FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017355903> ?p ?o ?g. }

• W2017355903 endingPage "19581" @default.
• W2017355903 startingPage "19575" @default.
• W2017355903 abstract "Transformation of baby hamster kidney fibroblasts by the Rous sarcoma virus causes a significant increase in the GlcNAcβ(1,6)Man-branched oligosaccharides by elevating the activity and mRNA transcript levels encodingN-acetylglucosaminyltransferase V (GlcNAc-T V). Elevated activity and mRNA levels could be inhibited by blocking cell proliferation with herbimycin A, demonstrating that Src kinase activity can regulate GlcNAc-T V expression. 5′ RACE analysis was used to identify a 3-kilobase 5′-untranslated region from GlcNAc-T V mRNA and locate a transcriptional start site in a 25-kilobase pair GlcNAc-T V human genomic clone. A 6-kilobase pair fragment of the 5′ region of the gene contained AP-1 and PEA3/Ets binding elements and, when co-transfected with a src expression plasmid into HepG2 cells, conferred src-stimulated transcriptional enhancement upon a luciferase reporter gene. This stimulation by srccould be antagonized by co-transfection with a dominant-negative mutant of the Raf kinase, suggesting the involvement of Ets transcription factors in the regulation of GlcNAc-T V gene expression. Thesrc-responsive element was localized by 5′ deletion analysis to a 250-base pair region containing two overlapping Ets sites. src stimulation of transcription from this region was inhibited by co-transfection with a dominant-negative mutant of Ets-2, demonstrating that the effects of the src kinase on GlcNAc-T V expression are dependent on Ets. Transformation of baby hamster kidney fibroblasts by the Rous sarcoma virus causes a significant increase in the GlcNAcβ(1,6)Man-branched oligosaccharides by elevating the activity and mRNA transcript levels encodingN-acetylglucosaminyltransferase V (GlcNAc-T V). Elevated activity and mRNA levels could be inhibited by blocking cell proliferation with herbimycin A, demonstrating that Src kinase activity can regulate GlcNAc-T V expression. 5′ RACE analysis was used to identify a 3-kilobase 5′-untranslated region from GlcNAc-T V mRNA and locate a transcriptional start site in a 25-kilobase pair GlcNAc-T V human genomic clone. A 6-kilobase pair fragment of the 5′ region of the gene contained AP-1 and PEA3/Ets binding elements and, when co-transfected with a src expression plasmid into HepG2 cells, conferred src-stimulated transcriptional enhancement upon a luciferase reporter gene. This stimulation by srccould be antagonized by co-transfection with a dominant-negative mutant of the Raf kinase, suggesting the involvement of Ets transcription factors in the regulation of GlcNAc-T V gene expression. Thesrc-responsive element was localized by 5′ deletion analysis to a 250-base pair region containing two overlapping Ets sites. src stimulation of transcription from this region was inhibited by co-transfection with a dominant-negative mutant of Ets-2, demonstrating that the effects of the src kinase on GlcNAc-T V expression are dependent on Ets. The glycosylation of cell surface glycoproteins is a dynamic process that can be regulated by agents that cause differentiation, such as retinoic acid (1Cho S.K. Yeh J. Cho M. Cummings R.D. J. Biol. Chem. 1996; 271: 3238-3246Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar) or transforming growth factor-β (2Miyoshi E. Nishikawa A. Ihara Y. Saito H. Uozumi N. Hayashi N. Fusamoto H. Kamada T. Taniguchi N. J. Biol. Chem. 1995; 270: 6216-6220Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), or by those that induce cellular proliferation, for example, interleukin-1 or tumor necrosis factor-α (3Hanasaki K. Varki A. Stamenkovic I. Bevilacqua M.P. J. Biol. Chem. 1994; 269: 10637-10643Abstract Full Text PDF PubMed Google Scholar). In many instances, alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell (4Finne J. Castori S. Feizi T. Burger M.M. Int. J. Cancer. 1989; 43: 300-304Crossref PubMed Scopus (14) Google Scholar, 5Kawano I. Takasaki S. Tao T.-W. Kobata A. Int. J. Cancer. 1993; 53: 91-96Crossref PubMed Scopus (63) Google Scholar). An induced alteration in the glycosylation of cell surface glycoproteins that has been documented for many years concerns the significant increase in oligosaccharide size caused by oncogenic transformation using a variety of agents (6Buck C.A. Glick M.C. Warren L. Biochemistry. 