FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017446909> ?p ?o ?g. }

• W2017446909 endingPage "10567" @default.
• W2017446909 startingPage "10559" @default.
• W2017446909 abstract "During chlorophyll and bacteriochlorophyll biosynthesis in gymnosperms, algae, and photosynthetic bacteria, dark-operative protochlorophyllide oxidoreductase (DPOR) reduces ring D of aromatic protochlorophyllide stereospecifically to produce chlorophyllide. We describe the heterologous overproduction of DPOR subunits BchN, BchB, and BchL from Chlorobium tepidum in Escherichia coli allowing their purification to apparent homogeneity. The catalytic activity was found to be 3.15 nmol min-1 mg-1 with Km values of 6.1 μm for protochlorophyllide, 13.5 μm for ATP, and 52.7 μm for the reductant dithionite. To identify residues important in DPOR function, 21 enzyme variants were generated by site-directed mutagenesis and investigated for their metal content, spectroscopic features, and catalytic activity. Two cysteine residues (Cys97 and Cys131) of homodimeric BchL2 are found to coordinate an intersubunit [4Fe-4S] cluster, essential for low potential electron transfer to (BchNB)2 as part of the reduction of the protochlorophyllide substrate. Similarly, Lys10 and Leu126 are crucial to ATP-driven electron transfer from BchL2. The activation energy of DPOR electron transfer is 22.2 kJ mol-1 indicating a requirement for 4 ATP per catalytic cycle. At the amino acid level, BchL is 33% identical to the nitrogenase subunit NifH allowing a first tentative structural model to be proposed. In (BchNB)2, we find that four cysteine residues, three from BchN (Cys21, Cys46, and Cys103) and one from BchB (Cys94), coordinate a second inter-subunit [4Fe-4S] cluster required for catalysis. No evidence for any type of molybdenum-containing cofactor was found, indicating that the DPOR subunit BchN clearly differs from the homologous nitrogenase subunit NifD. Based on the available data we propose an enzymatic mechanism of DPOR. During chlorophyll and bacteriochlorophyll biosynthesis in gymnosperms, algae, and photosynthetic bacteria, dark-operative protochlorophyllide oxidoreductase (DPOR) reduces ring D of aromatic protochlorophyllide stereospecifically to produce chlorophyllide. We describe the heterologous overproduction of DPOR subunits BchN, BchB, and BchL from Chlorobium tepidum in Escherichia coli allowing their purification to apparent homogeneity. The catalytic activity was found to be 3.15 nmol min-1 mg-1 with Km values of 6.1 μm for protochlorophyllide, 13.5 μm for ATP, and 52.7 μm for the reductant dithionite. To identify residues important in DPOR function, 21 enzyme variants were generated by site-directed mutagenesis and investigated for their metal content, spectroscopic features, and catalytic activity. Two cysteine residues (Cys97 and Cys131) of homodimeric BchL2 are found to coordinate an intersubunit [4Fe-4S] cluster, essential for low potential electron transfer to (BchNB)2 as part of the reduction of the protochlorophyllide substrate. Similarly, Lys10 and Leu126 are crucial to ATP-driven electron transfer from BchL2. The activation energy of DPOR electron transfer is 22.2 kJ mol-1 indicating a requirement for 4 ATP per catalytic cycle. At the amino acid level, BchL is 33% identical to the nitrogenase subunit NifH allowing a first tentative structural model to be proposed. In (BchNB)2, we find that four cysteine residues, three from BchN (Cys21, Cys46, and Cys103) and one from BchB (Cys94), coordinate a second inter-subunit [4Fe-4S] cluster required for catalysis. No evidence for any type of molybdenum-containing cofactor was found, indicating that the DPOR subunit BchN clearly differs from the homologous nitrogenase subunit NifD. Based on the available data we propose an enzymatic mechanism of DPOR. Protochlorophyllide (Pchlide) 2The abbreviations used are: Pchlide, protochlorophyllide; bChl, bacteriochlorophyll; Chl, chlorophyll; Chlide, chlorophyllide; GST, glutathione S-transferase; ICP-MS, inductively coupled plasma mass spectrometry; HPLC, high pressure liquid chromatography; LPOR, light-dependent protochlorophyllide oxididoreductase; DPOR, dark-operative protochlorophyllide oxidoreductase. 