FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017229649> ?p ?o ?g. }

• W2017229649 endingPage "52051" @default.
• W2017229649 startingPage "52042" @default.
• W2017229649 abstract "Rad51 and Rad54 proteins play a key role in homologous recombination in eukaryotes. Recently, we reported that Ca2+ is required in vitro for human Rad51 protein to form an active nucleoprotein filament that is important for the search of homologous DNA and for DNA strand exchange, two critical steps of homologous recombination. Here we find that Ca2+ is also required for hRad54 protein to effectively stimulate DNA strand exchange activity of hRad51 protein. This finding identifies Ca2+ as a universal cofactor of DNA strand exchange promoted by mammalian homologous recombination proteins in vitro. We further investigated the hRad54-dependent stimulation of DNA strand exchange. The mechanism of stimulation appeared to include specific interaction of hRad54 protein with the hRad51 nucleoprotein filament. Our results show that hRad54 protein significantly stimulates homology-independent coaggregation of dsDNA with the filament, which represents an essential step of the search for homologous DNA. The results obtained indicate that hRad54 protein serves as a dsDNA gateway for the hRad51-ssDNA filament, promoting binding and an ATP hydrolysis-dependent translocation of dsDNA during the search for homologous sequences. Rad51 and Rad54 proteins play a key role in homologous recombination in eukaryotes. Recently, we reported that Ca2+ is required in vitro for human Rad51 protein to form an active nucleoprotein filament that is important for the search of homologous DNA and for DNA strand exchange, two critical steps of homologous recombination. Here we find that Ca2+ is also required for hRad54 protein to effectively stimulate DNA strand exchange activity of hRad51 protein. This finding identifies Ca2+ as a universal cofactor of DNA strand exchange promoted by mammalian homologous recombination proteins in vitro. We further investigated the hRad54-dependent stimulation of DNA strand exchange. The mechanism of stimulation appeared to include specific interaction of hRad54 protein with the hRad51 nucleoprotein filament. Our results show that hRad54 protein significantly stimulates homology-independent coaggregation of dsDNA with the filament, which represents an essential step of the search for homologous DNA. The results obtained indicate that hRad54 protein serves as a dsDNA gateway for the hRad51-ssDNA filament, promoting binding and an ATP hydrolysis-dependent translocation of dsDNA during the search for homologous sequences. Calcium and Double-stranded Break RepairJournal of Biological ChemistryVol. 279Issue 50PreviewDouble-stranded breaks in DNA can be lethal if left unrepaired. Fortunately, cells have evolved several mechanisms, including one known as homologous recombination, to ensure the repair of these breaks. In homologous recombination, the undamaged sister chromatid is used as a template for repair. After an initial break is detected, the broken double-stranded DNA is processed to generate a single-stranded region with a 3′ overhang. Rad51 polymerizes onto the single-stranded DNA to form a nucleoprotein filament. Full-Text PDF Open Access Homologous recombination (HR) 1The abbreviations used are: HR, homologous recombination; RPA, replication protein A; ssDNA, single-stranded DNA; dsDNA, double-stranded DNA; DTT, dithiothreitol; BSA, bovine serum albumin. is critical for maintaining genome stability both in prokaryotes and eukaryotes (1Flores-Rozas H. Kolodner R.D. Trends Biochem. Sci. 2000; 25: 196-200Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, 2Wyman C. Ristic D. Kanaar R. DNA Repair (Amst.). 2004; 3: 827-833Crossref PubMed Scopus (157) Google Scholar). Its major function in the cell is to repair DNA double-stranded breaks, the most lethal type of DNA damage, and to promote correct segregation of homologous chromosomes during meiosis (3West S.C. Nat. Rev. Mol. Cell. Biol. 2003; 4: 435-445Crossref PubMed Scopus (813) Google Scholar). Malfunction of HR leads to genome instability causing genetic diseases in humans. The process of HR involves enzymatic processing of the broken dsDNA into resected DNA heteroduplex with a protruding 3′-ssDNA tail (4Haber J.E. Bioessays. 