FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2016886758> ?p ?o ?g. }

• W2016886758 endingPage "39524" @default.
• W2016886758 startingPage "39515" @default.
• W2016886758 abstract "Apolipoprotein B (apoB) is required for the assembly and secretion of triglyceride-rich lipoproteins. ApoB synthesis is constitutive, and post-translational mechanisms modulate its secretion. Transforming growth factor β (TGF-β) increased apoB secretion in both differentiated and nondifferentiated Caco-2 cells and decreased secretion in HepG2 cells without affecting apolipoprotein A-I secretion. TGF-β altered apoB secretion by changing steady-state mRNA levels and protein synthesis. Expression of SMAD3 and SMAD4 differentially regulated apoB secretion in these cells. Thus, SMADs mediate dissimilar secretion of apoB in both the cell lines by affecting gene transcription. We identified a 485-bp element, 55 kb upstream of the apob gene that contains a SMAD binding motif. This motif increased the expression of chloramphenicol acetyltransferase in Caco-2 cells treated with TGF-β or transfected with SMADs. Hence, TGF-β activates SMADs that bind to the 485-bp intestinal enhancer element in the apob gene and increase its transcription and secretion in Caco-2 cells. This is the first example showing differential transcriptional regulation of theapob gene by cytokines and dissimilar regulation of one gene in two different cell lines by TGF-β. In this regulation, the presence of cytokine-responsive motif in the tissue-specific enhancer element confers cell-specific response. Apolipoprotein B (apoB) is required for the assembly and secretion of triglyceride-rich lipoproteins. ApoB synthesis is constitutive, and post-translational mechanisms modulate its secretion. Transforming growth factor β (TGF-β) increased apoB secretion in both differentiated and nondifferentiated Caco-2 cells and decreased secretion in HepG2 cells without affecting apolipoprotein A-I secretion. TGF-β altered apoB secretion by changing steady-state mRNA levels and protein synthesis. Expression of SMAD3 and SMAD4 differentially regulated apoB secretion in these cells. Thus, SMADs mediate dissimilar secretion of apoB in both the cell lines by affecting gene transcription. We identified a 485-bp element, 55 kb upstream of the apob gene that contains a SMAD binding motif. This motif increased the expression of chloramphenicol acetyltransferase in Caco-2 cells treated with TGF-β or transfected with SMADs. Hence, TGF-β activates SMADs that bind to the 485-bp intestinal enhancer element in the apob gene and increase its transcription and secretion in Caco-2 cells. This is the first example showing differential transcriptional regulation of theapob gene by cytokines and dissimilar regulation of one gene in two different cell lines by TGF-β. In this regulation, the presence of cytokine-responsive motif in the tissue-specific enhancer element confers cell-specific response. apolipoprotein chloramphenicol acetyltransferase fetal bovine serum mitogen-activated protein transforming growth factor β interleukin bovine serum albumin Dulbecco's modified Eagle's medium reverse transcriptase enzyme-linked immunosorbent assay glyceraldehyde-3-phosphate dehydrogenase cytomegalovirus The B apolipoproteins, apoB-1001 and apoB-48, are necessary for triglyceride-rich lipoprotein assembly and neutral lipid transport in the body (1Havel R.J. Kane J.P. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disorders. McGraw-Hill, Inc., New York1995: 1841-1851Google Scholar). There is only one apob gene in the human genome, and its expression is limited to the liver, intestine, and heart (2Young S.G. Circulation. 1990; 82: 1574-1594Crossref PubMed Scopus (328) Google Scholar, 3Kim E. Young S.G. J. Lipid Res. 1998; 39: 703-723Abstract Full Text Full Text PDF PubMed Google Scholar, 4Levy-Wilson B. Prog. Nucleic Acids Res. Mol. Biol. 1995; 50: 161-190Crossref PubMed Scopus (26) Google Scholar, 5Hussain M.M. Kancha R.K. Zhou Z. Luchoomun J., Zu, H. Bakillah A. Biochim. Biophys. Acta. 1996; 1300: 151-170Crossref PubMed Scopus (144) Google Scholar, 6Zannis V.I. Kan H.Y. Kritis A. Zanni E. Kardassis D. Front. Biosci. 