1971; 10: 2176-2180Crossref PubMed Scopus (89) Google Scholar, 7Dennis J.W. Laferte S. Waghorne C. Breitman M.L. Kerbel R.S. Science. 1987; 236: 582-585Crossref PubMed Scopus (860) Google Scholar, 8Buck C.A. Glick M.C. Warren L. Biochemistry. 1970; 9: 4567-4576Crossref PubMed Scopus (249) Google Scholar, 9Tuszynski G.P. Baker S.R. Fuhrer J.P. Buck C.A. Warren L. J. Biol. Chem. 1978; 253: 6092-6099Abstract Full Text PDF PubMed Google Scholar, 10Warren L. Fuhrer J.P. Buck C.A. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 1838-1842Crossref PubMed Scopus (234) Google Scholar, 11Warren L. Critchley D. Macpherson I. Nature. 1972; 235: 275-278Crossref PubMed Scopus (77) Google Scholar, 12Glick M.C. Biochemistry. 1979; 18: 2525-2532Crossref PubMed Scopus (40) Google Scholar, 13Glick M.C. Buck C.A. Biochemistry. 1973; 12: 85-90Crossref PubMed Scopus (49) Google Scholar, 14Meezan E. Wu H.C. Black P.H. Robbins P.W. Biochemistry. 1969; 8: 2518-2524Crossref PubMed Scopus (188) Google Scholar). This increase in size was found to result mainly from an increase in the levels of asparagine-linked oligosaccharides containing N-acetylglucosamine linked β1,6 to the α(1,6)-linked mannose in the trimannosyl core, (GlcNAcβ(1,6)Man), and in many cases these oligosaccharides express polylactosamine that can be sialylated (15Yamashita K. Ohkura T. Tachibana Y. Takasaki S. Kobata A. J. Biol. Chem. 1984; 259: 10834-10840Abstract Full Text PDF PubMed Google Scholar, 16Arango J. Pierce M. J. Cell. Biochem. 1988; 37: 225-231Crossref PubMed Scopus (62) Google Scholar, 17Santer U.V. DeSantis R. Hard K.J. van Kuik J.A. Vliegenthart J.F. Won B. Glick M.C. Eur. J. Biochem. 1989; 181: 249-260Crossref PubMed Scopus (54) Google Scholar, 18Yamamura K. Takasaki S. Ichihashi M. Mishima Y. Kobata A. J. Invest. Dermatol. 1991; 97: 735-741Abstract Full Text PDF PubMed Scopus (16) Google Scholar). The (GlcNAcβ(1,6)Man) branch is synthesized byN-acetylglucosaminyltransferase V (GlcNAc-T V), 1The abbreviations used are: GlcNAc-T V,N-acetylglucosaminyltransferase V; BHK, baby hamster kidney; RSV, Rous sarcoma virus; PEA, polyoma enhancer activator; GAPDH, glyceraldehyde phosphate dehydrogenase; RACE, rapid amplification of cDNA ends; GlcNAc-T I, N-acetylglucosaminyltransferase I; MES, 4-morpholineethanesulfonic acid; kb, kilobase pair(s); PCR, polymerase chain reaction; bp, base pair(s); UTR, untranslated region. the enzyme whose activity is significantly and selectively increased after transformation by tumor viruses or isolated oncogenes (16Arango J. Pierce M. J. Cell. Biochem. 1988; 37: 225-231Crossref PubMed Scopus (62) Google Scholar, 19Yamashita K. Tachibana Y. Ohkura T. Kobata A. J. Biol. Chem. 1985; 260: 3963-3969Abstract Full Text PDF PubMed Google Scholar, 20Yousefi S. Higgins E. Daoling Z. Pollex-Kruger A. Hindsgaul O. Dennis J.W. J. Biol. Chem. 1991; 266: 1772-1782Abstract Full Text PDF PubMed Google Scholar, 21Lu Y. Chaney W. Mol. Cell. Biochem. 1993; 122: 85-92Crossref PubMed Scopus (50) Google Scholar, 22Palcic M.M. Ripka J. Kaur K.J. Shoreibah M. Hindsgaul O. Pierce M. J. Biol. Chem. 1990; 265: 6759-6769Abstract Full Text PDF PubMed Google Scholar). Moreover, decreased expression of the GlcNAcβ(1,6)Man branch has been correlated with decreased metastatic potential (23Dennis J.W. Laferte S. Waghorne C. Breitman M.L. Kerbel R.S. Science. 1987; 236: 582-585Crossref PubMed Scopus (814) Google Scholar, 24Lu Y. Pelling J.C. Chaney W.G. Clin. Exp. Metastasis. 1994; 12: 47-54Crossref PubMed Scopus (38) Google Scholar), whereas the increased expression of this branch appears in some instances to correlate with the progression of invasive malignancies (25Fernandes B. Sagman U. Auger M. Demetriou M. Dennis J.W. Cancer Res. 1991; 51: 718-723PubMed Google Scholar). The transformation of baby hamster kidney (BHK) fibroblasts by thesrc oncogene causes an increase in N-linked oligosaccharide (GlcNAcβ(1,6)Man) branching, and the mechanism by which this increase occurs has been under investigation in our laboratories. To elucidate this mechanism, we examined GlcNAc-T V enzyme activity and mRNA levels in BHK cells