FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016807682> ?p ?o ?g. }

• W2016807682 endingPage "27322" @default.
• W2016807682 startingPage "27315" @default.
• W2016807682 abstract "Binding of antigenic peptides to major histocompatibility complex (MHC) class II glycoproteins occurs in specialized endocytic compartments of antigen-presenting cells, which in man are termed MIICs. Newly synthesized MHC class II molecules are transported from the trans-Golgi network to MIICs, but previous studies of this important step in antigen processing have failed to conclusively determine whether most immature MHC class II complexes are transported directly to the processing compartments or are first transiently exposed at the cell surface. To attempt to resolve this question, I constructed a chimeric HLA-DRα chain containing two optimal tyrosine sulfation motifs. When expressed in a human B lymphoblastoid cell line lacking functional DRα chains, the chimera was correctly incorporated into complexes containing endogenous β and invariant chains, transported to the trans-Golgi network, and efficiently sulfated. Pulse-chase experiments showed that the sulfated complexes were rapidly transported to processing compartments with kinetics consistent with direct transport from the trans-Golgi network. The rate of maturation was not significantly altered in cells expressing a temperature-sensitive mutant of dynamin under conditions where the endocytosis of transferrin was inhibited by 95%, confirming that endocytosis was not required for delivery to MIICs. Maturation of MHC class II-containing complexes was inhibited by aluminum fluoride and brefeldin A, indicating the involvement of heterotrimeric G-proteins and ADP-ribosylation factor in the transport event(s). The procedure described provides a unique mechanism to study critical events in antigen processing and presentation. Binding of antigenic peptides to major histocompatibility complex (MHC) class II glycoproteins occurs in specialized endocytic compartments of antigen-presenting cells, which in man are termed MIICs. Newly synthesized MHC class II molecules are transported from the trans-Golgi network to MIICs, but previous studies of this important step in antigen processing have failed to conclusively determine whether most immature MHC class II complexes are transported directly to the processing compartments or are first transiently exposed at the cell surface. To attempt to resolve this question, I constructed a chimeric HLA-DRα chain containing two optimal tyrosine sulfation motifs. When expressed in a human B lymphoblastoid cell line lacking functional DRα chains, the chimera was correctly incorporated into complexes containing endogenous β and invariant chains, transported to the trans-Golgi network, and efficiently sulfated. Pulse-chase experiments showed that the sulfated complexes were rapidly transported to processing compartments with kinetics consistent with direct transport from the trans-Golgi network. The rate of maturation was not significantly altered in cells expressing a temperature-sensitive mutant of dynamin under conditions where the endocytosis of transferrin was inhibited by 95%, confirming that endocytosis was not required for delivery to MIICs. Maturation of MHC class II-containing complexes was inhibited by aluminum fluoride and brefeldin A, indicating the involvement of heterotrimeric G-proteins and ADP-ribosylation factor in the transport event(s). The procedure described provides a unique mechanism to study critical events in antigen processing and presentation. major histocompatibility complex invariant chain endoplasmic reticulum trans-Golgi network Class II-associated invariant chain peptide polyacrylamide gel electrophoresis phosphate-bufferedn saline bovine serum albumin 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid brefeldin A fluorescence-activated cell sorter Major histocompatibility complex (MHC)1 class II glycoproteins are heterodimers that bind antigenic peptides and present them to CD4+ “helper” T cells (reviewed in Ref. 1Watts C. Annu. Rev. Immunol. 