FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017341363> ?p ?o ?g. }

• W2017341363 endingPage "23523" @default.
• W2017341363 startingPage "23514" @default.
• W2017341363 abstract "Snail, a transcriptional repressor of E-cadherin expression, plays a role in the process of epithelial-mesenchymal transition. However, the molecular basis of the role of snail in epithelial-mesenchymal transition has not been fully clarified. Here we show that the expression of snail in epithelial Madin-Darby canine kidney (MDCK) and A431 cells enhances both cell detachment and attachment. Snail did not confer resistance to anoikis induced by loss of contact but instead enhanced cell attachment to extracellular matrices such as fibronectin. This attachment was inhibited by Arg-Gly-Asp (RGD) peptides. Up-regulation of the promoter activity of integrin αV was observed in snail-expressing MDCK (MDCK/snail) cells. Snail also enhanced MDCK cell migration toward osteopontin that is a ligand for integrin αVβ3. We confirmed the reduction of basement membrane proteins such as laminin (LN) α3, β3, and γ2 (laminin-5/LN-5) and of receptors for LN-5 such as integrins α3, α6, or β4 in MDCK/snail or in snail-expressing A431 (A431/snail) cells. Nevertheless, suppression of LN-α3 chain by transient transfection of small interference RNAs resulted in no enhancement of cell detachment. We also found an induction of matrix metalloproteinase-3 in MDCK/snail and A431/snail cells. However, the inhibition of matrix metalloproteinase-3 showed no significant effect on the detachment of MDCK/snail cells. These results suggest that snail enhances cell detachment by multiple mechanism and leads to cell migration and reattachment at a second site, at least in part, by changing the expression of integrins in the cells. Snail, a transcriptional repressor of E-cadherin expression, plays a role in the process of epithelial-mesenchymal transition. However, the molecular basis of the role of snail in epithelial-mesenchymal transition has not been fully clarified. Here we show that the expression of snail in epithelial Madin-Darby canine kidney (MDCK) and A431 cells enhances both cell detachment and attachment. Snail did not confer resistance to anoikis induced by loss of contact but instead enhanced cell attachment to extracellular matrices such as fibronectin. This attachment was inhibited by Arg-Gly-Asp (RGD) peptides. Up-regulation of the promoter activity of integrin αV was observed in snail-expressing MDCK (MDCK/snail) cells. Snail also enhanced MDCK cell migration toward osteopontin that is a ligand for integrin αVβ3. We confirmed the reduction of basement membrane proteins such as laminin (LN) α3, β3, and γ2 (laminin-5/LN-5) and of receptors for LN-5 such as integrins α3, α6, or β4 in MDCK/snail or in snail-expressing A431 (A431/snail) cells. Nevertheless, suppression of LN-α3 chain by transient transfection of small interference RNAs resulted in no enhancement of cell detachment. We also found an induction of matrix metalloproteinase-3 in MDCK/snail and A431/snail cells. However, the inhibition of matrix metalloproteinase-3 showed no significant effect on the detachment of MDCK/snail cells. These results suggest that snail enhances cell detachment by multiple mechanism and leads to cell migration and reattachment at a second site, at least in part, by changing the expression of integrins in the cells. The molecular basis of the EMT 2The abbreviations used are:EMTepithelial-mesenchymal transitionECMextracellular matrixLNlamininCol IVcollagen IVFNfibronectinBMbasement membraneMDCKMadin-Darby canine kidneyDMEMDulbecco's modified Eagle's mediumFCSfetal calf serumPBSphosphate-buffered salineBSAbovine serum albuminMTT3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromideRTreverse transcriptionsiRNAsmall interference RNApoly-HEMApoly-2-hydroxyethyl methacrylateLDHlactate dehydrogenaseCMVcytomegalovirusFLfirefly luciferaseRLRenilla luciferasePIpropidium iodideCMconditioned mediumDCdeoxycholic acid. 2The abbreviations used are:EMTepithelial-mesenchymal transitionECMextracellular matrixLNlamininCol IVcollagen IVFNfibronectinBMbasement membraneMDCKMadin-Darby canine kidneyDMEMDulbecco's modified Eagle's mediumFCSfetal calf serumPBSphosphate-buffered salineBSAbovine serum albuminMTT3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromideRTreverse transcriptionsiRNAsmall interference RNApoly-HEMApoly-2-hydroxyethyl methacrylateLDHlactate dehydrogenaseCMVcytomegalovirusFLfirefly luciferaseRLRenilla luciferasePIpropidium iodideCMconditioned mediumDCdeoxycholic acid. process involves changes in the expression, distribution, and function of a number of proteins that play a role in extracellular matrix remodeling or in cell-cell adhesion, such as MMPs, and E-cadherins (1Kiemer A.K. Takebuchi K. Quinlan M.P. Oncogene. 