2The abbreviations used are: Pchlide, protochlorophyllide; bChl, bacteriochlorophyll; Chl, chlorophyll; Chlide, chlorophyllide; GST, glutathione S-transferase; ICP-MS, inductively coupled plasma mass spectrometry; HPLC, high pressure liquid chromatography; LPOR, light-dependent protochlorophyllide oxididoreductase; DPOR, dark-operative protochlorophyllide oxidoreductase. is a central metabolite for the biosynthesis of chlorophylls (Chl) and bacteriochlorophylls (bChl). In photosynthetic organisms two distinct enzymes catalyze the stereospecific reduction of ring D of the aromatic Pchlide to form chlorophyllide (Chlide) (1Fujita Y. Plant Cell Physiol. 1996; 37: 411-421Crossref PubMed Scopus (116) Google Scholar, 2Schoefs B. Photosynth. Res. 2001; 70: 257-271Crossref PubMed Scopus (53) Google Scholar, 3Apel, K. (2001) in Regulation of Photosynthesis (Aro, E.-M., and Anderson, B., eds) pp. 235-252, Kluwer Akademic Publishers, DordrechtGoogle Scholar) (Fig. 1). The first enzyme is the light-dependent Pchlide oxidoreductase (LPOR; NADPH Pchlide oxidoreductase, EC 1.3.1.33). To achieve the chemically difficult reduction of the aromatic ring system, the complex of monomeric LPOR and substrate Pchlide must absorb light energy prior to NADPH-dependent reduction (4Belyaeva O.B. Griffiths W.T. Kovalev J.V. Timofeev K.N. Litvin F.F. Biochemistry (Mosc.). 2001; 66: 173-177Crossref PubMed Scopus (15) Google Scholar, 5Heyes D.J. Hunter C.N. van Stokkum I.H. van Grondelle R. Groot M.L. Nat. Struct. Biol. 2003; 10: 491-492Crossref PubMed Scopus (68) Google Scholar, 6Heyes D.J. Ruban A.V. Wilks H.M. Hunter C.N. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11145-11150Crossref PubMed Scopus (81) Google Scholar) making LPOR a dominant player in the light-dependent greening of flowering plants (angiosperms) (7Rüdiger, W. (2003) in Porphyrin Handbook, Chlorophylls and Bilins: Biosynthesis, Synthesis, and Degradation (Kadish, K. M., Smith, K. M., and Guilard, R., eds) Vol. 13, pp. 71-108, Academic Press, New YorkGoogle Scholar, 8Masuda T. Takamiya K. Photosynth. Res. 2004; 81: 1-29Crossref PubMed Scopus (131) Google Scholar). The second Pchlide-reducing enzyme is the light-independent (dark) Pchlide oxidoreductase (DPOR), which shares no amino acid sequence homology to the LPOR system. It consumes ATP to drive the production of Chlide. Some anoxygenic bacteria only encode DPOR (9Xiong J. Inoue K. Bauer C.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14851-14856Crossref PubMed Scopus (142) Google Scholar), whereas angiosperms exclusively produce LPOR. Cyanobacteria, algae, and gymnosperms possess both LPOR and DPOR (1Fujita Y. Plant Cell Physiol. 1996; 37: 411-421Crossref PubMed Scopus (116) Google Scholar). DPOR enables these organisms to synthesize bChl or Chl in the dark. In bChl-synthesizing organisms the genes bchN, bchB, and bchL encode the three subunits of DPOR. In Chl-synthesizing organisms the corresponding genes are known as chlN, chlB, and chlL (10Suzuki J.Y. Bollivar D.W. Bauer C.E. Annu. Rev. Genet. 1997; 31: 61-89Crossref PubMed Scopus (138) Google Scholar, 11Bollivar D.W. Suzuki J.Y. Beatty J.T. Dobrowolski J.M. Bauer C.E. J. Mol. Biol. 1994; 237: 622-640Crossref PubMed Scopus (161) Google Scholar, 12Burke D.H. Alberti M. Hearst J.E. J. Bacteriol. 1993; 175: 2414-2422Crossref PubMed Google Scholar). Protein subunits of DPOR share significant amino acid sequence similarity with NifD, NifK, and NifH, the three subunits of nitrogenase. Among the subunits of DPOR, BchL is most similar to its counterpart NifH sharing 33% amino acid sequence identity (13Burke D.H. Hearst J.E. Sidow A. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 7134-7138Crossref PubMed Scopus (125) Google Scholar). The remaining two DPOR subunits BchN and BchB are similarly related to NifD and NifK, although sequence identities at ∼15% (for both comparisons) are not as pronounced (14Fujita Y. Matsumoto H. Takahashi Y. Matsubara H. Plant Cell Physiol. 1993; 34: 305-314PubMed Google Scholar). The well characterized nitrogenase protein complex consists of homodimeric Fe-dinitrogenase reductase (Fe-protein, NifH2) and tetrameric MoFe-protein complex ((NifD/NifK)2) responsible for the reduction of dinitrogen to ammonia (15Rees D.C. Akif Tezcan F. Haynes C.A. Walton M.Y. Andrade S. Einsle O. Howard J.B. Philos. Transact. A Math. Phys. Eng. Sci. 2005; 363 (1035-1040): 971-984Crossref PubMed Scopus (238) Google Scholar, 16Peters J.W. Fisher K. Dean D.R. Annu. Rev. Microbiol. 