1995; 17: 609-620Crossref PubMed Scopus (166) Google Scholar, 5Lee S.E. Moore J.K. Holmes A. Umezu K. Kolodner R.D. Haber J.E. Cell. 1998; 94: 399-409Abstract Full Text Full Text PDF PubMed Scopus (651) Google Scholar, 6Sun H. Treco D. Szostak J.W. Cell. 1991; 64: 1155-1161Abstract Full Text PDF PubMed Scopus (424) Google Scholar, 7Paull T.T. Gellert M. Mol. Cell. 1998; 1: 969-979Abstract Full Text Full Text PDF PubMed Scopus (706) Google Scholar). Following resection, a homologous DNA pairing protein, Rad51/RecA, is loaded onto the ssDNA to form a contiguous helical nucleoprotein filament (8Bianco P.R. Tracy R.B. Kowalczykowski S.C. Front. Biosci. 1998; 3: D570-D603Crossref PubMed Google Scholar, 9Radding C.M. Curr. Biol. 1993; 3: 358-360Abstract Full Text PDF PubMed Scopus (15) Google Scholar, 10Sung P. Krejci L. Van Komen S. Sehorn M.G. J. Biol. Chem. 2003; 278: 42729-42732Abstract Full Text Full Text PDF PubMed Scopus (343) Google Scholar). The filament searches for an intact homologous dsDNA template and then pairs with it to commence the exchange of DNA strands between homologous partners (11Haber J.E. Cell. 1997; 89: 163-166Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). The DNA joint molecule formed as a result of strand exchange can be used to prime DNA synthesis on a homologous DNA template, restoring the structure of the damaged DNA. In Saccharomyces cerevisiae, in addition to Rad51 protein, several other proteins, members of the Rad52 epistasis group, are important for DNA double-strand break repair by homologous recombination (12Game J.C. Mutat. Res. 2000; 451: 277-293Crossref PubMed Scopus (62) Google Scholar, 13Hays S.L. Firmenich A.A. Massey P. Banerjee R. Berg P. Mol. Cell. Biol. 1998; 18: 4400-4406Crossref PubMed Scopus (122) Google Scholar). Among them Rad54 protein plays an especially important role both in vivo and in vitro (12Game J.C. Mutat. Res. 2000; 451: 277-293Crossref PubMed Scopus (62) Google Scholar). Rad54 protein belongs to the Swi2/Snf2 class of DNA-binding proteins that participate in the remodeling (assembly/disassembly) of chromatin complexes (14Pazin M.J. Kadonaga J.T. Cell. 1997; 88: 737-740Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar, 15Fyodorov D.V. Kadonaga J.T. Cell. 2001; 106: 523-525Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). Like most members of the Swi2/Snf2 class, Rad54 protein, both yeast and human, possesses dsDNA-dependent ATPase activity (16Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (346) Google Scholar, 17Swagemakers S.M. Essers J. de Wit J. Hoeijmakers J.H. Kanaar R. J. Biol. Chem. 1998; 273: 28292-28297Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar). Chromatin remodeling activity was demonstrated for yeast and Drosophila Rad54 protein (18Jaskelioff M. Van Komen S. Krebs J.E. Sung P. Peterson C.L. J. Biol. Chem. 2003; 278: 9212-9218Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 19Alexeev A. Mazin A. Kowalczykowski S.C. Nat. Struct. Biol. 2003; 10: 182-186Crossref PubMed Scopus (194) Google Scholar, 20Alexiadis V. Kadonaga J.T. Genes Dev. 2002; 16: 2767-2771Crossref PubMed Scopus (133) Google Scholar). Rad54 protein topologically modifies DNA structure, introducing transient positive and negative supercoils into covalently closed circular DNA (21Tan T.L. Essers J. Citterio E. Swagemakers S.M. de Wit J. Benson F.E. Hoeijmakers J.H. Kanaar R. Curr. Biol. 1999; 9: 325-328Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 22Petukhova G. Van Komen S. Vergano S. Klein H. Sung P. J. Biol. Chem. 1999; 274: 29453-29462Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). In vitro, yeast Rad54 protein strongly stimulates the DNA strand exchange activity of yRad51 protein (16Petukhova G. Stratton S. Sung P. Nature. 