2001; 20: 217-226Crossref Scopus (69) Google Scholar, 2Pulyaeva H. Bueno J. Polette M. Birembaut P. Sato H. Seiki M. Thompson E.W. Clin. Exp. Metastasis. 1997; 15: 111-120Crossref PubMed Scopus (100) Google Scholar). Down-regulation of E-cadherin expression frequently occurs during the progression of carcinomas (3Takeichi M. Curr. Opin. Cell Biol. 1995; 5: 806-811Crossref Scopus (828) Google Scholar, 4Christofori G. Semb H. Trends Biochem. Sci. 1999; 24: 73-76Abstract Full Text Full Text PDF PubMed Scopus (648) Google Scholar). Over the last few years, several transcription factors have been characterized as repressors of E-cadherin. These factors repress E-cadherin transcription through binding to the proximal E-boxes of the human or murine promoters for E-cadherin (5Bolos V. Peinard H. Perez-Moreno M.A. Fraga M.F. Esreller M. Cano A. J. Cell Sci. 2003; 116: 499-511Crossref PubMed Scopus (911) Google Scholar, 6Yang J. Mani S.A. Donaher J.L. Ramaswamy S. Itzykson R.A. Come C. Cell. 2004; 117: 927-939Abstract Full Text Full Text PDF PubMed Scopus (3039) Google Scholar). Among these repressors of E-cadherin, the zinc-finger factor snail induces a full EMT when overexpressed in epithelial MDCK cells leading to the acquisition of a motile/invasive phenotype (7Cano A. Perez-Moreno M.A. Rodrigo I. Locascio A. Blanco M.J. del Barrio M.G. Nat. Cell Biol. 2000; 2: 76-83Crossref PubMed Scopus (2870) Google Scholar, 8Peinado H. Marine F. Cubillo E. Stark H.J. Fusening N.N. Niet M.A. J. Cell Sci. 2004; 117: 2827-2839Crossref PubMed Scopus (134) Google Scholar). In agreement with this role of EMT induction, snail has been found to down-regulate the expression of epithelial genes, such as occludin and claudin (9Ohkubo T. Ozawa M. J. Cell Sci. 2004; 117: 1675-1685Crossref PubMed Scopus (278) Google Scholar), and to induce the expression of mesenchymal and invasive genes, such as FN and MMP-9 (7Cano A. Perez-Moreno M.A. Rodrigo I. Locascio A. Blanco M.J. del Barrio M.G. Nat. Cell Biol. 2000; 2: 76-83Crossref PubMed Scopus (2870) Google Scholar, 10Jorda M. Olmeda D. Vinyals A. Valero E. Cubillo E. Llorens A. Cano A. Fabra A. J. Cell Sci. 2005; 118: 3371-3385Crossref PubMed Scopus (188) Google Scholar). The conversion of tumor cells from an epithelial to the mesenchymal phenotype is closely associated with the acquisition of metastatic potential (11Birchmeier C. Birchmeier W. Brand-Saberi B. Acta Anat. (Basel). 1996; 156: 17-26Crossref Scopus (230) Google Scholar). Snail expression has been detected in an increasing number of human carcinoma and melanoma cell lines (12Peinado H. Portillo F. Cano A. Int. J. Dev. Biol. 2004; 48: 365-375Crossref PubMed Scopus (482) Google Scholar). More importantly in terms of cell motility, snail is expressed at the invasive front of epidermoid carcinomas (8Peinado H. Marine F. Cubillo E. Stark H.J. Fusening N.N. Niet M.A. J. Cell Sci. 2004; 117: 2827-2839Crossref PubMed Scopus (134) Google Scholar) and is associated with the invasiveness of ductal breast carcinomas and hepatocarcinomas (13Blanco M.J. Moreno-Bueno G. Sarrio D. Locascio A. Cano A. Palacios J. Nieto M.A. Oncogene. 2002; 21: 3241-3246Crossref PubMed Scopus (484) Google Scholar, 14Sugimachi K. Tanaka S. Kameyama T. Taguchi K. Aishima S. Shimada M. Sugimachi K. Tsuneyoshi M. Clin. Cancer Res. 2003; 9: 2657-2664PubMed Google Scholar). However, the precise role of snail in tumor progression has not been clarified.BMs are dynamic, thin, sheet-like structures that consist of ECM proteins, on which epithelial cells reside. Disruption of the BM itself or integrins, the receptors for BM components, contributes to the tumor process (15Havenith M.G. Arends J.W. Simon R. Volovics A. Wiggers T. Bosman F.T. Cancer. 