2001; 6: D456-D504Crossref PubMed Google Scholar). The gene consists of 29 exons and 28 introns and exists as a 47.5-kb DNase-sensitive domain (7Ludwig E.H. Blackhart B.D. Pierotti V.R. Caiati L. Fortier C. Knott T. Scott J. Mahley R.W. Levy-Wilson B. McCarthy B.J. DNA. 1987; 6: 363-372Crossref PubMed Scopus (90) Google Scholar, 8Ludwig E.H. Levy-Wilson B. Knott T. Blackhart B.D. McCarthy B.J. DNA Cell Biol. 1991; 10: 329-338Crossref PubMed Scopus (12) Google Scholar). The presence of proximal 5-kb and distal 1.5-kb sequences is sufficient for the expression of the apob gene in the liver and heart of mice (9Borén J. Véniant M.M. Young S.G. J. Clin. Invest. 1998; 101: 1197-1202Crossref PubMed Scopus (109) Google Scholar, 10Nielsen L.B. Sullivan M. Vanni-Reyes T. Goldberg I.J. Young S.G. J. Mol. Cell Cardiol. 1999; 31: 695-703Abstract Full Text PDF PubMed Scopus (18) Google Scholar). However, elements required for the transgenic expression of the apob gene in the intestine are located between 54 and 62 kb upstream of the structural gene (11McCormick S.P.A., Ng, J.K. Véniant M. Borén J. Pierotti V. Flynn L.M. Grass D.S. Connolly A. Young S.G. J. Biol. Chem. 1996; 271: 11963-11970Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Within this region, 315-, 485-, and 690-bp enhancer elements have been identified. These elements increase the expression of the basal promoter activity in intestinal cells (12Antes T.J. Goodart S.A. Huynh C. Sullivan M. Young S.G. Levy-Wilson B. J. Biol. Chem. 2000; 275: 26637-26648Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 13Antes T.J. Namciu S.J. Fournier R.E. Levy-Wilson B. Biochemistry. 2001; 40: 6731-6742Crossref PubMed Scopus (58) Google Scholar, 14Antes T.J. Goodart S.A. Chen W. Levy-Wilson B. Biochemistry. 2001; 40: 6720-6730Crossref PubMed Scopus (11) Google Scholar). Thus, the tissue-specific expression of theapob gene depends on the far upstream, proximal, and distal sequences. The apob gene transcription is believed to be constitutive, and apoB levels are thought to change primarily by co- and post-translational mechanisms. First, it was demonstrated that various perturbations that increase apoB secretion do not affect apoB mRNA levels (15Pullinger C.R. North J.D. Teng B.B. Rifici V.A. Ronhild de Brito A.E. Scott J. J. Lipid Res. 1989; 30: 1065-1077Abstract Full Text PDF PubMed Google Scholar). Second, it was demonstrated that oleic acid supplementation increases apoB secretion in HepG2 cells by inhibiting the intracellular degradation (16Dixon J.L. Furukawa S. Ginsberg H.N. J. Biol. Chem. 1991; 266: 5080-5086Abstract Full Text PDF PubMed Google Scholar). Subsequent studies led to the understanding that co- and post-translational mechanisms involving degradation of nascent apoB are primarily involved in the modulation of apoB secretion (17Dixon J.L. Ginsberg H.N. J. Lipid Res. 1993; 34: 167-179Abstract Full Text PDF PubMed Google Scholar, 18Fisher E.A. Ginsberg H.N. J. Biol. Chem. 2002; 277: 17377-17380Abstract Full Text Full Text PDF PubMed Scopus (375) Google Scholar, 19Yao Z. Tran K. McLeod R.S. J. Lipid Res. 1997; 38: 1937-1953Abstract Full Text PDF PubMed Google Scholar, 20Fisher E.A. Pan M. Chen X., Wu, X. Wang H. Jamil H. Sparks J.D. Williams K.J. J. Biol. Chem. 2001; 276: 27855-27863Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar, 21Gillian-Daniel D.L. Bates P.W. Tebon A. Attie A.D. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 4337-4342Crossref PubMed Scopus (61) Google Scholar). However, apoB expression studies have challenged this concept and indicated that transcriptional mechanisms may also play a role in the control of apoB secretion. For example, the amounts of apoB secreted by rat hepatoma McA-RH7777 cells stably transfected with human apoB cDNAs were correlated with increases in apoB mRNA levels (22Selby S.L. Yao Z. Arterioscler. Thromb. Vasc. Biol. 1995; 15: 1900-1910Crossref PubMed Scopus (15) Google Scholar). Similarly, increased plasma apoB levels were correlated with the human transgene copy number in mice (3Kim E. Young S.G. J. Lipid Res. 1998; 39: 703-723Abstract Full Text Full Text PDF PubMed Google Scholar, 23Linton M.F. Farese Jr., R.V. Chiesa G. Grass D.S. Chin P. Hammer R.E. Hobbs H.H. Young S.G. J. Clin. Invest. 1993; 92: 3029-3037Crossref PubMed Scopus (211) Google Scholar, 24Callow M.J. Stoltzfus L.J. Lawn R.M. Rubin E.