177Crossref PubMed Scopus (764) Google Scholar). Since PKB is a wortmannin-sensitive Ser/Thr kinase present downstream of PI3K (22Alessi D.R. Andjelkovic M. Caudwell B. Cron P. Morrice N. Cohen P. Hemmings B.A. EMBO J. 1996; 15: 6541-6551Crossref PubMed Scopus (2511) Google Scholar,38Burgering B.M. Coffer P.J. Nature. 1995; 376: 599-602Crossref PubMed Scopus (1878) Google Scholar), we wished to determine whether PKB might phosphorylate these Ser residues. For this purpose, the above mentioned Ser residues of IRS-1 (serines 265, 302, 325, 358) were mutated to Ala, and the wild-type IRS-1 as well as its mutated form (IRS-14A) were transiently overexpressed in CHO-T cells. Cell extracts were immunoprecipitated with IRS-1 antibodies, and equal amounts of the precipitated IRS-1 proteins were subjected to in vitrophosphorylation by an activated PKB, derived from Fao extracts, fractionated over Mono-Q FPLC. As shown in Fig.2 immunoprecipitated wild-type IRS-1 served as an in vitro substrate for the activated PKB and underwent phosphorylation in a time-dependent manner. Phosphorylation was markedly inhibited when IRS-14A was used as a substrate. These results suggest that Ser residues, located within the PTB/SAIN domain of IRS-1, are in vitrophosphorylation sites for PKB, that might regulate IRS-1 functionin vivo.Table I" @default.
• W2016403730 created "2016-06-24" @default.
• W2016403730 creator A5018609929 @default.
• W2016403730 creator A5025632225 @default.
• W2016403730 creator A5033845345 @default.
• W2016403730 creator A5038623685 @default.
• W2016403730 creator A5070276458 @default.
• W2016403730 creator A5071391683 @default.
• W2016403730 creator A5079331236 @default.
• W2016403730 creator A5090381927 @default.
• W2016403730 creator A5030860797 @default.
• W2016403730 date "1999-10-01" @default.
• W2016403730 modified "2023-10-16" @default.
• W2016403730 title "Phosphorylation of Insulin Receptor Substrate-1 (IRS-1) by Protein Kinase B Positively Regulates IRS-1 Function" @default.
• W2016403730 cites W1487365829 @default.
• W2016403730 cites W1508994506 @default.
• W2016403730 cites W1538018231 @default.
• W2016403730 cites W1555409791 @default.
• W2016403730 cites W1591570672 @default.
• W2016403730 cites W1597094727 @default.
• W2016403730 cites W1630763432 @default.
• W2016403730 cites W1659855560 @default.
• W2016403730 cites W1697523131 @default.
• W2016403730 cites W1726025741 @default.
• W2016403730 cites W1841050729 @default.
• W2016403730 cites W1876033686 @default.
• W2016403730 cites W1970529208 @default.
• W2016403730 cites W1973372369 @default.
• W2016403730 cites W1973837499 @default.
• W2016403730 cites W1977795081 @default.
• W2016403730 cites W1982186905 @default.
• W2016403730 cites W1982449581 @default.
• W2016403730 cites W1985113364 @default.
• W2016403730 cites W1989294105 @default.
• W2016403730 cites W1990612610 @default.
• W2016403730 cites W1991246265 @default.
• W2016403730 cites W1993836723 @default.
• W2016403730 cites W200140000 @default.
• W2016403730 cites W2003659422 @default.
• W2016403730 cites W2016135608 @default.
• W2016403730 cites W2021075508 @default.
• W2016403730 cites W2030156849 @default.
• W2016403730 cites W2031504013 @default.
• W2016403730 cites W2038973974 @default.
• W2016403730 cites W2041925630 @default.
• W2016403730 cites W2044868069 @default.
• W2016403730 cites W2047531477 @default.
• W2016403730 cites W2048596844 @default.
• W2016403730 cites W2049113370 @default.
• W2016403730 cites W2049875806 @default.
• W2016403730 cites W2051758765 @default.
• W2016403730 cites W2058138221 @default.
• W2016403730 cites W2064801081 @default.
• W2016403730 cites W2066569500 @default.
• W2016403730 cites W2072298406 @default.
• W2016403730 cites W2078920527 @default.
• W2016403730 cites W2079123009 @default.
• W2016403730 cites W2082776443 @default.
• W2016403730 cites W2094734472 @default.
• W2016403730 cites W2100837269 @default.
• W2016403730 cites W2108544809 @default.
• W2016403730 cites W2110137900 @default.
• W2016403730 cites W2112009693 @default.
• W2016403730 cites W2120138780 @default.
• W2016403730 cites W2139191784 @default.
• W2016403730 cites W2140355533 @default.
• W2016403730 cites W2146157811 @default.
• W2016403730 cites W2154713680 @default.
• W2016403730 cites W2165863663 @default.
• W2016403730 doi "https://doi.org/10.1074/jbc.274.40.28816" @default.
• W2016403730 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10497255" @default.
• W2016403730 hasPublicationYear "1999" @default.
• W2016403730 type Work @default.
• W2016403730 sameAs 2016403730 @default.
• W2016403730 citedByCount "190" @default.
• W2016403730 countsByYear W20164037302012 @default.
• W2016403730 countsByYear W20164037302013 @default.
• W2016403730 countsByYear W20164037302014 @default.
• W2016403730 countsByYear W20164037302015 @default.
• W2016403730 countsByYear W20164037302016 @default.
• W2016403730 countsByYear W20164037302017 @default.
• W2016403730 countsByYear W20164037302018 @default.
• W2016403730 countsByYear W20164037302019 @default.
• W2016403730 countsByYear W20164037302020 @default.
• W2016403730 countsByYear W20164037302022 @default.
• W2016403730 countsByYear W20164037302023 @default.
• W2016403730 crossrefType "journal-article" @default.
• W2016403730 hasAuthorship W2016403730A5018609929 @default.
• W2016403730 hasAuthorship W2016403730A5025632225 @default.
• W2016403730 hasAuthorship W2016403730A5030860797 @default.
• W2016403730 hasAuthorship W2016403730A5033845345 @default.
• W2016403730 hasAuthorship W2016403730A5038623685 @default.
• W2016403730 hasAuthorship W2016403730A5070276458 @default.
• W2016403730 hasAuthorship W2016403730A5071391683 @default.
• W2016403730 hasAuthorship W2016403730A5079331236 @default.
• W2016403730 hasAuthorship W2016403730A5090381927 @default.
• W2016403730 hasBestOaLocation W20164037301 @default.
• W2016403730 hasConcept C112446052 @default.

• next