1988; 62: 2207-2211Crossref PubMed Scopus (97) Google Scholar). BM is composed of a number of different proteins. LN, the main component of BM, is comprised of at least 15 different LN trimers. LN-5 is composed of α3, β3, and γ2 chains and is present in most epithelial BMs. LN-5 interacts with integrin α6β4 and plays a crucial role in maintaining the stability of epithelial cells (16Ryan M.C. Lee K. Miyashita Y. Carter W.G. J. Cell Biol. 1999; 145: 1309-1323Crossref PubMed Scopus (255) Google Scholar). Oral squamous carcinoma cells that overexpress snail are deficient in LN-5 synthesis (17Takkunen M. Grenman R. Hukkanen M. Korhonen M. García de Herreros A. Virtanen I. J. Histochem. Cytochem. 2006; 54: 1263-1275Crossref PubMed Scopus (83) Google Scholar). Indeed, we found the expressions of LN-5 and its receptor proteins integrin α3, α6, and β4 were strongly suppressed in snail-expressing cells. However, cell detachment was not enhanced by inhibition of the expression of LN-5. These findings indicate that snail must affect the expressions of other molecules besides LN-5 to induce cell detachment.Collagen IV is also a major component of BM. It has been suggested that Collagen IV α5/α6 chains might protect against rapid cancer progression, as it has been shown that the normal production and assembly of BM is disrupted during malignant cancer progression (18Ikeda K. Iyama K. Ishikawa N. Egami H. Nakao M. Sado Y. Ninomiya Y. Baba H. Am. J. Pathol. 2006; 168: 856-865Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar).Integrins, heterodimeric transmembrane receptor complexes, interact with specific ECM proteins and thereby transmit signals to the cells. Enhanced expression of integrin αVβ3, in either a solid tumor or a melanoma, has been shown to correlate with tumor malignancy and with enhanced tumor cell growth and invasion (19Hood J.D. Bednarski M. Frausto R. Guccione S. Reisfeld R.A. Xiang R. Cheresh D.A. Science. 2002; 296: 2404-2407Crossref PubMed Scopus (784) Google Scholar, 20Brooks P.C. Montgomery A.M. Rosenfeld M. Reisfeld R.A. Hu T. Klier G. Cheresh D.A. Cell. 1994; 79: 1157-1164Abstract Full Text PDF PubMed Scopus (2169) Google Scholar). Furthermore, enhanced activity of integrin αVβ3 leads to increased tumor cell migration and adhesion to bone matrix protein (21Pecheur I. Peyruchaud O. Serre C.M. Guglielmi J. Voland C. Bourre F. Margue C. Cohen-Solal M. Buffet A. Kieffer N. Clezardin P. FASEB J. 2002; 10: 1266-1268Crossref Scopus (192) Google Scholar).Although genetic alterations in cancerous cells may vary in different types of metastatic cancers, all of these cancers share the characteristic of dissemination to multiple distant organs (22Chambers A.F. Groom A.C. MacDonald I.C. Nat. Rev. Cancer. 2002; 2: 563-572Crossref PubMed Scopus (3006) Google Scholar, 23Bogenrieder T. Herlyn M. Oncogene. 2003; 22: 6524-6536Crossref PubMed Scopus (497) Google Scholar). Typically, these aggressive cells detach from the site of origin, move across tissue boundaries, eventually extravasate from these vessels, and then colonize new sites. Although numerous studies have examined cell migration and invasion in snail-expressing cells, a role for snail expression in the regulation of cell attachment or detachment has not been described. This is the first report that demonstrates that snail enhances cell detachment from and attachment to ECM proteins at least in part by regulating the expression of integrins and BM proteins.EXPERIMENTAL PROCEDURESCells and Transfection—MDCK and A431 were grown in DMEM supplemented with 10% fetal calf serum (FCS). MDCK and A431 cells were transfected with 10 μg of HA-tagged human snail expression vector or control vector by a calcium phosphate method, as described previously (10Jorda M. Olmeda D. Vinyals A. Valero E. Cubillo E. Llorens A. Cano A. Fabra A. J. Cell Sci. 2005; 118: 3371-3385Crossref PubMed Scopus (188) Google Scholar), and were designated MDCK/snail, MDCK/neo, A431/snail, and A431/neo cells, respectively. We mainly used dog MDCK cells in this series of experiments, because we believe the cells show typical normal epithelial cell phenotype. However, because of the limited commercial availability of antibodies that recognize canine proteins, we also used human A431 cells. The mouse osteoblast cell line, MC3T3-E1 (kindly provided by Dr. Ohnishi, Kagoshima University), was maintained in α-minimal essential medium (Sigma) supplemented with 10% FCS containing antibiotics. To initiate osteoblast differentiation, confluent MC3T3-E1 cells were treated with 50 μg/ml ascorbic acid (Wako, Osaka, Japan) and 5 mm glycerophosphate (Merck, Darmstadt, Germany). After 4 weeks of treatment, the conditioned medium of these cells was collected every 4–5 days (24Bandow K. Nishikawa Y. Ohnishi T. Kakimoto K. Soejima K. Iwabuchi S. Kuroe K. Matsuguchi T. J. Cell Physiol. 