1998; 393: 91-94Crossref PubMed Scopus (346) Google Scholar, 22Petukhova G. Van Komen S. Vergano S. Klein H. Sung P. J. Biol. Chem. 1999; 274: 29453-29462Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar). The interaction between yRad51 and yRad54 proteins appears to be synergistic; reciprocally, the yRad51-ssDNA filament enhances dsDNA-dependent ATP hydrolysis, dsDNA unwinding (23Mazin A.V. Bornarth C.J. Solinger J.A. Heyer W.D. Kowalczykowski S.C. Mol. Cell. 2000; 6: 583-592Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar, 24Van Komen S. Petukhova G. Sigurdsson S. Stratton S. Sung P. Mol. Cell. 2000; 6: 563-572Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar), and chromatin remodeling promoted by yRad54 protein (19Alexeev A. Mazin A. Kowalczykowski S.C. Nat. Struct. Biol. 2003; 10: 182-186Crossref PubMed Scopus (194) Google Scholar). Also, it was found that yRad54 protein forms a specific and stoichiometric co-complex with the yRad51-ssDNA filament and significantly stabilizes it (23Mazin A.V. Bornarth C.J. Solinger J.A. Heyer W.D. Kowalczykowski S.C. Mol. Cell. 2000; 6: 583-592Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar, 25Wolner B. van Komen S. Sung P. Peterson C.L. Mol. Cell. 2003; 12: 221-232Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar, 26Mazin A.V. Alexeev A.A. Kowalczykowski S.C. J. Biol. Chem. 2003; 278: 14029-14036Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). In addition, it was reported that yRad54 protein stimulates DNA branch migration mediated by yRad51 protein and facilitates the removal of yRad51 protein from the DNA heteroduplex product (27Solinger J.A. Heyer W.D. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 8447-8453Crossref PubMed Scopus (78) Google Scholar, 28Solinger J.A. Kiianitsa K. Heyer W.D. Mol. Cell. 2002; 10: 1175-1188Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar). The biochemical activities of human Rad54 protein, including its dsDNA-dependent ATPase and dsDNA-unwinding and interactions with hRad51 protein, have been discovered and characterized previously (17Swagemakers S.M. Essers J. de Wit J. Hoeijmakers J.H. Kanaar R. J. Biol. Chem. 1998; 273: 28292-28297Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 21Tan T.L. Essers J. Citterio E. Swagemakers S.M. de Wit J. Benson F.E. Hoeijmakers J.H. Kanaar R. Curr. Biol. 1999; 9: 325-328Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 29Ristic D. Wyman C. Paulusma C. Kanaar R. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 8454-8460Crossref PubMed Scopus (111) Google Scholar, 30Golub E.I. Kovalenko O.V. Gupta R.C. Ward D.C. Radding C.M. Nucleic Acids Res. 1997; 25: 4106-4110Crossref PubMed Scopus (104) Google Scholar). However, studies on the functions of hRad54 protein in DNA strand exchange promoted by hRad51 protein have only started to emerge (31Sigurdsson S. Van Komen S. Petukhova G. Sung P. J. Biol. Chem. 2002; Google Scholar). The reason for this lag is that the reaction conditions which support the activities of both hRad51 and hRad54 proteins have not been readily identified. Recently, we discovered that in the presence of Mg2+, a traditional in vitro cofactor, hRad51 protein behaves as a self-inactivating ATPase; by hydrolyzing ATP the hRad51-ATP-ssDNA filament rapidly converts into an inactive hRad51-ADP-ssDNA form (32Bugreev D.V. Mazin A.V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9988-9993Crossref PubMed Scopus (196) Google Scholar). We further found that Ca2+ helps to preserve the filament in an active ATP-bound form by inhibiting ATP hydrolysis by hRad51 protein. As a consequence, DNA strand exchange activity of hRad51 protein is greatly stimulated by Ca2+. Here we tested the effect of Ca2+ on DNA strand exchange promoted by the hRad51 nucleoprotein filament in the presence of hRad54 protein. In the presence of Ca2+, hRad54 protein stimulates DNA strand exchange much greater than under standard conditions. The observed effect of Ca2+ on DNA strand exchange promoted by hRad51 and hRad54 proteins may have physiological relevance, since cellular concentration of Ca2+, a ubiquitous cellular regulator in vertebrates (33Berridge M.J. Lipp P. Bootman M.D. Nat. Rev. Mol. Cell. Biol. 2000; 1: 11-21Crossref PubMed Scopus (4493) Google Scholar), is elevated in response to DNA damage and during meiosis I, when homologous recombination takes place (34Spielberg H. June C.H. Blair O.C. Nystrom-Rosander C. Cereb N. Deeg H.J. Exp. Hematol. 