1997; 15: 821-850Crossref PubMed Scopus (654) Google Scholar). In man, expression of MHC class II molecules is generally restricted to “professional” antigen-presenting cells such as dendritic cells, B lymphocytes, activated macrophages, granulocytes, and T cells, although expression by other cell types can be induced by γ-interferon. In each case endosomal compartments enriched in MHC class II and referred to as MIICs (MHC II compartments) can be detected, which are believed to be the sites of peptide loading (2Nijman H.W. Kleijmeer M.J. Ossevoort M.A. Oorschot V.M.J. Vierboom M.P.M. Van de Keur M. Kenemans P. Kast W.M. Geuze H.J. Melief C.J.M. J. Exp. Med. 1995; 182: 163-174Crossref PubMed Scopus (176) Google Scholar, 3Kleijmeer M.J. Raposo G. Geuze H.J. Methods Companion Methods Enzymol. 1996; 10: 191-207Crossref Scopus (48) Google Scholar, 4Kleijmeer M.J. Morkowski S. Griffith J.M. Rudensky A. Geuze H.J. J. Cell Biol. 1997; 139: 639-649Crossref PubMed Scopus (197) Google Scholar, 5Peters P.J. Neefjes J.J. Oorschot V. Ploegh H.L. Geuze H.J. Nature. 1991; 349: 669-676Crossref PubMed Scopus (554) Google Scholar, 6West M.A. Lucocq J.M. Watts C. Nature. 1994; 369: 147-151Crossref PubMed Scopus (322) Google Scholar). B lymphoblastoid and B lymphoma cell lines constitutively express high levels of intracellular and cell surface MHC class II. Therefore, the majority of studies of human MHC class II-related antigen processing has been conducted using such cells. Although peptide exchange can occur, it is generally accepted that in B cells most antigenic peptides are loaded onto newly synthesized class II molecules (7Davidson H.W. Reid P.A. Lanzavecchia A. Watts C. Cell. 1991; 67: 105-116Abstract Full Text PDF PubMed Scopus (169) Google Scholar) and that correctly formed αβ-peptide complexes are subsequently long lived (8Lanzavecchia A. Reid P.A. Watts C. Nature. 1992; 357: 249-252Crossref PubMed Scopus (160) Google Scholar). Thus to understand fully the biochemistry of antigen processing and presentation, it is necessary to determine the nature and number of compartments through which newly synthesized MHC class II molecules pass. In most instances the intracellular trafficking of newly synthesized proteins can be defined by pulse-chase analysis of [35S]methionine-labeled molecules. However, investigation of MHC class II trafficking by this technique is severely complicated by the relatively asynchronous movement of MHC class II chains within the secretory pathway. In the endoplasmic reticulum (ER) newly synthesized class II α and β chains associate with the invariant chain (Ii) (9Cresswell P. Cell. 1996; 84: 505-507Abstract Full Text Full Text PDF PubMed Scopus (288) Google Scholar), a chaperone that acts both to mask the peptide binding groove (10Teyton L. O'Sullivan D. Dickson P.W. Lotteau V. Sette A. Fink P. Peterson P.A. Nature. 1990; 348: 39-44Crossref PubMed Scopus (258) Google Scholar, 11Roche P.A. Cresswell P. Nature. 1990; 345: 615-618Crossref PubMed Scopus (403) Google Scholar), and direct complexes to endosomal compartments (12Bakke O. Dobberstein B. Cell. 1990; 63: 707-716Abstract Full Text PDF PubMed Scopus (507) Google Scholar,13Lotteau V. Teyton L. Peleraux A. Nilsson T. Karlsson L. Schmid S.L. Quaranta V. Peterson P.A. Nature. 1990; 348: 600-605Crossref PubMed Scopus (444) Google Scholar). Export from the ER requires the formation of a nonameric complex comprising an Ii trimer and three associated α and β chains. Assembly occurs via trimeric, pentameric, and heptameric intermediates and has an overall half-time of approximately 60 min (14Lamb C.A. Cresswell P. J. Immunol. 1992; 148: 3478-3482PubMed Google Scholar). Thus export of radiolabeled molecules is asynchronous, since some labeled α or β chains associate with heptameric complexes and are exported within 10 min of the chase period, whereas others associate with Ii trimers and might still be retained in the ER 2 h later. Nonameric complexes rapidly traverse the Golgi stack but cannot readily be detected at the cell surface until 1–2 h after they have acquired terminal oligosaccharide modifications indicative of delivery to the trans-Golgi network (TGN) (15Machamer C.E. Cresswell P. J. Immunol. 1982; 129: 2564-2569PubMed Google Scholar). It is accepted that the complexes are retained in MIICs until peptide loading has occurred; however, there is still dispute as to whether the majority of αβIi complexes are transported directly from the TGN to MIICs (16Bénaroch P. Yilla M. Raposo G. Ito K. Miwa K. Geuze H.J. Ploegh H.L. EMBO J. 1995; 14: 37-49Crossref PubMed Scopus (151) Google Scholar) or transiently expressed at, and rapidly endocytosed from, the cell surface (17Roche P.A. Teletski C.L. Stang E. Bakke O. Long E.O. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8581-8585Crossref PubMed Scopus (186) Google Scholar). In order to address the precise post-Golgi trafficking of MHC class II molecules, an alternative strategy is required that restricts labeling to those molecules that have already been exported from the ER. Protein tyrosine sulfation is a ubiquitous late Golgi modification in mammalian cells that satisfies this requirement (reviewed in Ref. 18Huttner W.B. Annu. Rev. Physiol. 1988; 50: 363-376Crossref PubMed Scopus (194) Google Scholar). In most cells it is confined to the trans-Golgi/TGN (19Baeuerle P.A. Huttner W.B. J. Cell Biol. 1987; 105: 2655-2664Crossref PubMed Scopus (192) Google Scholar), and sulfate labeling has been used to study the biogenesis and trafficking of other TGN-derived vesicles (20Tooze S.A. Huttner W.B. Cell. 1990; 60: 837-847Abstract Full Text PDF PubMed Scopus (228) Google Scholar, 21Miller S.G. Moore H.P. Methods Enzymol. 1992; 219: 234-250Crossref PubMed Scopus (16) Google Scholar). A consensus sulfation motif has been defined (22Rosenquist G.L. Nicholas H.B. Protein Sci. 1993; 2: 215-222Crossref PubMed Scopus (55) Google Scholar), and Spiess and colleagues (23Leitinger B. Brown J.L. Spiess M. J. Biol. Chem. 1994; 269: 8115-8121Abstract Full Text PDF PubMed Google Scholar) showed that fusion of a nonapeptide derived from procholecystokinin to the carboxyl terminus of either a soluble protein or a type II membrane protein allowed efficient sulfation of the resulting chimeras. None of the MHC class II chains contain any recognizable sulfation motif, so in order to obtain labeling I have created a novel chimeric HLA-DRα chain containing two optimal tyrosine sulfation motifs. I have expressed this chimera in a B lymphoblastoid cell line lacking functional DR molecules, and I show that it correctly associates with β and Ii chains, is efficiently sulfated, and rapidly exported from the TGN. To inhibit clathrin-mediated endocytosis, without perturbing export from the TGN, I have utilized a temperature-sensitive mutant of dynamin 1 (24Wang K. Peterson P.A. Karlsson L. J. Biol. Chem. 1997; 272: 17055-17060Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 25Damke H. Baba T. Van der Bliek A.M. Schmid S.L. J. Cell Biol. 1995; 131: 69-80Crossref PubMed Scopus (341) Google Scholar, 26Damke H. Baba T. Warnock D.E. Schmid S.L. J. Cell Biol. 1994; 127: 915-934Crossref PubMed Scopus (1030) Google Scholar). I show that under conditions where clathrin-dependent endocytosis of transferrin is inhibited by at least 95%, the rate at which sulfated MHC class II is delivered to protease-containing compartments is unchanged. This indicates that most newly synthesized MHC class II molecules transit directly from the TGN to MIICs in this B cell line. Tissue culture media and supplements were obtained from Sigma. HMy2.DRN cells (27Koppelman B. Cresswell P. J. Immunol. 1990; 145: 2730-2736PubMed Google Scholar) were provided by Dr. P. Travers (University of London, UK) and maintained in RPMI 1640 containing 10% fetal calf serum, 1% minimum Eagle's medium non-essential amino acids (Life Technologies, Inc.), 2 mmGlu, 1 mm sodium pyruvate, 50 IU/ml penicillin, and 50 μg/ml streptomycin in a humified 95% air, 5% CO2atmosphere at 37 °C. Hybridomas L243 (28Lampson L.A. Levy R. J. Immunol. 1980; 125: 293-299PubMed Google Scholar), DA6.147, and DA6.231 (29Guy K. Van Heyningen V. Cohen B.B. Deane D.L. Steel C.M. Eur. J. Immunol. 1982; 12: 942-948Crossref PubMed Scopus (142) Google Scholar) were obtained from the European Collection of Animal Cell Cultures (Salisbury, UK) and propogated as described above. Supernatant from cultures of TAL14.1 (30Maddox J.F. Bodmer J.G. Dupont B. Immunobiology of HLA, Immunogenetics and Histocompatibility. II. Springer-Verlag, Berlin1989: 373-375Google Scholar) was generously provided by Dr. J. Bodmer (Oxford, UK). Monoclonal antibody Bü45 (31Wraight C.J. van Endert P. Moller P. Lipp J. Ling N.R. MacLennan I.C.M. Koch N. Moldenhauer G. J. Biol. Chem. 1990; 265: 5787-5792Abstract Full Text PDF PubMed Google Scholar) was obtained from the Binding Site (Birmingham, UK), LN2 (32Epstein A.L. Marder R.J. Winter J.N. Fox R.I. J. Immunol. 