2007; 211: 392-398Crossref PubMed Scopus (88) Google Scholar).Antibodies and Reagents—Mouse monoclonal antibodies against E-cadherin, integrins αV, α3, α5, and β4, and LN-β3 were purchased from BD Biosciences (Lexington, KY). Mouse anti-human integrin αVβ3 antibody (LM609) was purchased from Chemicon (Temecula, CA). Mouse monoclonal antibody against vinculin was purchased from Sigma. Rat monoclonal antibody against HA was purchased from Roche Applied Science (Mannheim, Germany). Human fibronectin was purchased from BD Biosciences Labware (Bedford, MA). Human collagen IV was purchased from Chemicon. Human collagen I was purchased from Collaborative Biomedical products (Bedford, MA). Mouse osteopontin was purchased from R&D systems (Minneapolis, MN). Human LN-5 was purchased from Oriental Yeast Co. (Nagahama, Japan). FN-related peptides (GRGDSP and GRGESP) were purchased from Takara (Otsu, Japan).Attachment Assays—Attachment assays were performed as follows. Briefly, FCS or 10 μg/ml of FN and LN-1 solution in phosphate-buffered saline (PBS) was spread evenly on the surface of 96-well plates. The protein was allowed to adsorb for either 1 or 12 h at 37 °C. Nonspecific interactions were blocked with 0.2% bovine serum albumin (BSA) in PBS. Cell suspensions were prepared in serum-free DMEM, and 2.5 × 104 cells were seeded on 96-well plates. After 30- to 40-min incubation, non-adherent cells were removed and adherent cells were fixed with 70% ethanol. Following staining with a 0.1% solution of crystal violet or methylene blue for 30 min, the cells were rinsed and the crystal violet or methylene blue adsorbed onto the adherent cells was dissolved with 0.5% Triton X-100. The optical density was then measured at 595 nm (25Heilshorn S.C. Dizio K.A. Welsh E.R. Tirrell D.A. Biomaterials. 2003; 24: 4245-4252Crossref PubMed Scopus (164) Google Scholar). The number of the cells that adhered to the plate was calculated by using a cell-number standard curve (cell number versus absorbance values) and presented. For peptide inhibition assays the peptides GRGDNP and GRGESP, at a final concentration of 1 mm, were incubated with the cell suspension for 10 min before seeding of the cells to the wells.Detachment Assays—Suspended cells (1.2 × 104) were plated on 24-well plates and incubated for 24 h. Cells were then dissociated from the culture plate by incubation with 0.125% trypsin/0.1 mm EDTA or 0.025% trypsin/0.02 mm EDTA at 37 °C for the indicated times. DMEM containing 10% FCS or trypsin inhibitor was then added to the cells to inhibit trypsin. Following removal of the detached cells, the number of remaining cells was determined using crystal violet as described above. The data are also presented as a percentage of remained adherent cells to untreated cells. Detachment assays were performed in Transwell plates with a 0.4-μm pore size (Corning, Corning, NY). Cells (1 × 105) were seeded in the upper chamber of the Transwell plates, incubated for 24 h, and then treated with 0.125% trypsin/0.1 mm EDTA that was added to the lower chamber. At the indicated time trypsin was inactivated with 0.2% trypsin inhibitor, the cells in the upper chamber were rinsed, and the remained cells were determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as previously described (26Uchimiya H. Furukawa T. Okamoto M. Nakajima Y. Matsushita S. Ikeda R. Gotanda T. Haraguchi M. Sumizawa T. Ono M. Kuwano M. Kanzaki T. Akiyama S. Cancer Res. 2002; 62: 2834-2839PubMed Google Scholar).RT-PCR Analysis—Total RNA were extracted from the cells with the Isogen kit (Wako, Osaka Japan) and was reverse transcribed using ReverTra Ace (Toyobo, Osaka, Japan). The resulting cDNAs were employed as templates for specific PCR reactions using GoTaq DNA polymerase (Promega, Madison, WI). The sequences for PCR primers were