1995; 49: 335-366Crossref PubMed Scopus (138) Google Scholar, 17Dean D.R. Bolin J.T. Zheng L. J. Bacteriol. 1993; 175: 6737-6744Crossref PubMed Google Scholar). NifH2 binds an intersubunit [4Fe-4S] redox cluster symmetrically coordinated by two cysteine residues (Cys97 and Cys132, Azotobacter vinelandii numbering) from each NifH subunit. This redox center is required for the ATP-driven transfer of electrons from ferredoxin to (NifD/NifK)2. These two cysteines are perfectly conserved in all BchL/ChlL protein sequences (10Suzuki J.Y. Bollivar D.W. Bauer C.E. Annu. Rev. Genet. 1997; 31: 61-89Crossref PubMed Scopus (138) Google Scholar). The tetrameric (NifD/NifK)2 MoFe complex bears two types of metallocenters, an [8Fe-7S] cluster (P-cluster) located at the interface of the NifD and NifK subunits and a [1Mo-7Fe-9S-1homocitrate] or MoFe cofactor located within each NifD subunit (Fig. 2). The P-cluster is thought to mediate electron transfer from NifH2 to the MoFe cofactor, where final dinitrogen reduction takes place (18Igarashi R.Y. Seefeldt L.C. Crit. Rev. Biochem. Mol. Biol. 2003; 38: 351-384Crossref PubMed Scopus (201) Google Scholar). BchN and BchB together contain only four highly conserved cysteines, compared with six cysteines coordinating the [8Fe-7S] P-cluster in NifD/NifK. Three are found in BchN (Cys21, Cys46, Cys103, C. tepidum numbering) and one in BchB (Cys94). A bridging Fe-S center, although presumably smaller than the P-cluster, may thus be located at the interface of BchN and BchB. Residues involved in MoFe cofactor binding in NifD are not conserved in BchN implying that this part of dinitrogen reduction does not have a counterpart in reduction of Pchlide. Several protein complexes of dinitrogenase reductase and the MoFe-protein have been trapped using (AlF4−) or (BeF3−) together with Mg-ADP, or by deleting Leu127 in the ATP-binding motif of NifH (19Lanzilotta W.N. Fisher K. Seefeldt L.C. J. Biol. Chem. 1997; 272: 4157-4165Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). The [4Fe-4S] cluster of NifH2 has, moreover, been shown to be a better reductant when in complex with the MoFe-protein, than in its uncomplexed form (20Ryle M.J. Lanzilotta W.N. Seefeldt L.C. Biochemistry. 1996; 35: 9424-9434Crossref PubMed Scopus (36) Google Scholar). These findings indicate that the BchL subunits of DPOR may similarly catalyze an ATP-driven transfer of electrons from a bound [Fe-S] cluster to catalytic protein complex BchNB containing a second Fe-S redox center. Interestingly ATP-dependent electron transfer is not restricted to nitrogenase. Instead, Fe-dinitrogenase reductase-like subunits also occur in enzymes such as 2-hydroxyacyl-CoA dehydratase, referred to as “archerases” due to their ability to “activate single electrons” by an ATP-induced change in the redox potential of a [4Fe-4S] center (21Kim J. Hetzel M. Boiangiu C.D. Buckel W. FEMS Microbiol. Rev. 2004; 28: 455-468Crossref PubMed Scopus (70) Google Scholar). DPOR from Rhodobacter capsulatus, studied using a homologous expression system, consists of BchL and a BchNB complex. Its enzymatic activity requires both ATP and a reducing agent such as dithionite (22Nomata J. Swem L.R. Bauer C.E. Fujita Y. Biochim. Biophys. Acta. 2005; 1708: 229-237Crossref PubMed Scopus (46) Google Scholar, 23Fujita Y. Bauer C.E. J. Biol. Chem. 2000; 275: 23583-23588Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar), whereas ferredoxin is its physiological electron donor (22Nomata J. Swem L.R. Bauer C.E. Fujita Y. Biochim. Biophys. Acta. 2005; 1708: 229-237Crossref PubMed Scopus (46) Google Scholar). Because R. capsulatus DPOR activity declines rapidly after affinity purification, crude cellular extracts were used in these experiments (22Nomata J. Swem L.R. Bauer C.E. Fujita Y. Biochim. Biophys. Acta. 2005; 1708: 229-237Crossref PubMed Scopus (46) Google Scholar). We have established the first heterologous milligram range production and purification system for Chlorobium tepidum DPOR in Escherichia coli, allowing the kinetic, spectroscopic, and structural characterization of recombinant wild-type and mutant BchNB and BchL including two [4Fe-4S] clusters and their coordinating cysteine residues. Production and Purification of