1991; 19: 742-748PubMed Google Scholar, 35Schieven G.L. Kirihara J.M. Gilliland L.K. Uckun F.M. Ledbetter J.A. Mol. Biol. Cell. 1993; 4: 523-530Crossref PubMed Scopus (54) Google Scholar, 36Gafter U. Malachi T. Ori Y. Breitbart H. J. Lab. Clin. Med. 1997; 130: 33-41Abstract Full Text PDF PubMed Scopus (27) Google Scholar, 37Sakai H. Ito E. Cai R.X. Yoshioka T. Kubota Y. Hashimoto K. Fujishima A. Biochim. Biophys. Acta. 1994; 1201: 259-265Crossref PubMed Scopus (107) Google Scholar, 38Negre-Salvayre A. Salvayre R. Biochim. Biophys. Acta. 1992; 1123: 207-215Crossref PubMed Scopus (33) Google Scholar, 39Tombes R.M. Simerly C. Borisy G.G. Schatten G. J. Cell Biol. 1992; 117: 799-811Crossref PubMed Scopus (245) Google Scholar, 40Carroll J. Swann K. Whittingham D. Whitaker M. Development (Camb.). 1994; 120: 3507-3517Crossref PubMed Google Scholar). High activities of both hRad51 and hRad54 proteins in the presence of Ca2+ allowed us to study the interactions between these two key human HR proteins in detail and to clarify the function of hRad54 protein in DNA strand exchange. Proteins and DNA—Yeast Rad54 and Rad51 proteins, human Dmc1, and Rad51 and RPA proteins were purified as described (41Sigurdsson S. Trujillo K. Song B. Stratton S. Sung P. J. Biol. Chem. 2001; 276: 8798-8806Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar, 42Li Z. Golub E.I. Gupta R. Radding C.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11221-11226Crossref PubMed Scopus (128) Google Scholar, 43Zaitseva E.M. Zaitsev E.N. Kowalczykowski S.C. J. Biol. Chem. 1999; 274: 2907-2915Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 44Henricksen L.A. Umbricht C.B. Wold M.S. J. Biol. Chem. 1994; 269: 11121-11132Abstract Full Text PDF PubMed Google Scholar). All oligonucleotides used in this study (Table I) were synthesized using phosphoroamidite chemistry and were purified by denaturing 6–10% PAGE. The concentrations of the oligonucleotides were measured spectrophotometrically (1 A260 unit of ssDNA = 33 μg/ml). dsDNA oligonucleotides were prepared as described (45Sambrook J. Russell D.W. Third Edition. Molecular Cloning: A Laboratory Manual. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York2001: 1.65-1.68Google Scholar) and stored at –20 °C. Oligonucleotides were labeled using [γ-32P]ATP and T4 polynucleotide kinase (26Mazin A.V. Alexeev A.A. Kowalczykowski S.C. J. Biol. Chem. 2003; 278: 14029-14036Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar). Supercoiled pUC19 dsDNA was purified using alkaline lysis method followed by CsCl-ethidium bromide equilibrium centrifugation (45Sambrook J. Russell D.W. Third Edition. Molecular Cloning: A Laboratory Manual. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York2001: 1.65-1.68Google Scholar). Linear 2686-bp blunt-ended dsDNA fragment was prepared by cleavage of pUC19 dsDNA with SmaI restriction endonuclease. A mixture of 1373- and 1313-bp blunt-ended dsDNA fragments was produced by digestion of pUC19 dsDNA with ScaI and AflIII restriction endonucleases. A 679-bp blunt-ended dsDNA fragment was produced by cleavage of pUC19 scDNA with AluI restriction endonuclease and purified by 6% non-denaturing PAGE (45Sambrook J. Russell D.W. Third Edition. Molecular Cloning: A Laboratory Manual. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York2001: 1.65-1.68Google Scholar). All restriction endonucleases were from New England Biolabs. After cleavage DNA fragments were deproteinized by phenol extraction. All DNA concentrations are expressed as molar in nucleotide.Table IOligonucleotides used in this study.#1, 63-mer,5′-ACAGCACCAG ATTCAGCAAT TAAGCTCTAA GCCATCCGCA AAAATGACCT CTTATCAAAA GGA#2, 63-mer,5′-TCCTTTTGAT AAGAGGTCAT TTTTGCGGAT GGCTTAGAGC TTAATTGCTG AATCTGGTGC TGT, is complementary to #1#5, 32-mer,5′-CCATCCGCAA AAATGACCTC TTATCAAAAG GA#6, 32-mer,5′-TCCTTTTGAT AAGAGGTCAT TTTTGCGGAT GG, is complementary to #5#25, 48-mer,5′-GCAATTAAGC TCTAAGCCAT CCGCAAAAAT GACCTCTTAT CAAAAGGA#26, 48-mer,5′-TCCTTTTGAT AAGAGGTCAT TTTTGCGGAT GGCTTAGAGC TTAATT GC, is complementary to #25#71, 94-mer,5′-CTTTAGCTGC ATATTTACAA CATGTTGACC TACAGCACCA GATTC AGCAA TTAAGCTCTA AGCCATCCGC AAAAATGACC TCTTATCAAA AGGA#90, 90-mer,5′-CGGGTGTCGG GGCTGGCTTA ACTATGCGGC ATCAGAGCAG ATTGTACTGA GAGTGCACCA TATGCGGTGT GAAATACCGC ACAGATGCGT#91, 90-mer,5′-ACGCATCTGT GCGGTATT TCACACCGCA TATGGTGCAC TCTCAGTACA ATCTGCTCTG ATGCCGCATA GTTAAGCCAG CCCCGACACC CG, is complementary to #90#114, 135-mer,5′-CGGGTGTCGG GGCTGGCTTA ACTATGCGGC ATCAGAGCAG ATTGTACTGA GAGTGCACCA TATGCGGTGT GAAATACCGC ACAGATGCGT AAGGAGAAAA