listed in Table 1 and 2. RT-PCR of glyceraldehyde-3-phosphate dehydrogenase was used as an internal control.TABLE 1Dog primer sequences for RT-PCRGeneForward primerReverse primerIntegrin αVTCTGTTGCTGCCACTGACATAACTGGTCTGGCTCTGTATAIntegrin α5GGCAGCCACGGCGTCCCGCTGTGGGCATCAGAGGTGGCAGGTGGCTTIntegrin α6GAACTGCTTTTATCGGTCTCAGAATGTCCAAGTAGTTCAGIntegrin β3GATGAGGCCCTGCCTCTGGGCTCCTTGCCGAACTTGGATGGAGAALN-α3ACAGATGGGGAAGGAAACAACAGTGGCCCGCTTTGCTTGGLN-β3CTGTCGAGAAGGGTTTGGTGTCTGCTCCATCTTGCTCCTGLN-γ2AATGGGAAGTCCAGGCAGTGTGTCACAGCGCTCGCCGGTGACAGCCollagen IVATGTCCATGGCGCCCATCGCCTTCAAGGTGGATGGCGTGGSyndecanAGGACGAGGGGAGCTATGACCGTGGGGGCCTTCTGATAAGMMP-3TGGGTCTCTTTCACTCGGCTGGATAACCGGCTTGTACCTCGAPDHTGAAGGTCGGTGTGAACGGATTTGGCCATGTAGGCCATGAGGTCCACCAC Open table in a new tab TABLE 2Human primer sequences for RT-PCRGeneForward primerReverse primerIntegrin αVAGAATCATTCCTATTCTCTGTTCTTCTTGAGGTGGCCGGAIntegrin β3CCTACATGACCGAAAATACCTAATCCCTCCCCACAAATACTGIntegrin β4GGTCCAGGAAGATCCATTTCAATAGCAGACCTCGTAGGCTGTGALN-α3ACAGATGGAGAGGGAAACAACATTTGCCTGCTTGGCTTGGLN-γ2TCAGCCAGAAGGTTTCAGATGCCGGCCAGCTTCACTGTTGCTCAAGCAGCollagen IVATGTCAATGGCACCCATCACCTTCAAGGTGGACGGCGTAGSyndecanAGGACGAAGGCAGCTACTCCTTTTGGTGGGCTTCTGGTAGGMMP-3GAACAATGGACAAAGGATACAACAAATGAAAACGAGGTCCTTGCTAGSnailACTACAGCGAGCTGCAGGGTGTGGCTTCGGATGTGCGAPDHGCATCCTGGGCTACACTGGTGAGGAGGGGAGATTCAG Open table in a new tab siRNA-mediated Protein Knockdown—MDCK/neo cells (2 × 105) were seeded per well in 6-well plates in antibiotic-free DMEM with FCS. After 24-h incubation, MDCK/neo cells were transfected with an siRNA duplex directed against LN-α3 (Sigma Genosys, Ishikari, Japan) using Lipofectamine 2000 (Invitrogen). The sequence of the siRNA target was 5′-AAATGACTACGAAGCCAAACT-3′ (27Mak G.Z. Kavanaugh G.M. Buschmann M.M. Stickley S.M. Koch M. Goss K.H. Waechter H. Zuk A. Matlin K.S. Mol. Biol. Cell. 2006; 17: 3664-3677Crossref PubMed Google Scholar). After incubation for 5 h, FCS was then added and the cells were incubated for an additional 24 h. The cells were then harvested and seeded for further experiments.Anoikis Assay—Poly-2-hydroxyethyl methacrylate (poly-HEMA) (Sigma, St. Louis, MO) was applied to 6-well plates (0.5 ml/well of a 12 mg/ml stock solution in ethanol) and allowed to air dry. This procedure was repeated twice. MDCK/neo and MDCK/snail cells (5 × 105/well) were cultured either on poly-HEMA-coated or non-coated plates for 24 h. After incubation, detached and suspended cells from poly-HEMA-coated plates were harvested in DMEM and centrifuged at 500 × g for 5 min. Cells from non-coated plates were trypsinized, collected, and centrifuged in a similar manner. The pellets were stained with 100 μl of propidium iodide (PI) solution (10 μg/ml in PBS) at 25 °C for 15 min. The number of viable cells was then analyzed by using flow cytometry (FACSCalibur, BD Biosciences, San Jose, CA).Lactate Dehydrogenase (LDH) Assay—MDCK/neo and MDCK/snail cells (1 × 105) were cultured either on poly-HEMA coated, or non-coated 24-well plates for 24 h at 37 °C. The medium was recovered from cell culture and was assayed for LDH, released from dying cells, using a previously described method (28Haraguchi M. Torii S. Matsuzawa S. Xie Z. Kitada S. Krajewski S. Yoshida H. Mak T.W. Reed J.C. J. Exp. Med. 2000; 191: 1709-1720Crossref PubMed Scopus (138) Google Scholar). Data for released LDH were normalized relative to total LDH and expressed as a percentage. All measurements were performed in triplicate.Promoter Assay—The mouse integrin αV promoter, with the indicated deletions of the 5′-flanking region, was cloned upstream from the luciferase reporter gene (pGL3-Basic vector, Promega). The luciferase expression vectors, including the fragments deleted up to positions –3200, –1500, –933, –617, –310, –108, +22, to +97 were designated pIαV(–3.2k)-Luc, pIαV(–1.5k)-Luc, pIαV(–933)-Luc, pIαV(–617)-Luc, pIαV(–310)-Luc, pIαV(–108)-Luc, pIαV(+22)-Luc, and pIαV(+97)-Luc, respectively (29Kambe M. Miyamoto Y. Hayashi M. Biochim. Biophys. Acta. 1998; 1395: 209-219Crossref PubMed Scopus (11) Google Scholar). Cells (1 × 105) were seeded into 24-well plates 24 h prior to transfection. One microgram of reporter vector and 20 ng of pRL-CMV vector were transfected per well using Lipofectamine Plus. After 48 h, both firefly (FL) and Renilla luciferase (RL) activities were measured