C. tepidum DPOR in E. coli—The complete bchNBL-operon from C. tepidum (strain ATCC 49652) was PCR-amplified using primers CAGGATCCATGATGCCGGTTTCAAG and CAATGCGGCCGCTTACTGCCAGCCACC and cloned into BamHI and NotI sites of pGEX-6P-1 to yield pGEX-bchNBL. The bchL gene was analogously amplified using primers CAGGATCCATGAGTTTAGTATTGGCC and CAATGCGGCCGCTTACTGCCAGCCACC and cloned into BamHI and NotI sites of pGEX-6P-1 to generate pGEX-bchL. The plasmids were transformed into E. coli BL21(DE3) Codon Plus RIL to produce the BchNBL complex or only BchL. Cells were cultivated at 17 °C in 500 ml of LB medium with 1 mm Fe(III)-citrate. Protein production was induced by 50 μm isopropyl-β-thiogalactoside at 0.6 OD578. After 16 h of cultivation 1.7 mm dithionite was added and cultivation was continued without agitation for 2 h at 18 °C in an anaerobic chamber (Coy Laboratories, Grass Lake, MI) to allow [Fe-S] cluster formation. All remaining steps were performed under anaerobic conditions at oxygen partial pressure below 1 ppm (Oxygen detector, Coy Laboratories, Grass Lake, MI). Solutions were N2-saturated prior use. Cells were centrifuged, resuspended in 15 ml of lysis buffer (100 mm HEPES-NaOH (pH 7.5), 10 mm MgCl2, 1 m glycerol, 10 mm dithiothreitol), and disrupted by a single passage through a French press at 1500 p.s.i. into an anaerobic bottle. Following 60 min of centrifugation at 175,000 × g at 4 °C, the supernatant was added to 500 μl of glutathione-Sepharose (GE Healthcare) equilibrated with lysis buffer. After washing with 20 ml of phosphate-buffered saline containing 10 mm dithiothreitol (wash buffer) the recombinant fusion protein GST-BchN in complex with BchB or GST-BchL alone were eluted using 2 ml of 50 mm Tris-HCl (pH 8.0) containing 10 mm reduced glutathione. Fractions containing the BchNB complex or GST-BchL were identified by SDS-PAGE. Purification of the Ternary BchNBL Complex—To obtain a stable ternary DPOR complex, all steps of the affinity purifications were carried out in the presence of 2 or 10 mm (BeF3−), or 100 or 200 μm (AlF4−) and 5 mm Mg-ADP. Cell-free extracts were incubated with metallofluorides and Mg-ADP 30 min prior to affinity chromatography. Site-directed Mutagenesis of DPOR Genes and Ribosomal Binding Sites—Up to four nucleotides of the plasmid pGEX-bchNBL were exchanged using the QuikChange™ site-directed mutagenesis kit (Stratagene). Oligonucleotides to incrementally optimize the ribosomal binding site of bchB (exchanged nucleotides underlined) were: GACGAAAAGCAAAGAGCAATCATGCGTTTAGC; GACGAAAAGGAAACAGTATTCATGCGTTTAGC. Mutations to optimize the ribosomal binding site of bchL were: CGATAAACCAATTGACGTCAATGATTCCATGAGTTTAG; CGATAAACCAATTGACGACACTGTTTTCATGAGTTTAG; and CGATAAACCAATTGAGGAAACAGTATTCATGAGTTTAG. This expression construct was termed pGEX-bchNBL*. Point substitutions in BchN were introduced using the oligonucleotides: C8S, GTTCAAGCGATAGCCAGATTCTCAAAG; C21S, CCACAGCTTCAGCGGCCTGGCCTG; C25S, CGGCCTGGCCAGTGTCGGCTGGC; C46S, GGTACCCACACCAGCGCGCACTTTCTCC; C103S, CCTGCTTTCTTCCAGTACCCCCGAAGTC; C153S, GTGCCCTTCAGCCCCGAAGCTCC; C220S, CTGTCGCGCGTCAGCTCGCGCCTG; and C309S, GGAGGTTGTCGAGAGCAGCAGCGCC. Oligonucleotides for the exchange of codons in bchB were: C94S, GTAGCCCCGAGTAGCAGCACGGCGC; C94A, CCCGAGTGCCAGCACGGC; C217S, CGTGAGATCGGTAGCCAAGCTGCCGG; C373S, GGAGCTGGTCAGCGGCACCCAG; C382S, CGGCACAGCAGCCGCAAGCTCG; and C389A, ACGTGCCCGCCATGGTCATTTC. Oligonucleotides for the exchange of codons in bchL were: C38S, GCTCCAGATCGGTAGCGACCCGAAGC; C97S, GGAAGCGGCAGCGGCGGCTAC; C131S, CGACGTGGTGAGCGGCGGCTTC; C162S, CCAACCGCCTCTCCATGGCCATTCAGC; C239S, GCTGGCAGAGAGCCTCGCGCC; K10A, GCCGTTTACGGAGCAGGCGGGATC; and ΔL126, TTCTTTTTGATGTGGGCGACGTGGTG. Protein Concentrations—Concentrations of GST fusion proteins in crude cellular extracts were determined using the GST-detection module (GE Healthcare). The concentration of purified proteins was determined employing the BCA (bicinchoninic acid) protein assay kit (Pierce) and bovine serum albumin as a standard. N-terminal Amino Acid Sequence Determination—Edman degradation was used to confirm the identity of purified proteins and quantify protein subunits from Western blots. UV-Visible Light Absorption Spectroscopy—UV-visible light spectra of purified recombinant BchNB complexes and BchL were recorded using a V-550 spectrophotometer (Jasco, Groß Umstadt, Germany) under strict anaerobic conditions. Iron Determination Method—Protein-bound iron was determined colorimetrically with o-phenantroline after acid denaturation of purified BchNB or BchL (24Lovenberg W. Buchanan B.B. Rabinowitz J.C. J. Biol. Chem. 1963; 238: 3899-3913Abstract Full Text PDF PubMed Google Scholar). The iron content of wild-type BchNB and BchL was confirmed by commercial inductively coupled plasma mass spectrometry (ICP-MS) (CURRENTA Bayer-Analytics, Leverkusen, Germany). Detection of Potential Flavins—Standard detection methods for FMN and FAD cofactors were performed as described elsewhere (25Yu S.W. Kim Y.R. Kang S.O. Biochem. J. 1999; 341: 755-763Crossref PubMed Google Scholar, 26Heinemann I.U. Diekmann N. Masoumi A. Koch M. Messerschmidt A. Jahn M. Jahn D. Biochem. J. 2007; 402: 575-580Crossref PubMed Scopus (36) Google Scholar). Analysis of a Potential Heme Cofactor—The presence of a potential heme cofactor was screened as described elsewhere (27Sun W. J. Chem. Sci. 2005; 117: 317-322Crossref Scopus (21) Google Scholar). Pchlide Preparation—Pchlide was isolated from the bchL-deficient R. capsulatus strain ZY5 as described earlier (23Fujita Y. Bauer C.E. J. Biol. Chem. 2000; 275: 23583-23588Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Pchlide Reduction Assay—DPOR activity was measured in 250-μl assays in 100 mm Hepes-NaOH (pH 7.5), 2 mm ATP, 5 mm MgCl2, 20 μm Pchlide, and 10 mm dithiothreitol as electron donor and an ATP regenerating system (20 mm creatine phosphate and 20 units of creatine phosphokinase/assay). This standard DPOR assay was supplemented with 30–100 μl of cell-free E. coli extract containing overproduced GST-BchN, BchB, and BchL. In DPOR reconstitution assays, 20 μg of BchNB complex and 20–60 μg of GST-BchL fusion protein were added. After 30–70 min at 35 °C under strict anaerobic conditions in the dark, reactions were stopped by 1 ml of acetone. Pchlide and Chlide in supernatants obtained by centrifuging for 10 min at 12,000 × g were spectrophotometrically quantified using extinction coefficient ϵ626 = 30.4 mm-1 cm-1 for Pchlide (23Fujita Y. Bauer C.E. J. Biol. Chem. 2000; 275: 23583-23588Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar) and ϵ665 = 74.9 mm-1 cm-1 for Chlide (28McFeeters R.F. Chichester C.O. Whitaker J.R. Plant Physiol. 1971; 47: 609-618Crossref PubMed Google Scholar). To investigate the ability of ferredoxin to function as elctron donor, the reconstitution assay was supplemented with a ferredoxin regenerating system (13 mm glucose 6-phosphate, 1.1 unit of glucose-6-phosphate dehydrogenase from Torula yeast (Sigma), 1.64 mm NADP+, and 0.025 units of ferredoxin-NADP+ oxidoreductase from spinach (Sigma)). The assay was also supplemented with commercially available ferredoxins from Clostridium, Porphyra, or spinach (Sigma) or with recombinantly produced ferredoxin from Synechococcus (29Dammeyer T. Frankenberg-Dinkel N. J. Biol. Chem. 2006; 281: 27081-27089Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar) at a concentration of 25 μg/ml, respectively. Activation Energy of DPOR Catalysis—To determine the activation energy of ATP-driven DPOR catalysis, the standard assay was repeated between 291 and 319 K. The initial rate of Chlide formation was used to calculate the rate constant at each temperature and the activation energy was determined by the Arrhenius equation, ln k=(−Eact/R·T)+C(Eq. 1) where k is the rate constant, Eact the activation energy, R the gas constant (8.314 kJ mol-1 K-1), T the temperature (K), and c a reaction constant. CN- Inhibition of DPOR—To analyze the inhibitory effect of CN- on DPOR catalysis, standard DPOR assays were carried out in the presence of 0–60 mm sodium cyanide. Molecular Mass Determination—Analytical gel permeation chromatography was performed using a Superdex 200 HR 10/30 column (GE Healthcare), equilibrated with wash buffer containing 100 mm NaCl. The column was calibrated with protein standards (Molecular Weight Marker Kit MW-GF 1000, Sigma) at a flow rate of 0.5 ml min-1. A 15-μl sample of purified BchNB or BchL (∼45 μg) was run under identical conditions (30Layer G. Verfurth K. Mahlitz E. Jahn D. J. Biol. Chem. 2002; 277: 34136-34142Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). Molybdenum Cofactor Analysis—To identify a possible molybdenum cofactor coordinated by BchNB, the nit-1 reconstitution assay supplemented with 4 μg of BchNB was used (31Havemeyer A. Bittner F. Wollers S. Mendel R. Kunze T. Clement B. J. Biol. Chem. 2006; 281: 34796-34802Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). 