TACCGCATCA GGCGCCATTCGCCATTCAGG CTGCG#115, 135-mer,5′-CGCAGCCTGA ATGGCGAATG GCGCCTGATG CGGTATTTTC TCCTTACGCA TCTGTGCGGT ATTTCACACC GCATATGGTG CACTCTCAGT ACAATCTGCT CTGATGCCGC ATAGTTAAGC CAGCCCCGAC ACCCG, is complementary to #114 Open table in a new tab Purification of hRad54 Protein—A glutathione S-transferase-tagged version of hRad54 protein was expressed using Baculovirus Expression System (Clontech). Sf21 cells (density 1 × 106) were infected with the recombinant baculoviruses at multiplicity of infection of 5 and after 48 h of incubation were collected by centrifugation (1500 × g) and washed twice with ice-cold phosphate-buffered saline (pH 7. 4), containing 140 mm NaCl, 2.7 mm KCl, 8 mm NaHPO4, and 1.5 mm KH2PO4. The cell pellet was frozen and stored at –80 °C. All purification steps were performed at 4 °C. Cells (10 g) were lysed by incubation in ten volumes of ice-cold buffer A (50 mm Tris-HCl, pH 7.5, 200 mm KCl, 2 mm EDTA, 10% glycerol, 10 mm 2-mercaptoethanol, 0.5% Nonidet P-40) supplemented with EDTA-free protease inhibitors mixture (Roche Applied Science) for 30 min with a constant stirring. The crude extract was clarified by ultracentrifugation (100, 000 × g for 60 min) (Fraction I) and loaded on a Q-Sepharose column (20 ml) equilibrated with T20 buffer (20 mm Tris-HCl, pH 7.5, 1 mm EDTA, 10% glycerol, and 10 mm 2-mercaptoethanol), containing 200 mm KCl. The Q-Sepharose column flow-through (Fraction II) was collected and the KCl concentration was increased to 500 mm. This fraction was loaded on a glutathione-Sepharose column (10 ml) equilibrated with phosphate-buffered saline containing 500 mm KCl and washed with T20 buffer containing 500 mm KCl. hRad54 protein was eluted with T50 buffer (50 mm Tris-HCl, pH 8.0, 500 mm KCl, 1 mm EDTA, 10% glycerol, 10 mm 2-mercaptoethanol) containing 20 mm glutathione. The fraction containing hRad54 protein (Fraction III) was concentrated to 1 ml volume in a dialysis bag that was placed on solid polyethylene glycol (Mr 20,000) and further fractionated in a Superdex-200 column (58 ml), equilibrated with buffer K20 (20 mm KH2PO4, pH 7.5, 0.5 mm EDTA, 10% glycerol, 10 mm 2-mercaptoethanol) containing 500 mm KCl. The fraction containing hRad54 protein (Fraction IV) was diluted with 4 volumes of K20 and loaded on a Resource-S column (1 ml) equilibrated with buffer K20 containing 100 mm KCl. The hRad54 protein was eluted with a 20-ml gradient of KCl (100 mm to 1 m) in buffer K20. The hRad54 protein fraction (Fraction V) was dialyzed against storage buffer (20 mm Tris-HCl, pH 7.5, 400 mm KCl, 0.1 mm DTT, 30% glycerol). The total yield of hRad54 protein was 2.7 mg. The protein contained no contaminating nuclease activities and appeared nearly homogeneous in Coomassie stained SDS-Polyacrylamide gels. To produce hRad54 K189R protein, the mutation in the hRAD54 gene was generated using QuikChange™ site-directed mutagenesis kit (Stratagene). The gene was sequenced to ensure that no mutation other than this intended had been introduced. The hRad54 K189R mutant protein was expressed and purified as described for the wild type hRad54 protein. Spectrophotometric ATP Hydrolysis Assay—The hydrolysis of ATP by Rad54 protein was monitored spectrophotometrically as described (46Kowalczykowski S.C. Krupp R.A. J. Mol. Biol. 1987; 193: 97-113Crossref PubMed Scopus (200) Google Scholar). The oxidation of NADH, coupled to ADP phosphorylation, resulted in a decrease in absorbance at 340 nm, which was continuously monitored by a Hewlett-Packard 8453 diode array spectrophotometer using UV-visible ChemStation software. The rate of ATP hydrolysis was calculated from the rate of change in absorbance using the following formula: rate of A340 decrease (s–1) × 9880 = rate of ATP hydrolysis (μm/min) (46Kowalczykowski S.C. Krupp R.A. J. Mol. Biol. 1987; 193: 97-113Crossref PubMed Scopus (200) Google Scholar). The reactions in standard buffer containing 20 mm Tris-HCl, pH 7.5, 0.9 mm MgCl2, 0.5 mm CaCl2, 1 mm DTT, 1 mm ATP, 3 mm phosphoenolpyruvate, pyruvate kinase (20 units/ml), lactate dehydrogenase (20 units/ml), and NADH (200 μg/ml), and the indicated amounts of DNA and hRad54 protein were carried out at 30 °C. Prior to initiation of ATP hydrolysis by addition of hRad54 protein, the reactions were preincubated