using the Dual luciferase reporter assay kit (Promega). FL activities were normalized to the RL activities. The experiments were performed in triplicate.Migration Assay—Migration assays were performed in Transwell plates with an 8-μm pore size (Corning) as described previously (26Uchimiya H. Furukawa T. Okamoto M. Nakajima Y. Matsushita S. Ikeda R. Gotanda T. Haraguchi M. Sumizawa T. Ono M. Kuwano M. Kanzaki T. Akiyama S. Cancer Res. 2002; 62: 2834-2839PubMed Google Scholar) with minor modifications. Briefly, 0.1 ml of cells (1 × 106 cells/ml) in DMEM supplemented with 0.1% BSA was seeded into the upper wells. FN or osteopontin was added to 0.6 ml of DMEM supplemented with 0.1% BSA in the lower wells at a final concentration of 10 μg/ml. Conditioned medium of MC3T3-E1 cells or fresh medium containing 10% FCS (0.15 ml) was added to 0.45 ml of DMEM supplemented with 0.1% BSA in lower wells. After 4 h of incubation, the cells remaining in the upper wells were completely removed. The cells that had migrated to the lower surface of the filter were subjected to the MTT assay.Statistical Analysis—Statistical analysis was performed by Student's t test. Differences were considered to be significant at p < 0.05.RESULTSSnail Enhances Cell Detachment from Tissue Culture Dishes—We observed that the transfection of snail into MDCK cells enhanced cell detachment from tissue culture dishes. We therefore quantified detachment of MDCK/snail cells and compared it to that of MDCK/neo cells. Cells were sparsely seeded to inhibit cell-cell contacts. Following incubation for 24 h at 37 °C, the cells were treated with 0.125% trypsin/0.1 mm EDTA for up to 10 min. The remaining adherent cells were then stained with crystal violet, and the percentage of remaining cells to total cells was assessed. Approximately 88% of MDCK/snail cells detached within 1 min by trypsin/EDTA treatment (Fig. 1A). In contrast, only ∼55% of MDCK/neo cells were detached at this time point. We also found that ∼83% of A431/snail cells whereas only 35% of A431/neo cells detached within 4 min by 0.025% trypsin/0.02 mm EDTA treatment (Fig. 1B). It has been proposed that cell-cell junctional complexes can inhibit the accessibility of trypsin to cell surface proteins that mediate cell attachment to the substratum. E-cadherin is considered to be the main component of junctional complexes that mediates this inhibition. To remove the effect of adhesion proteins on the accessibility of trypsin, we performed the detachment assay in Transwell chambers. MDCK/snail or MDCK/neo cells (1 × 105 cells/well) were seeded in the upper part of the chambers and, 24 h later, 0.1% trypsin/0.02% EDTA was added to the lower part of the chambers. Cells remaining adhered to the upper chamber were then counted by MTT assay. Over 80% of MDCK/snail cells were detached after 3 min of trypsin treatment compared with only 3% of MDCK/neo cells (Fig. 1C). Therefore, altered accessibility of trypsin to the proteins involved in cell-substrate attachment is not the reason why MDCK/snail cells show accelerated cell detachment compared with control cells.Snail Reduces the Expression of ECM Proteins—We next determined whether the rapid detachment of snail-expressing cells was due to changes in the ECM produced by these cells. We therefore compared the adhesion of MDCK/neo or MDCK/snail cells to the ECM deposited by either cell type. MDCK/snail cells adhered to the ECM deposited by both the MDCK/neo and MDCK/snail cells, with a comparable extent. However, MDCK/neo cells were much less adherent to the ECM laid down by MDCK/snail cells than to their own ECM (Fig. 2). This result suggests that the ECM components deposited by the MDCK/snail cells must be altered in some way. The expression of ECM proteins involved in binding to the receptors of MDCK/neo cells might be reduced in MDCK/snail cells. The ECM prepared with deoxycholic acid had more ability to support adhesion of MDCK/neo cells than that prepared with trypsin. Trypsin might degrade the proteins that involved in the adhesion of MDCK/neo cells. Furthermore, the expression of receptors for ECM proteins may be altered in MDCK/snail cells, thereby MDCK/snail cells adhered to the ECM from both cell types to a comparable level. The major adhesive components expressed and secreted by epithelial