and their Rous sarcoma virus-transformed counterparts (RSV-BHK) in the presence of the Src kinase inhibitor, herbimycin A. The results from these experiments led us to examine the 5′ region of the human gene encoding GlcNAc-T V and its increased expression caused by Src activity. Our results indicate that the N-acetylglucosaminyltransferase V gene can be transcriptionally activated by Src tyrosine kinase activity, and this control is dependent on both the Raf-1 kinase and an Ets family transcriptional activator. Cells were grown to confluency and harvested in 50 mm MES 6.5, 150 mm NaCl, and lysed by addition of Trition X-100 to 1%. Lysates were assayed according to the method of Palcic et al. (22Palcic M.M. Ripka J. Kaur K.J. Shoreibah M. Hindsgaul O. Pierce M. J. Biol. Chem. 1990; 265: 6759-6769Abstract Full Text PDF PubMed Google Scholar). Briefly, 106 cpm of UDP-[3H]GlcNAc (25 cpm/pmol) and 10 nmol of synthetic trisaccharide acceptor for GlcNAc-T V (octyl 6-O-[2-O-(2-acetamido-2-deoxy-β-d-glucosyl-pyranosyl)-α-d-mannopyranosyl]-β-d-glucopyraoside) were dried under vacuum in a 1.5-ml microcentrifuge tube. Extracts of various protein concentrations were prepared, and 10 μl were added to the assay tube. Assays were incubated at 37 °C for 4 h and quenched by the addition of 500 μl of water. Radiolabeled product was isolated on a C18 Sep-Pak (Waters) column, eluted in 2 ml of methanol, and counted in a scintillation counter. Assays were performed in duplicate or triplicate, at two or three protein concentrations, and specific activity was calculated by linear least squares regression analysis of the data. 20 μg of total RNA was electrophoresed on a 1% formaldehyde-agarose gel and blotted to nylon. A 1-kb fragment of a partial rat GlcNAc-T V cDNA clone was random prime-labeled (26Vogelstein B. Gillespie D. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 615-619Crossref PubMed Scopus (1071) Google Scholar), and the blot was probed according to the method of Church and Gilbert (27Church G.M. Gilbert W. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 1991-1995Crossref PubMed Scopus (7266) Google Scholar). Data were collected and quantitated with a PhosphorImager. Cells were harvested by the addition of 1 ml of preheated SDS-polyacrylamide gel electrophoresis sample buffer to a 10-cm plate and shearing through a 20 gauge needle. Protein concentrations were determined on trichloroacetic acid precipitates using the BCA reagents (Pierce). 20 μg of protein were electrophoresed on a 4–20% gradient acrylamide gel and transferred to nitrocellulose (Bio-Rad). Blots were probed with an anti-phosphotyrosine antibody (a kind gift from Dr. Bart Sefton) followed by a goat anti-mouse horseradish peroxidase conjugate. Bands were detected using the ECL reagents (Amersham Corp.) and quantitated by scanning densitometry. Marathon Race Ready cDNA from human whole brain (CLONTECH) was used as a template in a 5′ RACE PCR according to the manufacturer's instructions. A 3′ PCR primer (303, CCTGGACCTCAGCAAAAGGTACATCAAGGC) designed near the 5′ end of the published human cDNA sequence was used along with the 5′ anchor primer in a primary round of RACE PCR. Products were separated on a 1% Tris-acetic acid-EDTA-agarose gel and blotted to nitrocellulose. A nested PCR product was generated using the primers 501 (GAATGGAAGTGAGGGAAGGC) and 305 (GGAAGTTGTCCTCTCAGAAGCTGGGCTTT) and a genomic clone template. This product was random prime-labeled (26Vogelstein B. Gillespie D. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 615-619Crossref PubMed Scopus (1071) Google Scholar) and used to probe the membrane to which the RACE PCR product was transferred (see Fig. 6). To improve yields of authentic products, a secondary round of RACE PCR was then performed. A nested GlcNAc-T V 3′ primer (305) and nested 5′ anchor primer were used in the secondary round of RACE PCR using as templates the products from the primary RACE PCR. The products from this round of RACE PCR were directly subcloned into the TA cloning vector (Invitrogen), and clones were sequenced. The human GlcNAc-T V promoter sequences were isolated from a human genomic library cloned in the λ-FIX II vector (Stratagene, Inc.). A 687-bp EcoRI fragment containing the 5′-untranslated region of the rat cDNA (28Shoreibah M. Perng G.