at 30 °C for 5 min. To examine the effect of hRad51-ssDNA filament on the ATPase activity of hRad54, hRad51 protein (800 nm) was incubated with ssDNA (#71, 94-mer; 2.4 μm) at 37 °C for 10 min and then at 30 °C for 5 min in standard buffer prior to addition of hRad54 (20 nm). Kinetic parameters of the ATPase reactions were determined using GraphPad Prism software version 4.0. ATPase Assay Using Thin Layer Chromatography (TLC)—The hRad54 protein (80 nm) was incubated with pUC19 supercoiled dsDNA (62 μm) and 1 mm ATP, 20 nCi of [γ-32P]ATP in 10 μl of reaction buffer containing 20 mm Tris-HCl, pH 7.5, 1 mm DTT, 100 μg/ml BSA, 0.9 mm MgCl2, and 0.75 mm CaCl2 at 30 °C. To examine the effect of the hRad51-ssDNA filament on the ATPase activity of hRad54, Rad51 protein (800 nm) was incubated with ssDNA (#71, 94-mer; 2.4 μm) at 37 °C for 10 min and then at 30 °C for 5 min in the same buffer prior to addition of hRad54 (80 nm). The level of ATP hydrolysis was determined using TLC on PEI-cellulose plates in running buffer containing 1 m formic acid and 0.3 m LiCl. The products of ATP hydrolysis were quantified using a Storm 840 PhosphorImager (Molecular Dynamics). D-loop Formation—The nucleoprotein filaments were formed by incubating of hRad51 protein with 32P-labeled ssDNA (#90, 90-mer) in buffer containing 20 mm Tris-HCl, pH 7.5, 1 mm ATP, 100 μg/ml BSA, 1mm DTT, 20 mm KCl (added with the protein stock), 0.9 mm MgCl2 (or indicated otherwise), CaCl2 (in the indicated concentrations), and the ATP regenerating system (30 units/ml creatine phosphokinase and 20 mm phosphocreatine) for 10 min at 37 °C (or as indicated otherwise). Then hRad54 was added to the filaments followed by addition of pUC19 dsDNA (62 μm nucleotide or 11.6 nm molecules) to initiate joint molecule (D-loops) formation. Aliquots (10 μl) were withdrawn, and joint molecules were deproteinized by treatment with 25 mm EDTA, 1.2% SDS, and proteinase K (880 μg/ml) for 15 min at 37 °C; mixed with a 0.10 volume of loading buffer (70% glycerol, 0.1% bromphenol blue); and analyzed by electrophoresis in 1% agarose-TAE (40 mm Tris acetate, pH 8.0, and 1 mm EDTA) gels. The gels were dried on DE81 chromatography paper and quantified using a Storm 840 PhosphorImager (Molecular Dynamics). The yield was expressed as percentage of the total plasmid DNA. The yeast Rad51-ssDNA filaments were formed by incubating yRad51 protein (2.0 μm) with 32P-labeled ssDNA (#90, 90-mer; 6.0 μm) in buffer containing 35 mm Tris-HCl, pH 7.5, 2.5 mm ATP, 100 μg/ml BSA, 1 mm DTT, 3 mm MgCl2, 1.0 mm CaCl2, and the ATP regenerating system (30 units/ml creatine phosphokinase and 20 mm phosphocreatine) for 15 min at 30 °C, followed by addition of yRad54 or hRad54 (200 nm). Joint molecule formation was initiated by addition of supercoiled pUC19 dsDNA (130 μm) and was carried out at 30 °C. The products were analyzed as described above. Assay for Coaggregation of DNA—This assay measures homology-independent conjunction of the hRad51-ssDNA filaments with dsDNA in complexes that sediment at more than 10,000 S (Svedberg) (2 min at 15,000 × g) (47Tsang S.S. Chow S.A. Radding C.M. Biochemistry. 1985; 24: 3226-3232Crossref PubMed Scopus (99) Google Scholar). hRad51 protein was incubated with ssDNA in buffer containing 20 mm Tris-HCl, pH 7.5, 1 mm ATP, 100 μg/ml BSA, 1 mm DTT, 20 mm KCl (added with the protein stocks), NaCl (in the indicated concentrations), 0.9 mm MgCl2, CaCl2 (in the indicated concentrations), and the ATP regenerating system (30 units/ml creatine phosphokinase and 20 mm phosphocreatine) for 15 min at 37 °C. When required, the indicated amounts of hRad54 protein were added to the filaments. Coaggregation was initiated by addition of 32P-labeled pUC19 dsDNA, linearized by BamHI restriction endonuclease, and carried out for 5 min at 37 °C. Aliquots (10 μl) were withdrawn from the reaction mixture and coaggregates were collected by centrifugation in 0.5-ml Eppendorf tubes at 15,000 × g for 5 min at 21 °C. The yield of coaggregates was determined using a radioactive counter (Beckman LS 6500). Residual retention of the radioactive DNA on the tube walls, ∼2–3%, was subtracted from the measurements. hRad54 Protein Efficiently Stimulates DNA Strand Exchange Activity of hRad51 Protein in the Presence of