1.2 mg of BchNB were used to detect the stable oxidation product FormA of the cofactor (32Rajagopalan K.V. Johnson J.L. Hainline B.E. Fed. Proc. 1982; 41: 2608-2612PubMed Google Scholar). Subsequent product dephosphorylation, sample preparation, and HPLC analysis were performed as published (33Schwarz G. Boxer D.H. Mendel R.R. J. Biol. Chem. 1997; 272: 26811-26814Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). DPOR Production by Strains of E. coli Defective in Molybdenum Uptake—DPOR was produced by transforming pGEX-bchNBL* into E. coli RK-5207, a strain unable to import molybdenum from the medium (34Stewart V. MacGregor C.H. J. Bacteriol. 1982; 151: 788-799Crossref PubMed Google Scholar, 35Campbell A.M. del Campillo-Campbell A. Villaret D.B. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 227-231Crossref PubMed Scopus (53) Google Scholar). To overcome the phenotype of the RK-5207 mutant, DPOR was concurrently produced in the presence of 1 and 10 mm Na2MoO4 in LB medium. DPOR activity was tested in cell-free extracts. Molybdenum and Vanadium Determination by ICP-MS—To rule out the involvement of molybdenum or vanadium in DPOR catalysis ICP-MS was performed (36Llamas A. Otte T. Multhaup G. Mendel R.R. Schwarz G. J. Biol. Chem. 2006; 281: 18343-18350Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 37Simons A. Ruppert T. Schmidt C. Schlicksupp A. Pipkorn R. Reed J. Masters C.L. White A.R. Cappai R. Beyreuther K. Bayer T.A. Multhaup G. Biochemistry. 2002; 41: 9310-9320Crossref PubMed Scopus (46) Google Scholar). Samples containing 5 μg of purified protein were applied to the ICP-MS. C. tepidum DPOR Produced in E. coli Is Enzymatically Active—The complete bchNBL operon of the thermophilic green sulfur bacterium C. tepidum was cloned into a standard E. coli expression vector, producing the DPOR subunit BchN as an N-terminal glutathione S-transferase fusion protein (pGEX-bchNBL). However, amounts of recombinant proteins and DPOR activity were found to be low. Replacing the C. tepidum-type ribosomal binding site upstream of bchB (CCAACGAACCAA) and bchL (CCTCTATCATAC) with an E. coli type ribosomal binding site (GGAAACAGTATT) resulted in an expression vector (pGEX-bch-NBL*) that allows significant amounts of BchB and BchL to be produced (data not shown). Concomitantly, the DPOR activity of E. coli cell extracts increases from 0.29 to 3.15 nmol min-1 mg-1 (standard DPOR assay, 35 °C) (Fig. 3B, traces a–d), a significant improvement in specific activity compared with ∼40 pmol min-1 mg-1 for DPOR from R. capsulatus cell-free extracts (23Fujita Y. Bauer C.E. J. Biol. Chem. 2000; 275: 23583-23588Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). Despite distinct homology to nitrogenase, DPOR activity does not require further enzymes, such as molybdenum cofactor biosynthesizing or incorporating proteins, known to be essential to nitrogenase-producing organisms. Orthologues of genes encoding these proteins are not found in the genome of the E. coli production host. Purification of the Heterotetrameric BchNB Complex—DPOR was maintained under strict anaerobic conditions throughout, including during cell harvesting, cell disruption, protein purification, and activity assays. BchN was purified from E. coli pGEX-bchNBL* extracts. GST-BchN fusion protein was coupled to glutathione-Sepharose, washed extensively, and either eluted intact with 10 mm glutathione (Fig. 3A, lane 2) or liberated from bound GST by PreScission protease treatment (Fig. 3A, lane 3). SDS-PAGE analyses confirm the masses of GST-BchN (Mr = 74,000) or BchN (Mr = 47,000) and reveal stoichiometric amounts of a second protein (Mr = 59,000) (Fig. 3A, lanes 2 and 3). By N-terminal amino acid sequencing BchB was identified in equimolar amounts. The molecular mass of the BchNB complex was estimated to be Mr = 210,000 by gel filtration (Fig. 4C) implying a stoichiometry of 2BchN (46,643 Da each) and 2BchB (58,968 Da each). Henceforth the complex is therefore denoted (BchNB)2. Overall, we purified 2 mg of pure (BchNB)2 