-S. Adler B. Weinstein J. Basu R. Cupples R. Wen D. Browne J.K. Buckhaults P. Fregien N. Pierce M. J. Biol. Chem. 1993; 268: 15381-15385Abstract Full Text PDF PubMed Google Scholar) was used as a probe to screen this library using standard plaque hybridization procedures. Screening 5 × 106 phage plaques yielded two overlapping genomic clones that span a region of approximately 30 kb. Sequencing of RACE PCR clones and human genomic clones was performed using the Applied Biosystems, Inc. reagents by the UGA Molecular Genetics Instrumentation Facility. For pGL2-TV1, a 6-kbXhoI-SacI fragment of the genomic clone was band-purified (Sephaglass, Pharmacia Biotech Inc.) and subcloned intoXhoI-SacI sites of the pGL2-Basic vector (Promega). For pGL2-TV2 through pGL2-TV4, PCR products were generated using the genomic clone as a template and subcloned into the TA vector. TA clones of the correct orientation were cut withXhoI-SacI, and inserts were cloned intoXhoI-SacI sites of pGL2-Basic. SV40-β-galactosidase (2 μg) and reporter constructs (2 μg) ± effector plasmids (2 μg) were transfected by the calcium-phosphate precipitation method (29Graham F.L. van der Eb A.J. Virology. 1973; 54: 536-539Crossref PubMed Scopus (419) Google Scholar) into 50% confluent cultures of HepG2 cells grown in 6-well culture plates. 40 h post-transfection, cell lysates were prepared and assayed for β-galactosidase and luciferase (Promega). Luciferase activity was normalized to vector-dependent β-galactosidase activity. The plasmids encoding the Raf-1 kinase and its dominant negative form (30Bruder J.T. Heidecker G. Rapp U.R. Genes & Dev. 1992; 6: 545-556Crossref PubMed Scopus (397) Google Scholar) were kind gifts from Dr. Ulf Rapp. Plasmids encoding Ets-2 and its dominant negative form (31Aperlo C. Pognonec P. Stanley R. Boulukos K.E. Mol. Cell. Biol. 1996; 16: 6851-6858Crossref PubMed Scopus (37) Google Scholar) were kinds gifts from Dr. K. E. Boulukos. The v-src expression plasmid was a kind gift from Dr. Tony Hunter. Earlier experiments utilizing BHK and RSV-BHK cells metabolically radiolabeled with [2-3H]mannose indicated at least a 2-fold increase in the total amount of (2,6)-substituted mannose in the RSV-BHK cells, normalized to total mannose-labeled glycopeptides. Although the specific activity of GlcNAc-T V was increased over 6-fold in the RSV-transformed cells, no significant differences in the kinetic properties of GlcNAc-T V in the transformed cells could be detected. These results suggested that the increases in GlcNAcβ(1,6)Man levels after transformation were most likely not due to post-translational effects on the enzyme (22Palcic M.M. Ripka J. Kaur K.J. Shoreibah M. Hindsgaul O. Pierce M. J. Biol. Chem. 1990; 265: 6759-6769Abstract Full Text PDF PubMed Google Scholar). The specific activity of GlcNAc-T V and its mRNA levels were measured, therefore, to determine if the increase in GlcNAc-T V activity in the transformed cells could result from differences in mRNA levels. GlcNAc-T V activity was assayed under optimal conditions in BHK and RSV-BHK cells using a synthetic trisaccharide acceptor. The transformed BHK cells demonstrated a GlcNAc-T V enzyme specific activity 6-fold higher than the untransformed BHK cells. By contrast, no difference was seen in the specific activity of another N-acetylglucosaminyltransferase that functions in the synthesis of N-linked oligosaccharides, GlcNAc-T I (Fig. 1), indicating the specificity of Rous sarcoma virus transformation on GlcNAc-T V activity. To investigate the possibility that the difference in GlcNAc-T V specific activity is associated with a difference in steady-state mRNA levels, Northern blots were performed using a fragment of a cDNA encoding GlcNAc-T V. Compared with BHK cells, RSV-transformed cells were found to have a 6-fold increase in the expression levels of both 8.7 and 9.3 kb GlcNAc-T V transcripts, but no change in either GAPDH or GlcNAc-T I transcripts (Fig.2). Although not apparent in Fig. 2, PhosphorImager quantitation demonstrated an equivalent increase in both GlcNAc-T V mRNA transcripts. These results demonstrated that the elevation of enzyme activity in the RSV-transformed cells was a result of either transcriptional activation or increased mRNA stability and argue against postranslational modifications of the enzyme causing a significant increase in its catalytic activity.Figure 2BHK and RSV-BHK cell GlcNAc-T V mRNA levels. Upper panel, Northern blot of total RNA from BHK (lane 1) and RSV-BHK cells (lane 2) probed with a 1-kb radiolabeled fragment from the open reading frame of murine GlcNAc-T V and visualized using a PhosphorImager. Lower panel, PhosphorImager quantitation of the band intensities from the analysis shown in the upper panel. The blot was stripped and hybridized with a rat GAPDH radiolabeled cDNA to demonstrate loading equivalence.