1984; 133: 1028-1036PubMed Google Scholar) from Sigma, and 12CA5 (33Niman H.L. Houghten R.A. Walker L.E. Reisfeld R.A. Wilson I.A. Hogle J.M. Lerner R.A. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 4949-4953Crossref PubMed Scopus (316) Google Scholar) from Roche Molecular Biochemicals. Oligonucleotides were supplied by Genosys (Cambridge, UK) and molecular biology enzymes by New England Biolabs (Hitchin, UK). Other reagents were obtained from Sigma except where indicated. Plasmid pCD1 contains cDNA encoding human preprocathepsin D (34Faust P.L. Kornfeld S. Chirgwin J.M. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4910-4914Crossref PubMed Scopus (258) Google Scholar) between the Hin dIII and Xba I sites of pBluescript (Stratagene, Cambridge, UK). Oligonucleotides encoding the secretogranin I tyrosine sulfation site (sense 5′ TCGAGAGGATCCCCTTCGAAGAGGAACCTGAGTATGGCGCCCCCATGGT 3′; antisense 5′ CTAGACCATGGGGGCGCCATACTCAGGTTCCTCTTCGAAGGGG ATCCTC 3′) were annealed, digested with Bam HI, and ligated into pCD1 that had been digested with Bam HI and Xba I. The product (pCS1) contained the tyrosine sulfation site in frame with the cathepsin D signal peptide. A second aliquot of the annealed oligonuclotides was then digested with Bst BI and ligated into pCS1 cut with Nar I and Xba I to produce pCS2. The mature DRα chain was amplified by polymerase chain reaction from plasmid pE.DRα (gift of Dr. N. Holmes, University of Cambridge) using Pfu DNA polymerase (Stratagene) and primers designed to introduce unique Cla I and Xba I sites (sense 5′ CCATCGATGCACCCGGGGAAGAACATGTGATCATCC AGG 3′; antisense 5′ GGAATTCTAGAGAGGCCCCCTGCGTTCTGC 3′). The product was gel-purified, ligated into the Eco RV site of pBluescript, excised with Cla I and Xba I, and ligated into pCS2 cut with Nar I and Xba I to produce pCS3. The entire coding sequence of pCS3 was excised using Xho I and Not I and ligated into the mammalian expression vector pBJ (gift of Dr. M. Jackson, Scripps Research Institute) that contains the SRα promoter (35Takebe Y. Seiki M. Fujisawa J.I. Hoy P. Yokota K. Arai K.I. Yoshida M. Arai N. Mol. Cell. Biol. 1988; 8: 466-472Crossref PubMed Google Scholar), bovine growth hormone polyadenylation signal, and aminoglycoside phosphotransferase gene (36Southern P.J. Berg P. J. Mol. Appl. Genet. 1982; 1: 327-341PubMed Google Scholar), to form pYY-DRα. Plasmid for transfection was purified using Qiagen columns (Hybaid, Crawley, UK) according to the manufacturer's instructions. HMy2.DRN cells (2 × 107) were collected from culture, washed once with serum-free Iscove's modified Dulbecco's medium, and resuspended in 0.5 ml of the same medium. After transfer to a 0.4-cm electroporation cuvette (Bio-Rad) and incubation on ice for 10 min, 10 μg of pYY-DRα was added, and the incubation was continued for an additional 2 min. The cells were then electroporated at 230 V and 960 microfarads using a Bio-Rad Gene pulser, allowed to recover on ice for 10 min, then returned to culture. After 24 h the media was supplemented with G418 (Calbiochem), initially at 0.9 mg/ml, and after an additional 24 h to a final concentration of 1.8 mg/ml. Resistant clones were isolated by limiting dilution and, after 2 months at 1.8 mg/ml G418, maintained in media containing 0.9 mg/ml. A single clone expressing the modified HLA-DRα chain at high levels (YY1) was obtained and used for all subsequent experiments. Cells were collected from culture, washed twice with phosphate-buffered saline containing 5 mg/ml BSA (PBS/BSA), and resuspended in PBS/BSA containing 5% (v/v) normal rabbit serum (1 × 107 cells/ml). After incubation at room temperature for 30 min to block nonspecific binding sites, the cells were collected by centrifugation, and resuspended in ice-cold PBS/BSA. Fluorescein isothiocyanate-conjugated mouse anti-(human HLA-DR) (clone G46-6; Becton Dickinson, Cowley, UK), or an appropriate isotype control (Sigma), was added, and the cells were incubated on ice with occasional mixing for 90 min. They were then washed three times with ice-cold PBS/BSA, once with PBS, and fixed in PBS containing 2% paraformaldehyde. Fixed cells were analyzed using a Becton Dickinson FACSort. Clone YY1 cells (1.5 × 107) were collected from culture, washed twice with PBS/BSA, resuspended in