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2130-2134Crossref PubMed Scopus (148) Google Scholar, 25Fan J.L. McCormick S.P.A. Krauss R.M. Taylor S. Quan R. Taylor J.M. Young S.G. Arterioscler. Thromb. Vasc. Biol. 1995; 15: 1889-1899Crossref PubMed Scopus (54) Google Scholar). It is conceivable that human apoB might have escaped the co- and post-translational mechanisms in rats and mice, leading to increased secretion. It is also possible that overexpression might have burdened the post-translational control mechanisms and enhanced apoB secretion. It remains to be determined whether modest changes in the transcription of the endogenous apob gene would affect apoB secretion in human cells. Transforming growth factor β (TGF-β) is a family of cytokines that play a widespread role in various biological processes such as growth, development, differentiation, apoptosis, embryogenesis and anti-inflammation (26Massague J. Annu. Rev. Biochem. 1998; 67: 753-791Crossref PubMed Scopus (3975) Google Scholar, 27Massague J. Nat. Rev. Mol. Cell. Biol. 2000; 1: 169-178Crossref PubMed Scopus (1641) Google Scholar). These cytokines are produced by most cell types and exert paracrine, autocrine, and endocrine effects by interacting with their cell surface serine/threonine kinase TGF-β receptors type I and type II. TGF-β binds to type II receptors and induces phosphorylation of the type I receptors. The phosphorylated receptor I in turn phosphorylates the receptor SMADs. The phosphorylated receptor SMADs bind to SMAD4, and the complex translocates to the nucleus. The receptor SMADs and SMAD4 complex affects the transcription of various genes by directly interacting with the DNA sequences present in the promoter, enhancer, or repressor elements or through physical interactions with other transcriptional co-activators or co-repressors (26Massague J. Annu. Rev. Biochem. 1998; 67: 753-791Crossref PubMed Scopus (3975) Google Scholar, 27Massague J. Nat. Rev. Mol. Cell. Biol. 2000; 1: 169-178Crossref PubMed Scopus (1641) Google Scholar). Ubiquitylation and proteosome-dependent degradation of receptor SMADs in the nucleus provide a way to terminate the TGF-β responses (26Massague J. Annu. Rev. Biochem. 1998; 67: 753-791Crossref PubMed Scopus (3975) Google Scholar, 27Massague J. Nat. Rev. Mol. Cell. Biol. 2000; 1: 169-178Crossref PubMed Scopus (1641) Google Scholar). This TGF-β/SMAD signaling system has been shown to alter the transcription of various genes such as collagen (28Vindevoghel L. Kon A. Lechleider R.J. Uitto J. Roberts A.B. Mauviel A. J. Biol. Chem. 1998; 273: 13053-13057Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar), the tissue plasminogen activator inhibitor (29Dennler S. Itoh S. Vivien D. Ten Dijke P. Huet S. Gauthier J.M. EMBO J. 1998; 17: 3091-3100Crossref PubMed Scopus (1578) Google Scholar), the p21/WAF1/CiP1 cell cycle inhibitor (30Moustakas A. Kardassis D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6733-6738Crossref PubMed Scopus (321) Google Scholar), and apoCIII (31Kardassis D. Pardali K. Zannis V.I. J. Biol. Chem. 2000; 275: 41405-41414Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). In addition to SMADs, mitogen-activated protein kinases (MAP kinases) have also been shown to be the downstream mediators of the TGF-β response in many cell types and regulate gene expression (27Massague J. Nat. Rev. Mol. Cell. Biol. 2000; 1: 169-178Crossref PubMed Scopus (1641) Google Scholar, 32Han J. Hajjar D.P. Tauras J.M. Feng J. Gotto Jr., A.M. Nicholson A.C. J. Biol. Chem. 2000; 275: 1241-1246Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar, 33Chin B.Y. Petrache I. Choi A.M. Choi M.E. J. Biol. Chem. 1999; 274: 11362-11368Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 34Atfi A. Djelloul S. Chastre E. Davis R. Gespach C. J. Biol. Chem. 1997; 272: 1429-1432Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 35Bhowmick N.A. Zent R. Ghiassi M. McDonnell M. Moses H.L. J. Biol. Chem. 2001; 276: 46707-46713Abstract Full Text Full Text PDF PubMed Scopus (331) Google Scholar). TGF-β has been postulated to play an important role in the normal growth and differentiation of the intestinal and hepatic cells. TGF-β expression is the highest in the villus cells and the lowest in the crypt cells (36Barnard J.A. Beauchamp R.D. Coffey R.J. Moses H.L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1578-1582Crossref PubMed Scopus (316) Google Scholar). Enterocytes not only secrete cytokines but also express their receptors (36Barnard J.A. Beauchamp R.D. Coffey R.J. Moses H.L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1578-1582Crossref PubMed Scopus (316) Google Scholar, 37Eckmann L. Jung H.C. Schurer-Maly C. Panja A. Morzycka-Wroblewska E. Kagnoff M.F. Gastroenterology. 