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To obtain convincing evidence that the differences in GlcNAc-T V expression result from src tyrosine kinase activity, we made use of a src-selective tyrosine kinase inhibitor, herbimycin A, a metabolite produced by Streptomyces sp. MH237-CF8. This inhibitor was first identified for its ability to reverse the transformed morphology of Rous sarcoma virus-infected rat kidney cells (32Uehara Y. Hori M. Takeuchi T. Umezawa H. Jpn. J. Cancer Res. 1985; 76: 672-675PubMed Google Scholar), and this reversion of morphology was associated with a reduction in total cellular phosphotyrosine levels (33Uehara Y. Murakami Y. Sugimoto Y. Mizuno S. Cancer Res. 1989; 49: 780-785PubMed Google Scholar). Herbimycin A was unable, however, to reverse the transformed morphologies induced by theras, raf, or myc oncogenes, demonstrating its specificity for the src family of tyrosine kinase oncogenes (34Uehara Y. Murakami Y. Mizuno S. Kawai S. Virology. 1988; 164: 294-298Crossref PubMed Scopus (166) Google Scholar). Herbimycin A is also able to reversesrc-stimulated expression of the glucose transporter gene (35Murakami Y. Mizuno S. Hori M. Uehara Y. Cancer Res. 1988; 48: 1587-1590PubMed Google Scholar) and to cause a reversible Go contact arrest insrc-transformed normal rat kidney cells (36Suzukake-Tsuchiya K. Moriya Y. Hori M. Uehara Y. Takeuchi T. J. Antibiot. ( Tokyo ). 1989; 42: 1831-1837Crossref PubMed Scopus (14) Google Scholar). We utilized herbimycin A, therefore, to test the hypothesis that the expression of GlcNAc-T V is positively regulated by the src tyrosine kinase. First, to monitor the effects of src kinase and demonstrate its inhibition by herbimycin A, we measured total cellular phosphotyrosine levels by performing Western blots with an α-phosphotyrosine antibody on extracts made from cells treated for 24 h with various concentrations of the drug. These results demonstrate that, as expected, herbimycin A caused a dose-dependent decrease in cellular phosphotyrosine levels (Fig. 3). At a concentration of 1 μg/ml, herbimycin A caused a reversal of the RSV-transformed morphology and a complete inhibition of cell division (data not shown). Consistent with the drug's effect of inhibiting the src kinase (33Uehara Y. Murakami Y. Sugimoto Y. Mizuno S. Cancer Res. 1989; 49: 780-785PubMed Google Scholar) and blocking cell division in Go (36Suzukake-Tsuchiya K. Moriya Y. Hori M. Uehara Y. Takeuchi T. J. Antibiot. ( Tokyo ). 1989; 42: 1831-1837Crossref PubMed Scopus (14) Google Scholar), herbimycin A caused a dose-dependent decrease in GlcNAc-T V enzyme specific activity in RSV-transformed BHK cells (Fig. 4). Interestingly, although the drug blocked cell division and caused a modest decrease in phosphotyrosine levels in the untransformed BHK cells (data not shown), it had little effect on the expression level of GlcNAc-T V enzyme activity in confluent cultures of untransformed cells (Fig. 4). This result suggests that regulation of GlcNAc-T V expression is complex, with both src-dependent andsrc-independent factors. Herbimycin A had no effect on the specific activity of GlcNAc-T I (data not shown), arguing against nonspecific toxic effects on the transformed cells and confirming that GlcNAc-T I is not regulated by src. To determine if the inhibition of expression of GlcNAc-T V enzyme activity by herbimycin A was a result of inhibiting the expression of the mRNA encoding the enzyme, Northern blots were performed on RNA samples prepared from RSV-transformed cells treated with various concentrations of the drug. Similar to its effects on GlcNAc-T V enzyme specific activity, herbimycin A caused a decrease in GlcNAc-T V message levels in the RSV-BHK cells in a dose-dependent manner (Fig.5). Taken together, these results indicate that expression of the GlcNAc-T V mRNA in the src-transformed cells is under the control of the src tyrosine kinase.Figure 4BHK and RSV-BHK GlcNAc-T V specific activities after treatment with herbimycin A. GlcNAc-T V enzyme specific activity was measured in cell lysates that had been incubated for 24 h with various concentrations of herbimycin A.