sulfate-free basal medium Eagle's containing 5% dialyzed newborn calf serum at 1.5 × 106 cells/ml, and incubated in a gassed incubator at 37 °C for 2 h. The cells were then collected by centrifugation at room temperature (4 min at 250 × g), washed once with sulfate-free medium lacking bicarbonate, and supplemented with 20 mm Na-Hepes, pH 7.4 (Life Technologies, Inc.), and resuspended in 200 μl of the same medium. After preincubation at 37 °C for 5 min, 50 μl of medium containing 0.25 mCi Na235SO4 (lyophilized stock; Amersham Pharmacia Biotech) was added, and the incubation was continued for an additional 5–10 min with occasional mixing. The cells were then transferred to ice, diluted to 10 ml with ice-cold PBS/BSA containing 10 mm sodium sulfate, and collected by centrifugation at 4 °C. After a further wash in PBS/BSA-sulfate the cells were resuspended at 2.5 × 106 cells/ml in RPMI 1640 containing 10% newborn calf serum, 20 mm Hepes, pH 7.4, adjusted to 1 mm sulfate, and chased at 37 °C for times as indicated. Finally the cells were collected by centrifugation at 4 °C, the medium discarded, and the cells lysed as described previously (37Davidson H.W. J. Cell Biol. 1995; 130: 797-805Crossref PubMed Scopus (184) Google Scholar). Radiolabeled class II was recovered with L243 + protein A (“mature”), or DA6.231 + protein G (total), and Ii with a combination of Bü45 and LN2 + protein G. Bound proteins were separated by SDS-PAGE using 12.5% gels and analyzed by phosphorimaging using a Fuji Bas2000 system. In some experiments eluted proteins were precipitated with 10 volumes of acetone previously chilled to −80 °C and collected by centrifugation. The precipitates were resuspended in 25 μl of 0.1 m sodium phosphate, pH 6.5, containing 10 mm EDTA and 0.1% SDS, and heated to 100 °C for 10 min. The solutions were then cooled to room temperature, CHAPS added to a final concentration of 1% (w/v), and incubated for 18 h at 37 °C in the presence or absence of 1 unit of N- glycanase (Roche Molecular Biochemicals). An equal volume of twice concentrated SDS-PAGE sample buffer was then added, and the samples were analyzed as described above. Plasmid pTM1-HA-tsDyn (kindly provided by Dr. S. Schmid, La Jolla, CA) contains human dynamin 1 having an amino-terminal hemaglutinin epitope tag and the mutation G273D (25Damke H. Baba T. Van der Bliek A.M. Schmid S.L. J. Cell Biol. 1995; 131: 69-80Crossref PubMed Scopus (341) Google Scholar). Plasmid pMEP4 (Invitrogen) contains the human metallothionein IIA promotor allowing inducible expression of heterologous proteins in mammalian cells after treatment with heavy metal ions (38McNeall J. Sanchez A. Gray P.P. Chesterman C.N. Sleigh M.J. Gene (Amst.). 1989; 76: 81-88Crossref PubMed Scopus (31) Google Scholar). It also contains elements conferring resistance to hygromycin B treatment and the ability to replicate episomally in some cells. The entire coding sequence was excised with Spe I and Sal I and ligated into the Nhe I and Xho I sites of pMEP4 to form pDY8. Clone YY1 cells were transfected with pDY8 as described above and selected in medium supplemented with G418 (0.9 mg/ml) and 0.6 mg/ml hygromycin B (Roche Molecular Biochemicals) at 37 °C. A representative clone (YY1:DY8) was used for subsequent experiments. Mutant dynamin was induced by culturing clone YY1:DY8 in medium additionally supplemented with 100 μm ZnCl2 for 18–24 h at 31 °C. Following induction, high level expression was maintained in the absence of zinc for at least 8 h at 31 °C. YY1 cells (2 × 106) were collected from culture, washed once with PBS, and lysed in PBS containing 1% Triton X-100 and 1 mm phenylmethylsulfonyl fluoride (107 cells/ml) at 0 °C. Protein in the clarified lysates was precipitated by the addition of 6 volumes of acetone previously cooled to −80 °C and incubated on ice for 10 min. After centifugation at 17,000 × g for 15 min, precipitates were solubilized in SDS-PAGE sample buffer, separated by electrophoresis, and transferred to nitrocellulose. Immunological detection was by chemiluminescence (SuperSignal®, Pierce & Warriner, Chester, UK) and carried out according to the manufacturer's instructions. Endocytosis of transferrin was measured using a modification of the enzyme-linked immunosorbent assay protocol of Smythe and colleagues (39Smythe E. Redelmeier T.E. Schmid S.L. Methods Enzymol. 