1993; 105: 1689-1697Abstract Full Text PDF PubMed Scopus (0) Google Scholar). It is known that TGF-β levels are increased during liver regeneration (38Bissell D.M. Wang S.S. Jarnagin W.R. Roll F.J. J. Clin. Invest. 1995; 96: 447-455Crossref PubMed Scopus (370) Google Scholar). Bissell et al.(38Bissell D.M. Wang S.S. Jarnagin W.R. Roll F.J. J. Clin. Invest. 1995; 96: 447-455Crossref PubMed Scopus (370) Google Scholar) have shown that TGF-β levels increase in hepatocytes after injury and in lipocytes during inflammation and fibrosis. HepG2, hepatoma, and Caco-2 (colon carcinoma) cells have been used as models of human hepatic and intestinal cells, respectively, to study lipoprotein assembly and cytokine response (39Javitt N.B. FASEB J. 1990; 4: 161-168Crossref PubMed Scopus (306) Google Scholar, 40Levy E. Mehran M. Seidman E. FASEB J. 1995; 9: 626-635Crossref PubMed Scopus (178) Google Scholar). In HepG2 cells, TGF-β is expressed constitutively in an autocrine fashion and affects the hepatic gene expression by binding to its cell surface receptors. TGF-β increases apoCIII expression in these cells (31Kardassis D. Pardali K. Zannis V.I. J. Biol. Chem. 2000; 275: 41405-41414Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). Caco-2 cells express many acute phase proteins inducible by cytokines (41Molmenti E.P. Ziambaras T. Perlmutter D.H. J. Biol. Chem. 1993; 268: 14116-14124Abstract Full Text PDF PubMed Google Scholar) and have detectable levels of TGF-β mRNA (37Eckmann L. Jung H.C. Schurer-Maly C. Panja A. Morzycka-Wroblewska E. Kagnoff M.F. Gastroenterology. 1993; 105: 1689-1697Abstract Full Text PDF PubMed Scopus (0) Google Scholar). It has been shown that proinflammatory cytokines like IL-1β, IL-6, and tumor necrosis factor-α decrease the secretion of apoB by Caco-2 cells, whereas anti-inflammatory TGF-β increases apoB secretion (42Murthy S. Mathur S.N. Varilek G. Bishop W. Field F.J. Am. J. Physiol. Gastrointest. Liver Physiol. 1996; 270: G94-G102Crossref PubMed Google Scholar). The effect of TGF-β on apoB secretion by liver cells has not been described. Here, we show that TGF-β differentially affects apoB secretion in these cells, and this effect is mediated by SMAD3 and SMAD4. Furthermore, acis-element has been localized to 55 kb upstream of theapob gene that responds to TGF-β and increases apoB secretion in Caco-2 cells. Recombinant TGF-β2 was from R & D Systems, Inc. (Minneapolis, MN). Antibodies used for the determination of apoB have been described (43Hussain M.M. Zhao Y. Kancha R.K. Blackhart B.D. Yao Z. Arterioscler. Thromb. Vasc. Biol. 1995; 15: 485-494Crossref PubMed Scopus (63) Google Scholar, 44Bakillah A. Zhou Z. Luchoomun J. Hussain M.M. Lipids. 1997; 32: 1113-1118Crossref PubMed Scopus (38) Google Scholar). Bovine serum albumin (BSA), MAP kinase inhibitor PD98059, and other chemicals were from Sigma. Monoclonal anti-apoA-1 antibody, 4H1, was from the University of Ottawa Heart Institute. Polyclonal anti-apoA-1 antibodies were from Roche Molecular Biochemicals. The β-galactosidase assay kit was from Invitrogen. [14C]Chloramphenicol and Trans-35S label were from ICN Biomedicals, Inc. (Irvine, CA). The human and mouse promoter/enhancer plasmids, −85CAT, 690CAT, 315CAT, 485(F)CAT, and 485(R)CAT have been described before (12Antes T.J. Goodart S.A. Huynh C. Sullivan M. Young S.G. Levy-Wilson B. J. Biol. Chem. 2000; 275: 26637-26648Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar, 14Antes T.J. Goodart S.A. Chen W. Levy-Wilson B. Biochemistry. 