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 5BHK and RSV GlcNAc-T V mRNA levels after treatment with herbimycin A. Total RNA was extracted from cells treated for 24 h with herbimycin A and subjected to Northern blot analysis, and the results were quantitated using a PhosphorImager. The level of GlcNAc-T V mRNA in untreated cells was set at 100%.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To elucidate the mechanism by which src induces the expression of GlcNAc-T V, we isolated the 5′-flanking region of the gene and analyzed this region for promoter activity. The GlcNAc-T V message is approximately 9 kb in most rodent and human tissues, with brain having high expression levels. To locate a promoter for GlcNAc-T V, 5′ RACE PCR techniques were used to isolate and sequence the 5′ end of the message from human brain. RACE PCR products were first generated from the genomic clone using the 303 primer (designed against the 5′ end of the human GlcNAc-T V cDNA sequence) and then analyzed by Southern blotting. GlcNAc-T V-specific sequences were detected using a nested 501–305 PCR product as the hybridization probe. Multiple bands were detected, the longest of which was 2.9 kb (Fig. 6). PCR products were ligated into the TA cloning vector, and clones corresponding to the 600- and 1200-bp products were obtained and found to overlap and differ only in the length of their 5′ ends. To isolate a product that encompassed all of the 5′-untranslated region of the GlcNAc-T V message, a second round of RACE PCR was then performed using two nested primers designed near the 5′ end of the 0.6 kb clone, and the resulting products were subcloned and sequenced. Clones corresponding to the 1.8- and 2.9-kb bands were isolated from this second round of RACE PCR and sequenced. As before, these clones were found to differ only in the length of their 5′ ends. A third round of RACE PCR using a 3′ primer designed to the sequence near the 5′ end of the 2.9-kb clone produced a single product of the expected size (70 bp). The assembled sequence of the RACE clones was co-linear with the sequence of the genomic clone in this region, indicating that no splicing events occurred in the 5′-UTR of the message from human brain. These results demonstrate, therefore, that the location of the 5′-most transcriptional start site utilized in brain is located approximately 2.9 kb upstream of the ATG, corresponding to the band of this size shown in Fig. 6. To examine the 5′ region flanking the 5′-most transcriptional start site, a 6-kb SacI-XhoI genomic fragment containing 848 bp of the brain 5′-UTR and 5.5 kb of 5′-flanking sequence (depicted in Fig. 7), designated pGL2-TV1, was cloned into the luciferase expression vector pGL2-basic. The activity of this region as a promoter and its responsiveness to srcwere then examined in transiently transfected HepG2 cells. pGL2-TV1 was found to act as a weak promoter, shown in Fig. 8, consistent with the low levels of GlcNAc-T V transcript observed in HepG2 cells and most tissues. Moreover, this DNA fragment conferred transcriptional responsiveness to src when co-transfected with a src-containing expression plasmid (Fig. 8). The similarity between the increases in GlcNAc-T V expression in the RSV-transformed cells and src stimulation of transcription from the GlcNAc-T V promoter in HepG2 cells suggests that transcriptional control is likely the most important regulatory influence of src on GlcNAc-T V activity.Figure 8The TV1 fragment promoter activity is responsive to src and is dependent on raf.The TV1 fragment depicted in Fig. 7, representing a 6240-bpSacI-XhoI fragment of the 5′-flanking region, was cloned into the pGL2-Basic luciferase reporter vector and used to transfect Hep G-2 cells in the presence and the absence of a co-transfected src-expression plasmid. A dominant negativeraf-1 expression plasmid, Raf C4B, was also utilized in some transfections, as well as an expression plasmid containing an inactive point mutant of the same, Raf C4B pm17.