cells are LN, heparan sulfate proteoglycan, and collagens. We therefore determined protein and mRNA expressions of these molecules in MDCK/neo, MDCK/snail, A431/neo, and A431/snail cells. LN-β3 protein was undetectable in MDCK/snail nor A431/snail cells but was expressed in MDCK/neo and A431/neo cells, as measured with an antibody against LN-β3 (Fig. 3, A–D). The expressions of the LN-α3, -β3, and -γ2 subunits were also reduced in MDCK/snail cells, and the expressions of LN-α3 and γ2 were reduced in A431/snail cells when assayed by RT-PCR (Fig. 3, E and F). In agreement with a previous report, the expression of vimentin, as measured by Western blot, was enhanced in MDCK/snail and in A431/snail cells compare with MDCK/neo cells and A431/neo cells (Fig. 3, A–C). In contrast, the level of mRNA expression of syndecan was similar in MDCK/neo and MDCK/snail cells and A431/neo or A431/snail cells when assayed by RT-PCR (Fig. 3, E and F). We also found not only LN-5 protein expression but also the expressions of receptor proteins for LN-5 such as integrin α3 and α6 were strongly suppressed in MDCK/snail cells as assessed by Western blot (Fig. 3, A and C) or by RT-PCR (Fig. 3E), respectively. The expression of integrin β4 was also suppressed in A431/snail cells as assessed by both Western blot (Fig. 3, B and D) and by RT-PCR (Fig. 3F). These data indicate that snail regulates the expression of specific ECM proteins and their receptors. We also determined the expressions of decorin, collagen I, integrin α2, integrin β1, and MMP-2, and found they were unaltered in snail-expressing cells (data not shown).FIGURE 2The ECM produced by MDCK/snail cells is less adhesive for MDCK/neo cells than that produced by MDCK/neo cells. To obtain the deposited ECM for this assay, MDCK/neo and MDCK/snail cells were seeded (5 × 104 cells/well) on 24-well plates and incubated for 48 h. The cells were then removed from the matrix protein by treatment with 0.1% deoxycholic acid (DC) or 0.125% trypsin/0.1 mm EDTA (trypsin). The ECM deposited by MDCK/neo (neo DC and neo trypsin) or by MDCK/snail (snail DC and snail trypsin) were washed with DMEM with 10% FCS and PBS. Blocking of nonspecific interactions was achieved by incubation with 0.2% BSA. MDCK/neo and MDCK/snail cells were then seeded (5 × 104 cells/well) onto the ECM-covered plates and incubated for 40 min at 37 °C in DMEM without FCS. After removing the non-adherent cells with PBS, adherent cells were quantified by staining with crystal violet. Data are the mean ± the S.E. for triplicate determinations. *, p < 0.05 versus ECM deposited by MDCK/neo cells.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 3Snail regulates the expression of integrins and ECM proteins. A and B, effect of snail on the protein expression of integrins and ECM proteins. MDCK/neo and MDCK/snail cells (A) and A431/neo and A431/snail cells (B) were lysed in SDS sample buffer and subjected to Western blot analysis with the indicated antibodies. Vinculin was served as an internal control for protein loading. Measurement of protein expression level was achieved by using ImageJ (National Institutes of Health). The data are presented as the relative intensity of the bands of from MDCK/snail cells to that in MDCK/neo cells (C) and the bands from A431/snail to that in A431/neo cells (D). *, p < 0.05 versus MDCK/neo (C) or A431/neo (D) cells. Effect of snail on mRNA expression of integrins and ECM proteins in MDCK cells (E) and in A431 cells (F). RT-PCR of glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. The sequences for PCR primers are listed in Tables 1 and 2.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Inhi" @default.
• W2017341363 created "2016-06-24" @default.
• W2017341363 creator A5009623265 @default.
• W2017341363 creator A5018695200 @default.
• W2017341363 creator A5034132414 @default.
• W2017341363 creator A5047006149 @default.
• W2017341363 creator A5061019980 @default.
• W2017341363 creator A5068682184 @default.
• W2017341363 creator A5070137364 @default.
• W2017341363 creator A5077002221 @default.
• W2017341363 date "2008-08-01" @default.
• W2017341363 modified "2023-10-17" @default.
• W2017341363 title "Snail Regulates Cell-Matrix Adhesion by Regulation of the Expression of Integrins and Basement Membrane Proteins" @default.