2001; 40: 6720-6730Crossref PubMed Scopus (11) Google Scholar) and were kindly provided by Dr. Beatriz Levy-Wilson (Stanford University) (45Antes T.J. Levy-Wilson B. DNA Cell Biol. 2001; 20: 67-74Crossref PubMed Scopus (21) Google Scholar). In these plasmids, expression of chloramphenicol acetyltransferase (CAT) is under the control of various apoB promoter/enhancer elements. The 3TP-Lux construct (a gracious gift from Dr. Joan Massague (Memorial Sloan-Kettering Cancer Center, New York, NY)) contains three AP-1 sites from a collagenase promoter, a SMAD binding region from the PAI-1 promoter, and an adenovirus E4 promoter (46Wieser R. Attisano L. Wrana J.L. Massague J. Mol. Cell. Biol. 1993; 13: 7239-7247Crossref PubMed Google Scholar). Dr. Rik Derynck and Ying Zhang (University of California, San Francisco, CA) generously provided the expression vectors encoding the human SMAD3 and SMAD4 (47Derynck R. Zhang Y. Feng X.H. Cell. 1998; 95: 737-740Abstract Full Text Full Text PDF PubMed Scopus (948) Google Scholar). Caco-2 (human colon carcinoma) cells were cultured (37 °C, 5% CO2, humidified atmosphere) in 75-mm2 flasks (Corning Glassworks, Corning NY) in high glucose Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% fetal bovine serum (FBS),l-glutamine, and antibiotic/antimycotic mixture. Cells from 70–80% confluent flasks were seeded onto polycarbonate micropore membranes that were inserted into Transwells® (24-mm diameter, 3-μm pore size; Corning Costar Corp., Cambridge, MA), and then the media were changed every other day for 14–36 days. For experiments, the apical and the basolateral sides were washed three times with DMEM, and the cells were then incubated for 8–24 h in DMEM plus 0.1% BSA. This was to minimize the exposure of these cells to cytokines present in FBS. Cells were then washed and incubated with 2.0 ml of DMEM plus 0.1% BSA on the apical sides of the Transwells. The basolateral sides received 2.0 ml of DMEM supplemented with 0.1% BSA and different concentrations of either TGF-β1 or TGF-β2. Cells were then incubated (37 °C, 5% CO2, humidified atmosphere) for 17 h. The basolateral conditioned media were used for the determination of apoB and apoA-I levels (48Luchoomun J. Hussain M.M. J. Biol. Chem. 1999; 274: 19565-19572Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar). HepG2 (human hepatoma) cells were cultivated in 75-mm2flasks (Corning Glass) in DMEM supplemented with 10% FBS,l-glutamine and antibiotic/antimycotic mixture at 37 °C in 5% CO2 humidified atmosphere. Cells from 70–80% confluent flasks were seeded into six-well plates (Corning Costar Corp.). Subconfluent (70–80%) cell monolayers were washed thrice with DMEM and incubated for 8–24 h in the presence of DMEM plus 0.1% BSA to minimize their exposure to cytokines present in the serum. These cells were then washed and incubated for 17 h (37 °C, 5% CO2, humidified atmosphere) with 2.0 ml of DMEM containing 0.1% BSA along with different concentrations of either TGF-β1 or TGF-β2. The culture media and cells were collected for further processing. After 17 h of incubation with TGF-β2, differentiated Caco-2 and HepG2 cells were washed with DMEM. HepG2 cells received 2.0 ml of methionine/cysteine-free DMEM containing 0.1% BSA and 10 ng/ml of TGF-β2. In the case of Caco-2 cells, the apical sides received 2.0 ml of methionine/cysteine-free DMEM plus 0.1% BSA, and the basolateral side received 2.0 ml of methionine/cysteine-free DMEM plus 0.1% BSA containing 10 ng/ml of TGF-β2. After 1 h, 100 μCi of Trans-[35S] label were added to each well (to the apical side in the case of Caco-2 cells), and the cells were then incubated for the indicated time periods. Cells were washed with cold DMEM containing methionine and cysteine and were lysed with 0.5 ml of immunoprecipitation lysis buffer (phosphate-buffered saline containing 0.5% deoxycholate, 1% SDS, 1% Triton X-100, 20 mm methionine, 1 mm cysteine, and protease inhibitor mixture). The cell lysates were cleared by centrifugation at 10,000 rpm at 4 °C for 10 min. The supernatants were precleared with 10 μl of protein A + G-Sepharose and used for immunoprecipitation. Precleared cell lysates and the media (basolateral media in the case of Caco-2 cells) were incubated overnight at 4 °C in a rocker with 5 μl of sheep anti-human apoB antibodies. The antigen-antibody complexes were precipitated by adding 20 μl of protein A + G-Sepharose and rocking at 4 °C for 2 h. The samples were spun at 10,000 rpm at 4 °C for 2 min, and the supernatants were discarded. The pellets were washed three times with immunoprecipitation lysis buffer and once with PBS and were finally suspended in 1× Laemmli sample buffer. The suspensions