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Transformation and some transcriptional activation by srcoccurs via the MAPK pathway in a Raf-1-dependent manner. For example, a dominant-negative Raf-1 mutant suppresses srctransformation of BALB/c mouse fibroblasts (37Qureshi S.A. Joseph C.K. Hendrickson M. Song J. Gupta R. Bruder J. Rapp U. Foster D.A. Biochem. Biophys. Res. Commun. 1993; 192: 969-975Crossref PubMed Scopus (18) Google Scholar) and is able to blocksrc-stimulated transcriptional activation of the EGR gene (38Qureshi S.A. Rim M. Bruder J. Kolch W. Rapp U. Sukhatme V.P. Foster D.A. J. Biol. Chem. 1991; 266: 20594-20597Abstract Full Text PDF PubMed Google Scholar). Furthermore, this mutant is able to block serum or Ras stimulation of the transcription of an AP-1/Ets-driven gene (30Bruder J.T. Heidecker G. Rapp U.R. Genes & Dev. 1992; 6: 545-556Crossref PubMed Scopus (397) Google Scholar). If transcriptional activation of GlcNAc-T V by src occurs at least in part via the MAPK pathway, we reasoned that the activation should be inhibited by the dominant-negative Raf-1 mutant. Consistent with this hypothesis, the transcriptional stimulation of the GlcNAc-T V promoter by src was significantly inhibited when co-transfected with a plasmid encoding a dominant-negative mutant Raf, RafC4B-DN (Fig. 8). Because proliferation often occurs in a Raf-dependent manner, this result is consistent with correlations noted between GlcNAc-T V expression and cellular proliferation in nontransformed cells (39Perng G.S. Shoreibah M. Margitich I. Pierce M. Fregien N. Glycobiology. 1995; 4: 867-871Crossref Scopus (29) Google Scholar, 40Hahn T.J. Goochee C.F. J. Biol. Chem. 1992; 267: 23982-23987Abstract Full Text PDF PubMed Google Scholar) and may predict in certain cell types a general association between GlcNAc-T V enzyme activity and cell proliferation. To map more closely the region of the GlcNAc-T V promoter responsible for transcriptional activation by src, a series of 5′ deletions containing 70 bp of the brain 5′-UTR and different amounts of the 5′-flanking region were constructed by PCR amplification from the genomic clone, the boundaries of which are depicted in Fig. 7. Promoter fragments were cloned into the pGL2-basic vector and tested for basal promoter activity and src responsiveness. Based on the results from several sets of experiments, both pGL2-TV2, which contained about 1.2 kb, and pGL2-TV3, which contained 739 bp, were both found to be weakly active as promoters and transcriptionally responsive to src (Fig. 9). The pGL2-TV4 construct containing 339 bp, however, was found to be inactive as a basic promoter and completely unresponsive to src. These results suggest a requirement for the two overlapping PEA-3 sites located near the transcriptional start site, contained in pGL2-TV3, in thesrc-mediated transcriptional activation of the GlcNAc-T V gene (Figs. 7 and 10).Figure 10Nucleotide sequence of the GlcNAc-T V genomic fragment TV3. This sequence corresponds to the shortest fragment tested that conferred src responsiveness to a GlcNAc-T V promoter-driven luciferase gene. The fragment was generated as described under “Experimental Procedures” and included 70 bp 3′ of the transcriptional start site. PEA-3 (Ets-2 binding sites) and AP-1 binding sites are denoted by solid underlining anddotted underlining, respectively. Th" @default.
• W2017355903 created "2016-06-24" @default.
• W2017355903 creator A5013040974 @default.
• W2017355903 creator A5017168325 @default.
• W2017355903 creator A5056336499 @default.
• W2017355903 creator A5087911344 @default.
• W2017355903 date "1997-08-01" @default.
• W2017355903 modified "2023-10-16" @default.
• W2017355903 title "Transcriptional Regulation ofN-Acetylglucosaminyltransferase V by the srcOncogene" @default.
• W2017355903 cites W1489195678 @default.
• W2017355903 cites W1492116802 @default.
• W2017355903 cites W1515230561 @default.
• W2017355903 cites W1526965277 @default.
• W2017355903 cites W1542297760 @default.
• W2017355903 cites W1562659374 @default.