• W2017341363 cites W1526747357 @default.
• W2017341363 cites W1533260412 @default.
• W2017341363 cites W1734622341 @default.
• W2017341363 cites W1965822047 @default.
• W2017341363 cites W1973046279 @default.
• W2017341363 cites W1974643611 @default.
• W2017341363 cites W1995480433 @default.
• W2017341363 cites W2001753204 @default.
• W2017341363 cites W2007897263 @default.
• W2017341363 cites W2028134580 @default.
• W2017341363 cites W2036008499 @default.
• W2017341363 cites W2039628059 @default.
• W2017341363 cites W2047318490 @default.
• W2017341363 cites W2050085273 @default.
• W2017341363 cites W2059128799 @default.
• W2017341363 cites W2064675222 @default.
• W2017341363 cites W2070669176 @default.
• W2017341363 cites W2080888904 @default.
• W2017341363 cites W2082481267 @default.
• W2017341363 cites W2083487959 @default.
• W2017341363 cites W2084479444 @default.
• W2017341363 cites W2084867085 @default.
• W2017341363 cites W2087367170 @default.
• W2017341363 cites W2091189056 @default.
• W2017341363 cites W2094157386 @default.
• W2017341363 cites W2109998353 @default.
• W2017341363 cites W2131230383 @default.
• W2017341363 cites W2131718664 @default.
• W2017341363 cites W2134203671 @default.
• W2017341363 cites W2135109846 @default.
• W2017341363 cites W2153801209 @default.
• W2017341363 cites W2155554726 @default.
• W2017341363 cites W2163321666 @default.
• W2017341363 doi "https://doi.org/10.1074/jbc.m801125200" @default.
• W2017341363 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3259798" @default.
• W2017341363 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18593711" @default.
• W2017341363 hasPublicationYear "2008" @default.
• W2017341363 type Work @default.
• W2017341363 sameAs 2017341363 @default.
• W2017341363 citedByCount "97" @default.
• W2017341363 countsByYear W20173413632012 @default.
• W2017341363 countsByYear W20173413632013 @default.
• W2017341363 countsByYear W20173413632014 @default.
• W2017341363 countsByYear W20173413632015 @default.
• W2017341363 countsByYear W20173413632016 @default.
• W2017341363 countsByYear W20173413632017 @default.
• W2017341363 countsByYear W20173413632018 @default.
• W2017341363 countsByYear W20173413632019 @default.
• W2017341363 countsByYear W20173413632020 @default.
• W2017341363 countsByYear W20173413632021 @default.
• W2017341363 countsByYear W20173413632022 @default.
• W2017341363 countsByYear W20173413632023 @default.
• W2017341363 crossrefType "journal-article" @default.
• W2017341363 hasAuthorship W2017341363A5009623265 @default.
• W2017341363 hasAuthorship W2017341363A5018695200 @default.
• W2017341363 hasAuthorship W2017341363A5034132414 @default.
• W2017341363 hasAuthorship W2017341363A5047006149 @default.
• W2017341363 hasAuthorship W2017341363A5061019980 @default.
• W2017341363 hasAuthorship W2017341363A5068682184 @default.
• W2017341363 hasAuthorship W2017341363A5070137364 @default.
• W2017341363 hasAuthorship W2017341363A5077002221 @default.
• W2017341363 hasBestOaLocation W20173413631 @default.
• W2017341363 hasConcept C106487976 @default.
• W2017341363 hasConcept C1491633281 @default.
• W2017341363 hasConcept C185592680 @default.
• W2017341363 hasConcept C18903297 @default.
• W2017341363 hasConcept C189165786 @default.
• W2017341363 hasConcept C195687474 @default.
• W2017341363 hasConcept C2776193487 @default.
• W2017341363 hasConcept C2779965526 @default.
• W2017341363 hasConcept C43617362 @default.
• W2017341363 hasConcept C55493867 @default.
• W2017341363 hasConcept C85789140 @default.
• W2017341363 hasConcept C86803240 @default.
• W2017341363 hasConcept C95444343 @default.
• W2017341363 hasConceptScore W2017341363C106487976 @default.
• W2017341363 hasConceptScore W2017341363C1491633281 @default.
• W2017341363 hasConceptScore W2017341363C185592680 @default.
• W2017341363 hasConceptScore W2017341363C18903297 @default.
• W2017341363 hasConceptScore W2017341363C189165786 @default.
• W2017341363 hasConceptScore W2017341363C195687474 @default.
• W2017341363 hasConceptScore W2017341363C2776193487 @default.
• W2017341363 hasConceptScore W2017341363C2779965526 @default.
• W2017341363 hasConceptScore W2017341363C43617362 @default.
• W2017341363 hasConceptScore W2017341363C55493867 @default.

• next