were heated at 95 °C for 5 min and then centrifuged at 10,000 rpm for 2 min. The clear supernatants were applied to SDS-polyacrylamide gels, and proteins were separated by electrophoresis. The gels were fixed, dried, and exposed to the PhosphorImager screen. The intensity of each band was quantified with ImageQuant software (AmershamBiosciences). HepG2 cells and differentiated Caco-2 cells were incubated for 17 h either with or without 10 ng/ml TGF-β2. The total RNA was extracted from the cells using Trizol reagent (Invitrogen) by following the manufacturer's instructions. The total RNA (15 μg) was then run on a denaturing agarose gel and transferred to a nitrocellulose membrane in 20× SSC (20× 0.15 m NaCl and 0.015 m sodium citrate). The RNA was cross-linked to the membrane by exposing it to the UV light. Prehybridization was carried out for 3 h in Quikhyb hybridization solution (Stratagene), and hybridization was carried out in the same solution in the presence of radiolabeled probes and 100 μg/ml denatured and sheared salmon sperm DNA. To prepare different radiolabeled probes, apoB and GAPDH fragments were amplified and labeled with [α-32P]dCTP by using the Random Primers DNA Labeling System (Invitrogen). Membranes were then washed with 2× SSC, 0.1% SDS and exposed overnight to a PhosphorImager screen, and RNA levels were quantified with ImageQuant software (AmershamBiosciences). For RT-PCR, 1 μg of total RNA isolated from nontreated and TGF-β-treated Caco-2 and HepG2 cells was used. A blend of Omniscript and Sensiscript reverse transcriptase provided in the QuantiTect RT Mix (QuantiTect SYBR Green RT-PCR Kit, Qiagen, Valencia, CA) was used according to the manufacturer's instructions to reverse transcribe and amplify apoB and GAPDH sequences. Primers used for apoB and GAPDH were gcactctgcaggggatcccccagatgattggagag and tgatgcccatatttgtcac (apoB) and cagcccagaacatcatccctg and tgttacttataccgatgtcgttg (GAPDH). The reverse transcription was performed at 50 °C for 15 min and stopped by incubating at 95 °C for 15 min. This treatment also denatures the newly synthesized template cDNA and activates TaqDNA polymerase. PCR conditions were 94 °C for 15 s, 55 °C for 20 s, and 72 °C for 20 s. The products were electrophoresed on 2% agarose gel, and the bands were quantified by scanning. Varying amounts (5–10 μg) of plasmid DNAs along with 1 μg of an internal reference plasmid (pCMV-β-gal) were incubated with Fugene-6 (Roche Diagnostic) and introduced to subconfluent (∼70%) monolayers of Caco-2 and HepG2 cells in 75-mm2 flasks and then incubated for 24 h. An equal number of cells were then transferred to six-well plates or Transwells. After 24 h, the cells were washed with DMEM and incubated for 8 h with DMEM containing 0.1% BSA, washed, and treated with or without TGF-β. Three wells received DMEM plus 0.1% BSA containing 10 ng/ml TGF-β, whereas the remaining three wells served as controls (in the case of Transwells, TGF-β was added to the basolateral side). The cells were incubated for 17 h at 37 °C, 5% CO2 in humidified atmosphere, and the medium (from the basolateral side in the case of Transwells) was collected and assayed for apoB mass. Cells were washed and collected in lysis buffer (Promega Corp., Madison, WI). The cell lysates were cleared by centrifugation at 10,000 rpm for 10 min at 4 °C, and supernatants were used for the determination of cellular protein levels and different enzyme activities. Cell protein was quantified by the Bradford method (49Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (214409) Google Scholar) using Coomassie Blue reagent (Pierce). ApoB and apoA-I were quantified by sandwich ELISA (43Hussain M.M. Zhao Y. Kancha R.K. Blackhart B.D. Yao Z. Arterioscler. Thromb. Vasc. Biol. 1995; 15: 485-494Crossref PubMed Scopus (63) Google Scholar, 44Bakillah A. Zhou Z. Luchoomun J. Hussain M.M. Lipids. 1997; 32: 1113-1118Crossref PubMed Scopus (38) Google Scholar). The β-galactosidase and CAT activities were assayed as described previously (50Edlund T. Walker M.D. Barr P.J. Rutter W.J. Science. 