complex per liter of medium. Purification of the Homodimeric BchL Complex—To allow reconstitution of DPOR, the subunit BchL was separately purified from E. coli extracts. The GST-BchL fusion protein was purified by affinity chromatography and eluted as GST fusion protein with 10 mm glutathione buffer or cleaved off GST by PreScission protease. SDS-PAGE analysis indicates a single protein of Mr = 57,000 for GST-BchL (Fig. 3A, lane 4) or Mr = 30,000 for BchL. Analytical gel filtration revealed a relative molecular mass of about 60,000 (Fig. 4C) for BchL indicating that purified BchL from C. tepidum is homodimeric, henceforth denoted BchL2. Overall, 1.5 mg of pure BchL2 were recovered from 5 liters of E. coli culture. Reconstitution of DPOR Activity—To reconstitute DPOR activity in vitro, 20 μg (0.1 nmol) of (BchNB)2 and 20–60 μg (0.7–2 nmol) of BchL were assayed using 20 μm Pchlide in the presence of 10 mm dithionite as reductant, 2 mm ATP, and an ATP regenerating system. After 20 min incubation under anaerobic conditions at 35 °C, the reactions were stopped by adding 80% (v/v) acetone. Photometric analysis indicated that the reconstituted C. tepidum enzyme efficiently converts Pchlide (absorbance maximum 626 nm) into Chlide (absorbance maximum 665 nm; Fig. 3B, trace e). Chlide production was not detected if BchNB (trace f), BchL (trace g), dithionite, or the ATP regenerating system were omitted, or when the assay was performed under aerobic conditions (data not shown). Kinetic Properties of DPOR Catalysis—To establish the Km values for C. tepidum DPOR we determined the initial velocity of Chlide formation over a broad range of Pchlide, ATP, and dithionite concentrations using the outlined DPOR assay and saturating concentrations for the residual substrates. For Pchlide, ATP, and the artificial co-substrate dithionite, Chlide formation followed Michaelis-Menten kinetics. The apparent Km for Pchlide was found to be 6.1 μm, slightly lower than the 10.6 μm measured for DPOR from R. capsulatus (22Nomata J. Swem L.R. Bauer C.E. Fujita Y. Biochim. Biophys. Acta. 2005; 1708: 229-237Crossref PubMed Scopus (46) Google Scholar). The Km of C. tepidum DPOR for ATP was 13.5 μm, and 52.7 μm for dithionite (supplemental data Fig. 1). Ferredoxin-dependent C. tepidum DPOR Activity—To identify the true electron donor of DPOR, we replaced dithionite with [2Fe-2S]-ferredoxins from Synechococcus sp. PCC 7002, Porphyra umbilicalis, Spinacia oleracea, and with a [4Fe-4S]-ferredoxin from Clostridium pasteurianum in standard DPOR assays, supplemented with a ferredoxin-regenerating system: glucose 6-phosphate, glucose-6-phosphate dehydrogenase from Torula yeast (Sigma), NADP+, and ferredoxin-NADP+ oxidoreductase from spinach (Sigma). Only the ferredoxin from Synechococcus achieved 10% of the dithionite-supported DPOR activity. As other ferredoxins fail to sustain DPOR activity, we propose that a plant-type [2Fe-2S]-ferredoxin might be the electron donor for C. tepidum DPOR in vivo, corroborating the observation that [2Fe-2S]-ferredoxin from maize is an electron donor for DPOR from R. capsulatus (22Nomata J. Swem L.R. Bauer C.E. Fujita Y. Biochim. Biophys. Acta. 2005; 1708: 229-237Crossref PubMed Scopus (46) Google Scholar). Thermodynamic Properties of Pchlide Reduction by C. tepidum DPOR—Initial rates of Chlide formation were used to calculate rate constants at various temperatures. An Arrhenius plot of ln k versus 1/T indicates an activation energy for DPOR electron transfer of 22.2 kJ mol-1 (Fig. 3C), only slightly higher than the 18.8 kJ mol-1 reported for light-driven Pchlide reduction by LPOR (6Heyes D.J. Ruban A.V. Wilks H.M. Hunter C.N. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 11145-11150Crossref PubMed Scopus (81) Google Scholar) but dramatically lower than the 90–97 kJ mol-1 required for the electron transfer from the Fe-protein to the MoFe-protein of nitrogenase (38Mensink R.E. Haaker H. Eur. J. Biochem. 1992; 208: 295-299Crossref PubMed Scopus (10) G" @default.
• W2017446909 created "2016-06-24" @default.
• W2017446909 creator A5026922762 @default.
• W2017446909 creator A5035350917 @default.
• W2017446909 creator A5039241091 @default.
• W2017446909 creator A5040829211 @default.
• W2017446909 creator A5041916369 @default.
• W2017446909 creator A5061745193 @default.