• W2017355903 cites W1582944414 @default.
• W2017355903 cites W1584978389 @default.
• W2017355903 cites W1590543652 @default.
• W2017355903 cites W1596938063 @default.
• W2017355903 cites W1777997745 @default.
• W2017355903 cites W1963869566 @default.
• W2017355903 cites W1967074148 @default.
• W2017355903 cites W1971455353 @default.
• W2017355903 cites W1972020763 @default.
• W2017355903 cites W1972870035 @default.
• W2017355903 cites W1978920088 @default.
• W2017355903 cites W1979197786 @default.
• W2017355903 cites W1997416845 @default.
• W2017355903 cites W1997618958 @default.
• W2017355903 cites W2000748313 @default.
• W2017355903 cites W2001731569 @default.
• W2017355903 cites W2002215368 @default.
• W2017355903 cites W2002250987 @default.
• W2017355903 cites W2003879802 @default.
• W2017355903 cites W2003969944 @default.
• W2017355903 cites W2007695634 @default.
• W2017355903 cites W2024657139 @default.
• W2017355903 cites W2025226446 @default.
• W2017355903 cites W2035256873 @default.
• W2017355903 cites W2047022817 @default.
• W2017355903 cites W2061186971 @default.
• W2017355903 cites W2061327866 @default.
• W2017355903 cites W2067110717 @default.
• W2017355903 cites W2068571186 @default.
• W2017355903 cites W2071526750 @default.
• W2017355903 cites W2075907686 @default.
• W2017355903 cites W2076998193 @default.
• W2017355903 cites W2084017946 @default.
• W2017355903 cites W2105164402 @default.
• W2017355903 cites W2114992270 @default.
• W2017355903 cites W2129425746 @default.
• W2017355903 cites W2132106567 @default.
• W2017355903 cites W2171569176 @default.
• W2017355903 cites W2576734941 @default.
• W2017355903 doi "https://doi.org/10.1074/jbc.272.31.19575" @default.
• W2017355903 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9235963" @default.
• W2017355903 hasPublicationYear "1997" @default.
• W2017355903 type Work @default.
• W2017355903 sameAs 2017355903 @default.
• W2017355903 citedByCount "132" @default.
• W2017355903 countsByYear W20173559032012 @default.
• W2017355903 countsByYear W20173559032013 @default.
• W2017355903 countsByYear W20173559032014 @default.
• W2017355903 countsByYear W20173559032015 @default.
• W2017355903 countsByYear W20173559032016 @default.
• W2017355903 countsByYear W20173559032017 @default.
• W2017355903 countsByYear W20173559032018 @default.
• W2017355903 countsByYear W20173559032019 @default.
• W2017355903 countsByYear W20173559032020 @default.
• W2017355903 countsByYear W20173559032021 @default.
• W2017355903 countsByYear W20173559032022 @default.
• W2017355903 countsByYear W20173559032023 @default.
• W2017355903 crossrefType "journal-article" @default.
• W2017355903 hasAuthorship W2017355903A5013040974 @default.
• W2017355903 hasAuthorship W2017355903A5017168325 @default.
• W2017355903 hasAuthorship W2017355903A5056336499 @default.
• W2017355903 hasAuthorship W2017355903A5087911344 @default.
• W2017355903 hasBestOaLocation W20173559031 @default.
• W2017355903 hasConcept C104317684 @default.
• W2017355903 hasConcept C185592680 @default.
• W2017355903 hasConcept C27153228 @default.
• W2017355903 hasConcept C54355233 @default.
• W2017355903 hasConcept C86339819 @default.
• W2017355903 hasConcept C86803240 @default.
• W2017355903 hasConcept C95444343 @default.
• W2017355903 hasConceptScore W2017355903C104317684 @default.
• W2017355903 hasConceptScore W2017355903C185592680 @default.
• W2017355903 hasConceptScore W2017355903C27153228 @default.
• W2017355903 hasConceptScore W2017355903C54355233 @default.
• W2017355903 hasConceptScore W2017355903C86339819 @default.
• W2017355903 hasConceptScore W2017355903C86803240 @default.
• W2017355903 hasConceptScore W2017355903C95444343 @default.
• W2017355903 hasIssue "31" @default.
• W2017355903 hasLocation W20173559031 @default.
• W2017355903 hasOpenAccess W2017355903 @default.
• W2017355903 hasPrimaryLocation W20173559031 @default.
• W2017355903 hasRelatedWork W1580844082 @default.
• W2017355903 hasRelatedWork W1991523530 @default.

• next