1985; 230: 912-916Crossref PubMed Scopus (395) Google Scholar, 51Gorman C.M. Moffat L.F. Howard B.H. Mol. Cell. Biol. 1982; 2: 1044-1051Crossref PubMed Scopus (5292) Google Scholar). The CAT activity levels were quantified with PhosphorImager analysis and the ImageQuant program and were corrected for transfection efficiencies between the flasks by dividing with the β-galactosidase activity values. Luciferase activity was measured as per the manufacturer's instructions (Promega Corp.). To investigate the effect of TGF-β on apoB secretion by HepG2 and differentiated (17–20 days postplating), Caco-2 cells were incubated with increasing concentrations of TGF-β2 (Fig.1). The amount of apoB secreted by the control Caco-2 and HepG2 cells was 944 ± 59 and 1266 ± 82 ng/well, respectively, in agreement with our earlier studies (44Bakillah A. Zhou Z. Luchoomun J. Hussain M.M. Lipids. 1997; 32: 1113-1118Crossref PubMed Scopus (38) Google Scholar, 48Luchoomun J. Hussain M.M. J. Biol. Chem. 1999; 274: 19565-19572Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar,52Luchoomun J. Zhou Z. Bakillah A. Jamil H. Hussain M.M. Arterioscler. Thromb. Vasc. Biol. 1997; 17: 2955-2963Crossref PubMed Scopus (30) Google Scholar, 53Nayak N. Harrison E.H. Hussain M.M. J. Lipid Res. 2001; 42: 272-280Abstract Full Text Full Text PDF PubMed Google Scholar, 54Zhou Z. Luchoomun J. Bakillah A. Hussain M.M. Biochim. Biophys. Acta. 1998; 1391: 13-24Crossref PubMed Scopus (15) Google Scholar). In Caco-2 cells, TGF-β2 showed a concentration-dependent increase in the amount of apoB secreted into the basolateral medium. At 10 ng/ml, TGF-β2 increased apoB secretion by 56 ± 10%. The increases ranged from 20 to 80% in different experiments. At higher concentrations, no further increase in apoB secretion was observed, indicating that the maximum effect was achieved at 10 ng/ml TGF-β2. In contrast, TGF-β2 showed a concentration-dependent decrease in the amount of apoB secreted by HepG2 cells (Fig. 1). The decrease in apoB secretion was 20% at 5 ng/ml and reached a maximum of 30% inhibition at 15 ng/ml. Next, we compared the effect of TGF-β1 and TGF-β2 on apoB secretion in Caco-2 and HepG2 cells (Fig. 2). Both TGF-β1 and TGF-β2 augmented (16–25%) apoB secretion in Caco-2 cells and attenuated (23–30%) apoB secretion in HepG2 cells, indicating that both of these molecules have similar biologic effects. In subsequent experiments, we only used TGF-β2 because of more consistent results and relatively better responses. To determine the earliest time point required for TGF-β2 to exert its effects on apoB secretion, we performed time course experiments. These experiments revealed that statistically significant differential effects on apoB secretion in both cell lines were first apparent after 8 h of treatment (data not shown). These studies showed that TGF-β differentially regulates apoB secretion in intestine and liver-derived cell lines. In the studies described above, a major difference between Caco-2 and HepG2 cells was their state of differentiation; the Caco-2 cells were plated in Transwells and allowed to differentiate for about 2 weeks, whereas HepG2 cells were used 2–3 days after plating. Thus, diverse effects of TGF-β might be related to the differentiation of Caco-2 cells. To test this hypothesis, we studied the effect of TGF-β on Caco-2 cells after 2 days of plating along with HepG2 cells (Fig. 3). As seen before, treatment of HepG2 cells with TGF-β decreased apoB secretion by ∼25%. As expected, nondifferentiated Caco-2 cells secreted (54 ± 7 ng/well) significantly smaller amounts of apoB than the differentiated cells (see above), in agreement with other studies (48Luchoomun J. Hussain M.M. J. Biol. Chem. 1999; 274: 19565-19572Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar,52Luchoomun J. Zhou Z. Bakillah A. Jamil H. Hussain M.M. Arterioscler. Thromb. Vasc. Biol. 1997; 17: 2955-2963Crossref PubMed Scopus (30) Google Scholar). Nonetheless, treatment of these cells increased apoB secretion by 26% (Fig. 3). These experiments were extended to study the effect of TGF-β during the entire course of differentiation of Caco-2 cells. Determination of the differentiation of Caco-2 cells by measuring sucrase activity has been described before (48Lucho" @default.
• W2016886758 created "2016-06-24" @default.
• W2016886758 creator A5009686016 @default.
• W2016886758 creator A5027642225 @default.
• W2016886758 creator A5028536560 @default.
• W2016886758 creator A5043093823 @default.
• W2016886758 creator A5055404631 @default.