Ca2+— Using the D-loop assay we tested the stimulatory effect of hRad54 on DNA pairing promoted by hRad51 protein. In accord with previously published data (31Sigurdsson S. Van Komen S. Petukhova G. Sung P. J. Biol. Chem. 2002; Google Scholar), we observed that in the presence of Mg2+ at 30 °C stimulation of joint molecule formation was transient and the yield of joint molecules was low (Fig. 1, A and B). We then tested whether this stimulation can be enhanced in the presence of Ca2+, which increases DNA pairing activity of hRad51 protein (32Bugreev D.V. Mazin A.V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9988-9993Crossref PubMed Scopus (196) Google Scholar). Indeed, when we incorporated 0.5 mm CaCl2 into the reaction mixture, we observed a dramatic 12-fold increase of joint molecule formation in the presence of hRad54 protein, whereas the activity of hRad51 alone was still low at 30 °C (Fig. 1, C and D). We repeated this experiment at 37 °C, a temperature optimal for hRad51 protein. We found that at 37 °C, hRad54 protein also strongly stimulated hRad51 protein, ∼3-fold (Fig. 2A, squares and circles). Similar to yeast Rad54 protein, the ATPase activity of hRad54 protein is essential for stimulation of joint molecule formation; little or no stimulation was observed with the ATPase-deficient mutant of hRad54 protein, hRad54 K189R (Fig. 2A, triangles). Compared with yeast Rad54 protein (48Van Komen S. Petukhova G. Sigurdsson S. Sung P. J. Biol. Chem. 2002; 277: 43578-43587Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar), hRad54 protein appears to be sufficiently stable at 37 °C; after 5 min of preincubation at 37 °C in the presence of the hRad51-ssDNA filament, hRad54 protein maintained 98% of its ATPase activity (Fig. 2B). Therefore, D-loop formation, a rapid reaction completed in 2–5 min, was not significantly affected by thermal denaturation of hRad54 protein. Therefore, we used 37 °C temperature for joint molecule formation in all experiments described below.Fig. 2Stimulation of joint molecule formation by hRad54 nucleoprotein requires ATP hydrolysis and efficiently occurs at 37 °C. A, the hRad51-ssDNA nucleoprotein filaments were formed at 37 °C in standard buffer supplemented with 0.5 mm CaCl2. Then hRad54 storage buffer (circles) or hRad54 protein (120 nm), the wild type (squares) or the K189R mutant (triangles), were added to the filaments. Joint molecule formation was initiated by addition of pUC19 dsDNA and carried out for the indicated periods of time. B, hRad54 protein (20 nm) was incubated with the hRad51-ssDNA filament in standard buffer for the indicated periods of time at 37 °C, then the reaction mixtures were transferred to 30 °C, and ATP hydrolysis was initiated by addition of dsDNA (6 μm). The ATP hydrolysis rate of Rad54 protein was monitored using a spectrophotometric assay.View Large Image Figure ViewerDownload (PPT) We determined the effect of Ca2+ concentration on joint molecule formation promoted by hRad51 protein alone or in the presence of hRad54 protein. hRad54 protein lowered the Ca2+ concentration required for the maximal DNA pairing activity (Fig. 3A). The stimulatory effect of hRad54 protein was especially strong at Ca2+ concentrations lower than 1 mm. At higher than 1 mm Ca2+, both the ATPase activity of hRad54 protein and its stimulatory effect on hRad51 DNA pairing declined (Fig. 3, A and B), indicating further the important role of the hRad54 protein ATPase activity for stimulation of DNA strand exchange. Thus, our current results together with the previously published data (32Bugreev D.V. Mazin A.V. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9988-9993Crossref PubMed Scopus (196) Google Scholar) demonstrate that Ca2+ is important for both DNA strand exchange activity of hRad51 protein and for stimulation of this activity by hRad54 protein. hRad54 Protein Stimul" @default.
• W2017229649 created "2016-06-24" @default.
• W2017229649 creator A5023103944 @default.
• W2017229649 creator A5071817184 @default.
• W2017229649 date "2004-12-01" @default.
• W2017229649 modified "2023-09-26" @default.
• W2017229649 title "Human Rad54 Protein Stimulates DNA Strand Exchange Activity of hRad51 Protein in the Presence of Ca2+" @default.
• W2017229649 cites W1485786260 @default.