1992; 219: 223-234Crossref PubMed Scopus (40) Google Scholar). Briefly this involved the use of biotinylated transferrin (Sigma) rather than BSST and two 2-min washes with 10 mm HCl, 150 mm NaCl, pH 2, to remove surface ligand (40Subtil A. Hemar A. Dautry-Varsat A. J. Cell Sci. 1994; 107: 3461-3468Crossref PubMed Google Scholar) prior to solubilization. In order to focus upon movement of newly synthesized MHC class II between the late Golgi and compartments involved in antigen processing and peptide loading, I constructed a chimeric DRα chain that could be efficiently labeled with sulfate. Consideration of the crystal structure of HLA-DR1 (41Brown J.H. Jardetzky T.S. Gorga J.C. Stern L.J. Urban R.G. Strominger J.L. Wiley D.C. Nature. 1993; 364: 33-39Crossref PubMed Scopus (2098) Google Scholar) suggested that a hydrophilic peptide fused to the amino terminus of the non-polymorphic α chain would be accessible to post-translational modification but unlikely to interfere with binding of Ii. Analysis of the kinetic properties of protein tyrosine sulfotransferases has shown that the apparent Km of peptide substrates decreases with increasing number of sulfation sites (42Niehrs C. Kraft M. Lee R.W.H. Huttner W.B. J. Biol. Chem. 1990; 265: 8525-8532Abstract Full Text PDF PubMed Google Scholar). Accordingly, I constructed a chimera comprising the human cathepsin D signal peptide and two repeats of a sequence related to the sulfation site of bovine secretogranin 1, fused to Glu3 of HLA-DRα. The predicted structure of this chimera, including the expected amino terminus following signal peptide cleavage and sites of protein tyrosine sulfation, is indicated in Fig.1 A. LICR-LON-HMy2 is a variant of the plasma cell leukemia-derived B lymphoblastoid cell line ARH-77 (43Edwards P.A.W. Smith C.M. Neville A.M. O'Hare M.J. Eur. J. Immunol. 1982; 12: 641-648Crossref PubMed Scopus (140) Google Scholar). HMy2.DRN was generated by two rounds of γ-irradiation each followed by antibody and complement-mediated selection. The initial round was directed toward the HLA-A3 locus and isolated a line (HMy2.A3M) lacking an entire MHC haplotype. The second round was directed toward HLA-DR and identified a line (HMy2.DRN) in which the remaining DRα gene was mutated to encode a truncated protein that is rapidly degraded prior to export of αβIi complexes from the ER (27Koppelman B. Cresswell P. J. Immunol. 1990; 145: 2730-2736PubMed Google Scholar). The cell expresses cell surface immunoglobulin G (44Diaz-Espada F. Milstein C. Secher D. Mol. Immunol. 1987; 24: 595-603Crossref PubMed Scopus (2) Google Scholar), HLA-DP, and HLA-DQ but no HLA-DR. Western blot analysis of the HMy2.DRN-derived clone YY1 generated by transfection with cDNA encoding the chimeric α chain, using the DRα-specific antibody DA6.147 (29Guy K. Van Heyningen V. Cohen B.B. Deane D.L. Steel C.M. Eur. J. Immunol. 1982; 12: 942-948Crossref PubMed Scopus (142) Google Scholar), demonstrated the stable expression of the chimeric chain (Fig. 1 B, lane 2). Similarly, FACS analysis confirmed that the chimeric chain restored surface expression of mature HLA-DR molecules (Fig. 1 C). As shown in Fig. 2, [35S]sulfate was rapidly incorporated into complexes containing the chimeric α chain. Without a subsequent chase incubation, radiolabeled proteins were efficiently precipitated with antibodies toward the lumenal domain of Ii (Fig. 2, lane 1) but could not be recovered using L243 (lane 2), an antibody whose epitope is masked in HLA-DR molecules which are associated with intact Ii (45Shackelford D.A. Lampson L.A. Strominger J.L. J. Immunol. 1981; 127: 1403-1410PubMed Google Scholar). Most of the radiolabel recovered using anti-Ii antibodies was present as a smear of apparent molecular mass of 45–80 kDa. This material was sensitive to digestion with chondroitinase A, B, C, consistent with previous observations that Ii is the protein core for B cell chondroitin sulfate proteoglycan (46Giacoletto K.S. Sant A.J. Bono C. Gorka J. O'Sullivan D. Quaranta V. Schwartz B.D. J. Exp. Med. 1986; 164: 1422-1439Crossref PubMed Scopus (23) Google Scholar). After a 2-h chase incubation less than 5% of the radiolabel was associated with intact Ii (lane 3) but was efficiently recovered with L243 (lane 4). Radiolabel precipitated with L243 was entirely resistant