• W2016886758 creator A5062811978 @default.
• W2016886758 date "2002-10-01" @default.
• W2016886758 modified "2023-09-27" @default.
• W2016886758 title "Differential, Tissue-specific, Transcriptional Regulation of Apolipoprotein B Secretion by Transforming Growth Factor β" @default.
• W2016886758 cites W1489625468 @default.
• W2016886758 cites W1491692399 @default.
• W2016886758 cites W1528470195 @default.
• W2016886758 cites W1535872730 @default.
• W2016886758 cites W1548779076 @default.
• W2016886758 cites W1579835576 @default.
• W2016886758 cites W1599366995 @default.
• W2016886758 cites W1636022999 @default.
• W2016886758 cites W1640670825 @default.
• W2016886758 cites W1735521937 @default.
• W2016886758 cites W1820484722 @default.
• W2016886758 cites W1898264975 @default.
• W2016886758 cites W1956183677 @default.
• W2016886758 cites W1973012603 @default.
• W2016886758 cites W1973856139 @default.
• W2016886758 cites W1981135463 @default.
• W2016886758 cites W1988402185 @default.
• W2016886758 cites W1989715485 @default.
• W2016886758 cites W1992977676 @default.
• W2016886758 cites W1994273046 @default.
• W2016886758 cites W1994786692 @default.
• W2016886758 cites W1999614450 @default.
• W2016886758 cites W2002144573 @default.
• W2016886758 cites W2002433789 @default.
• W2016886758 cites W2003183550 @default.
• W2016886758 cites W2010231822 @default.
• W2016886758 cites W2011404780 @default.
• W2016886758 cites W2022966687 @default.
• W2016886758 cites W2029626819 @default.
• W2016886758 cites W2031934153 @default.
• W2016886758 cites W2033887719 @default.
• W2016886758 cites W2039487842 @default.
• W2016886758 cites W2040754829 @default.
• W2016886758 cites W2048862043 @default.
• W2016886758 cites W2055141649 @default.
• W2016886758 cites W2059485506 @default.
• W2016886758 cites W2063355128 @default.
• W2016886758 cites W2065367851 @default.
• W2016886758 cites W2066508034 @default.
• W2016886758 cites W2069875643 @default.
• W2016886758 cites W2080508595 @default.
• W2016886758 cites W2082802847 @default.
• W2016886758 cites W2084273795 @default.
• W2016886758 cites W2086258039 @default.
• W2016886758 cites W2091055429 @default.
• W2016886758 cites W2092344861 @default.
• W2016886758 cites W2092646080 @default.
• W2016886758 cites W2095173053 @default.
• W2016886758 cites W2097318755 @default.
• W2016886758 cites W2103031848 @default.
• W2016886758 cites W2105683352 @default.
• W2016886758 cites W2110381465 @default.
• W2016886758 cites W2118375178 @default.
• W2016886758 cites W2121472728 @default.
• W2016886758 cites W2123625253 @default.
• W2016886758 cites W2133193835 @default.
• W2016886758 cites W2134830120 @default.
• W2016886758 cites W2135427256 @default.
• W2016886758 cites W2139959812 @default.
• W2016886758 cites W2154133061 @default.
• W2016886758 cites W2156417547 @default.
• W2016886758 cites W2161826828 @default.
• W2016886758 cites W2164615751 @default.
• W2016886758 cites W2166083242 @default.
• W2016886758 cites W2166749754 @default.
• W2016886758 cites W2407708355 @default.
• W2016886758 cites W2409407209 @default.
• W2016886758 cites W3023473932 @default.
• W2016886758 cites W4293247451 @default.
• W2016886758 cites W4296588288 @default.
• W2016886758 doi "https://doi.org/10.1074/jbc.m205513200" @default.
• W2016886758 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12177061" @default.
• W2016886758 hasPublicationYear "2002" @default.
• W2016886758 type Work @default.
• W2016886758 sameAs 2016886758 @default.
• W2016886758 citedByCount "27" @default.
• W2016886758 countsByYear W20168867582012 @default.
• W2016886758 countsByYear W20168867582014 @default.
• W2016886758 countsByYear W20168867582016 @default.
• W2016886758 countsByYear W20168867582019 @default.
• W2016886758 countsByYear W20168867582022 @default.
• W2016886758 crossrefType "journal-article" @default.
• W2016886758 hasAuthorship W2016886758A5009686016 @default.
• W2016886758 hasAuthorship W2016886758A5027642225 @default.
• W2016886758 hasAuthorship W2016886758A5028536560 @default.
• W2016886758 hasAuthorship W2016886758A5043093823 @default.
• W2016886758 hasAuthorship W2016886758A5055404631 @default.

• next