• W2017229649 cites W1599277155 @default.
• W2017229649 cites W1605838085 @default.
• W2017229649 cites W1676891985 @default.
• W2017229649 cites W171067487 @default.
• W2017229649 cites W1832288685 @default.
• W2017229649 cites W1964702635 @default.
• W2017229649 cites W1966320645 @default.
• W2017229649 cites W1969896771 @default.
• W2017229649 cites W1972206421 @default.
• W2017229649 cites W1974488881 @default.
• W2017229649 cites W1984114789 @default.
• W2017229649 cites W1986730363 @default.
• W2017229649 cites W1986926515 @default.
• W2017229649 cites W1987600396 @default.
• W2017229649 cites W1990819415 @default.
• W2017229649 cites W1995376834 @default.
• W2017229649 cites W2000199388 @default.
• W2017229649 cites W2006268714 @default.
• W2017229649 cites W2006895915 @default.
• W2017229649 cites W2007342042 @default.
• W2017229649 cites W2014199526 @default.
• W2017229649 cites W2017988777 @default.
• W2017229649 cites W2031292590 @default.
• W2017229649 cites W2039057244 @default.
• W2017229649 cites W2039196623 @default.
• W2017229649 cites W2042900062 @default.
• W2017229649 cites W2046091365 @default.
• W2017229649 cites W2052942360 @default.
• W2017229649 cites W2053069224 @default.
• W2017229649 cites W2058412239 @default.
• W2017229649 cites W2064553941 @default.
• W2017229649 cites W2071721857 @default.
• W2017229649 cites W2072421613 @default.
• W2017229649 cites W2082981258 @default.
• W2017229649 cites W2089777262 @default.
• W2017229649 cites W2090263062 @default.
• W2017229649 cites W2109038089 @default.
• W2017229649 cites W2111490168 @default.
• W2017229649 cites W2113147636 @default.
• W2017229649 cites W2115478867 @default.
• W2017229649 cites W2124055215 @default.
• W2017229649 cites W2128443344 @default.
• W2017229649 cites W2130628767 @default.
• W2017229649 cites W2150453102 @default.
• W2017229649 cites W2151318295 @default.
• W2017229649 cites W2154074565 @default.
• W2017229649 cites W2154317163 @default.
• W2017229649 cites W2158526159 @default.
• W2017229649 cites W2164558029 @default.
• W2017229649 cites W2183548956 @default.
• W2017229649 cites W2322869446 @default.
• W2017229649 doi "https://doi.org/10.1074/jbc.m410244200" @default.
• W2017229649 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15466868" @default.
• W2017229649 hasPublicationYear "2004" @default.
• W2017229649 type Work @default.
• W2017229649 sameAs 2017229649 @default.
• W2017229649 citedByCount "68" @default.
• W2017229649 countsByYear W20172296492012 @default.
• W2017229649 countsByYear W20172296492013 @default.
• W2017229649 countsByYear W20172296492014 @default.
• W2017229649 countsByYear W20172296492015 @default.
• W2017229649 countsByYear W20172296492016 @default.
• W2017229649 countsByYear W20172296492017 @default.
• W2017229649 countsByYear W20172296492018 @default.
• W2017229649 countsByYear W20172296492019 @default.
• W2017229649 countsByYear W20172296492020 @default.
• W2017229649 countsByYear W20172296492022 @default.
• W2017229649 crossrefType "journal-article" @default.
• W2017229649 hasAuthorship W2017229649A5023103944 @default.
• W2017229649 hasAuthorship W2017229649A5071817184 @default.
• W2017229649 hasBestOaLocation W20172296491 @default.
• W2017229649 hasConcept C153911025 @default.
• W2017229649 hasConcept C185592680 @default.
• W2017229649 hasConcept C552990157 @default.
• W2017229649 hasConcept C55493867 @default.
• W2017229649 hasConcept C86803240 @default.
• W2017229649 hasConcept C95444343 @default.
• W2017229649 hasConceptScore W2017229649C153911025 @default.
• W2017229649 hasConceptScore W2017229649C185592680 @default.
• W2017229649 hasConceptScore W2017229649C552990157 @default.
• W2017229649 hasConceptScore W2017229649C55493867 @default.
• W2017229649 hasConceptScore W2017229649C86803240 @default.
• W2017229649 hasConceptScore W2017229649C95444343 @default.
• W2017229649 hasIssue "50" @default.
• W2017229649 hasLocation W20172296491 @default.
• W2017229649 hasOpenAccess W2017229649 @default.
• W2017229649 hasPrimaryLocation W20172296491 @default.
• W2017229649 hasRelatedWork W106631345 @default.
• W2017229649 hasRelatedWork W1622205638 @default.
• W2017229649 hasRelatedWork W1976736675 @default.

• next