to chondroitinase digestion (data not shown). This suggests that the chondroitin sulfate present in the un-chased precipitates is exclusively associated with intact Ii chains, consistent with the conclusion that the Ii chain must be cleaved at a site membrane proximal to the site of proteoglycan addition in order to reveal the L243 epitope. At early time points the chimeric α chain migrated with an apparent molecular mass of 42 kDa (Fig. 2). Subsequently it was converted in a time-dependent fashion to a 40-kDa form (Fig. 2, lane 4, and Fig.5 A). This chain could be precipitated with monoclonal DA6.147 (which recognizes both β chain-associated, and free, α chains) from denatured eluates previously precipitated with L243 (Fig.3 A, lane 2), confirming that it was indeed derived from the chimera. Conversion to the faster migrating form could be prevented by treatment with the membrane-permeant thiol protease inhibitor E64d, indicating that it was the result of proteolytic activity. Surprisingly, in addition to the 40–42-kDa band corresponding to the chimeric α chain, efficient labeling of the DRβ chain was also observed in immunoprecipitates of both immature and mature molecules (Fig. 2, lanes 1 and 4). This was unexpected since none of the tyrosine residues in this chain are located within the context of an optimal motif, and only minor labeling was observed in sulfate-labeled human tonsil cells (47Sant A.J. Zacheis M. Rumbarger T. Giacoletto K.S. Schwartz B.D. J. Immunol. 1988; 140: 155-160PubMed Google Scholar). I decided to investigate this further.Figure 3Characterization of sulfated MHC class II molecules. A, sulfate-labeled HLA-DR molecules were precipitated with L243 from detergent lysates of clone YY1 cells after a 2-h chase and eluted with non-reducing SDS sample buffer at 100 °C (lane 1). Eluted molecules were diluted 20-fold in 20 mm Tris·HCl, pH 7.5, containing 150 mm NaCl and 1% CHAPS and re-precipitated with DA6.147 (lane 2) or TAL14.1 (lane 3). B, clone YY1 (lane 1) or HMy2.DRN stably expressing wild-type DRα (lane 2) were labeled with [35S]sulfate for 10 min. MHC class II molecules were recovered using anti-class II antibody DA6.231.C, clone YY1 cells were radiolabeled with [35S]methionine as described previously (37Davidson H.W. J. Cell Biol. 1995; 130: 797-805Crossref PubMed Scopus (184) Google Scholar) (lanes 1–4) or [35S]sulfate as decribed under “Materials and Methods” (lanes 5 and 6). Cells were chased for 4 (lanes 1–4) or 1 h (lanes 5 and 6) in an excess of “cold” label, and MHC class II molecules were collected with L243. Samples were treated with N- glycanase as described under “Materials and Methods” either directly (lanes 5 and 6) or after re-precipitation of the α (lanes 1 and 2) or β (lanes 3 and 4) chains, respectively.Lanes 1, 3, and 5 show the results of mock incubations, and lanes 2, 4, and 6 show the effects of N- glycanase digestion. The arrow shows the position of deglycosylated β chains determined in lane 4.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To confirm that the 30-kDa sulfated species was indeed the DRβ chain, I re-precipitated denatured eluates previously recovered with L243 (Fig. 3 A, lane 1) with either DA6.147 or the DRβ chain-specific antibody TAL14.1 (30Maddox J.F. Bodmer J.G. Dupont B. Immunobiology of HLA, Immunogenetics and Histocompatibility. II. Springer-Verlag, Berlin1989: 373-375Google Scholar). As predicted, DA6.147 recognized the 40-kDa band and TAL14.1 the 30-kDa band in the denatured eluates (Fig. 3 A, lanes 2 and 3), confirming that both HLA-DR subunits were efficiently sulfated in clone YY1 cells. In contrast, neither the α nor the β chains were labeled with sulfate when HMy2.DRN cells stably expressing a DRα chain lacking the sulfation motifs were examined under identical conditions to those used for clone Y" @default.
• W2016807682 created "2016-06-24" @default.
• W2016807682 creator A5054029531 @default.
• W2016807682 date "1999-09-01" @default.
• W2016807682 modified "2023-10-11" @default.
• W2016807682 title "Direct Transport of Newly Synthesized HLA-DR from the trans-Golgi Network to Major Histocompatibility Complex Class II Containing Compartments (MIICS) Demonstrated Using a Novel Tyrosine-sulfated Chimera" @default.
• W2016807682 cites W1483035379 @default.
• W2016807682 cites W1493325887 @default.