• W2017446909 creator A5063692146 @default.
• W2017446909 creator A5067170943 @default.
• W2017446909 date "2008-04-01" @default.
• W2017446909 modified "2023-10-03" @default.
• W2017446909 title "ATP-driven Reduction by Dark-operative Protochlorophyllide Oxidoreductase from Chlorobium tepidum Mechanistically Resembles Nitrogenase Catalysis" @default.
• W2017446909 cites W1533678398 @default.
• W2017446909 cites W1876992098 @default.
• W2017446909 cites W1968660867 @default.
• W2017446909 cites W1975190350 @default.
• W2017446909 cites W1978257345 @default.
• W2017446909 cites W1980490580 @default.
• W2017446909 cites W1985259923 @default.
• W2017446909 cites W1991198925 @default.
• W2017446909 cites W1995331522 @default.
• W2017446909 cites W1996454766 @default.
• W2017446909 cites W1997352785 @default.
• W2017446909 cites W2006075724 @default.
• W2017446909 cites W2012115314 @default.
• W2017446909 cites W2017555639 @default.
• W2017446909 cites W2019585928 @default.
• W2017446909 cites W2022901826 @default.
• W2017446909 cites W2023008686 @default.
• W2017446909 cites W2027248634 @default.
• W2017446909 cites W2028504472 @default.
• W2017446909 cites W2039727644 @default.
• W2017446909 cites W2041946679 @default.
• W2017446909 cites W2042617445 @default.
• W2017446909 cites W2047733487 @default.
• W2017446909 cites W2049046940 @default.
• W2017446909 cites W2050846271 @default.
• W2017446909 cites W2051110936 @default.
• W2017446909 cites W2052159381 @default.
• W2017446909 cites W2055647855 @default.
• W2017446909 cites W2057585340 @default.
• W2017446909 cites W2058644435 @default.
• W2017446909 cites W2060809301 @default.
• W2017446909 cites W2061973014 @default.
• W2017446909 cites W2072207453 @default.
• W2017446909 cites W2082141080 @default.
• W2017446909 cites W2100810204 @default.
• W2017446909 cites W2102626746 @default.
• W2017446909 cites W2103507379 @default.
• W2017446909 cites W2107846233 @default.
• W2017446909 cites W2119261836 @default.
• W2017446909 cites W2135630897 @default.
• W2017446909 cites W2148900757 @default.
• W2017446909 cites W2153958932 @default.
• W2017446909 cites W2158298209 @default.
• W2017446909 cites W2163917615 @default.
• W2017446909 cites W2168707381 @default.
• W2017446909 cites W2169454844 @default.
• W2017446909 cites W2409105530 @default.
• W2017446909 cites W2469351867 @default.
• W2017446909 doi "https://doi.org/10.1074/jbc.m708010200" @default.
• W2017446909 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18252716" @default.
• W2017446909 hasPublicationYear "2008" @default.
• W2017446909 type Work @default.
• W2017446909 sameAs 2017446909 @default.
• W2017446909 citedByCount "60" @default.
• W2017446909 countsByYear W20174469092012 @default.
• W2017446909 countsByYear W20174469092013 @default.
• W2017446909 countsByYear W20174469092014 @default.
• W2017446909 countsByYear W20174469092015 @default.
• W2017446909 countsByYear W20174469092016 @default.
• W2017446909 countsByYear W20174469092017 @default.
• W2017446909 countsByYear W20174469092018 @default.
• W2017446909 countsByYear W20174469092019 @default.
• W2017446909 countsByYear W20174469092020 @default.
• W2017446909 countsByYear W20174469092021 @default.
• W2017446909 countsByYear W20174469092022 @default.
• W2017446909 countsByYear W20174469092023 @default.
• W2017446909 crossrefType "journal-article" @default.
• W2017446909 hasAuthorship W2017446909A5026922762 @default.
• W2017446909 hasAuthorship W2017446909A5035350917 @default.
• W2017446909 hasAuthorship W2017446909A5039241091 @default.
• W2017446909 hasAuthorship W2017446909A5040829211 @default.
• W2017446909 hasAuthorship W2017446909A5041916369 @default.
• W2017446909 hasAuthorship W2017446909A5061745193 @default.
• W2017446909 hasAuthorship W2017446909A5063692146 @default.
• W2017446909 hasAuthorship W2017446909A5067170943 @default.
• W2017446909 hasBestOaLocation W20174469091 @default.
• W2017446909 hasConcept C141280058 @default.
• W2017446909 hasConcept C161790260 @default.
• W2017446909 hasConcept C178790620 @default.
• W2017446909 hasConcept C181199279 @default.
• W2017446909 hasConcept C181440489 @default.
• W2017446909 hasConcept C185592680 @default.
• W2017446909 hasConcept C2779268744 @default.
• W2017446909 hasConcept C2779520027 @default.
• W2017446909 hasConcept C537208039 @default.

• next