• W2016807682 cites W1503506032 @default.
• W2016807682 cites W1507889270 @default.
• W2016807682 cites W1511184731 @default.
• W2016807682 cites W1513433026 @default.
• W2016807682 cites W1547352154 @default.
• W2016807682 cites W1585169250 @default.
• W2016807682 cites W1585391064 @default.
• W2016807682 cites W1661939772 @default.
• W2016807682 cites W1885217255 @default.
• W2016807682 cites W1963584953 @default.
• W2016807682 cites W1967965496 @default.
• W2016807682 cites W1970654655 @default.
• W2016807682 cites W1976483253 @default.
• W2016807682 cites W1980468321 @default.
• W2016807682 cites W1998434423 @default.
• W2016807682 cites W2000117355 @default.
• W2016807682 cites W2001347655 @default.
• W2016807682 cites W2012952808 @default.
• W2016807682 cites W2013829335 @default.
• W2016807682 cites W2016871586 @default.
• W2016807682 cites W2018620812 @default.
• W2016807682 cites W2021052717 @default.
• W2016807682 cites W2021595960 @default.
• W2016807682 cites W2021893101 @default.
• W2016807682 cites W2022653182 @default.
• W2016807682 cites W2024739169 @default.
• W2016807682 cites W2040209854 @default.
• W2016807682 cites W2044117690 @default.
• W2016807682 cites W2049652225 @default.
• W2016807682 cites W2052736790 @default.
• W2016807682 cites W2066844508 @default.
• W2016807682 cites W2067277735 @default.
• W2016807682 cites W2071680839 @default.
• W2016807682 cites W2077578546 @default.
• W2016807682 cites W2079090605 @default.
• W2016807682 cites W2080956086 @default.
• W2016807682 cites W2082307299 @default.
• W2016807682 cites W2084536008 @default.
• W2016807682 cites W2089393609 @default.
• W2016807682 cites W2091686762 @default.
• W2016807682 cites W2092636093 @default.
• W2016807682 cites W2095843724 @default.
• W2016807682 cites W2102914091 @default.
• W2016807682 cites W2105191016 @default.
• W2016807682 cites W2107801352 @default.
• W2016807682 cites W2112786488 @default.
• W2016807682 cites W2120673613 @default.
• W2016807682 cites W2122291762 @default.
• W2016807682 cites W2122364201 @default.
• W2016807682 cites W2126972494 @default.
• W2016807682 cites W2128674875 @default.
• W2016807682 cites W2134406040 @default.
• W2016807682 cites W2139711579 @default.
• W2016807682 cites W2148788901 @default.
• W2016807682 cites W2161769312 @default.
• W2016807682 cites W2187834230 @default.
• W2016807682 cites W2400728565 @default.
• W2016807682 cites W2409532372 @default.
• W2016807682 cites W243037252 @default.
• W2016807682 cites W4255858411 @default.
• W2016807682 cites W989012818 @default.
• W2016807682 doi "https://doi.org/10.1074/jbc.274.38.27315" @default.
• W2016807682 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10480952" @default.
• W2016807682 hasPublicationYear "1999" @default.
• W2016807682 type Work @default.
• W2016807682 sameAs 2016807682 @default.
• W2016807682 citedByCount "13" @default.
• W2016807682 countsByYear W20168076822012 @default.
• W2016807682 countsByYear W20168076822015 @default.
• W2016807682 crossrefType "journal-article" @default.
• W2016807682 hasAuthorship W2016807682A5054029531 @default.
• W2016807682 hasBestOaLocation W20168076821 @default.
• W2016807682 hasConcept C104317684 @default.
• W2016807682 hasConcept C119062480 @default.
• W2016807682 hasConcept C147483822 @default.
• W2016807682 hasConcept C155138218 @default.
• W2016807682 hasConcept C158617107 @default.
• W2016807682 hasConcept C185592680 @default.
• W2016807682 hasConcept C188280979 @default.
• W2016807682 hasConcept C202965653 @default.
• W2016807682 hasConcept C203014093 @default.
• W2016807682 hasConcept C207936829 @default.
• W2016807682 hasConcept C2776165026 @default.
• W2016807682 hasConcept C30278631 @default.
• W2016807682 hasConcept C55493867 @default.
• W2016807682 hasConcept C86803240 @default.
• W2016807682 hasConcept C95444343 @default.
• W2016807682 hasConceptScore W2016807682C104317684 @default.
• W2016807682 hasConceptScore W2016807682C119062480 @default.
• W2016807682 hasConceptScore W2016807682C147483822 @default.

• next