FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017644172> ?p ?o ?g. }

• W2017644172 endingPage "29409" @default.
• W2017644172 startingPage "29400" @default.
• W2017644172 abstract "The sorting of membrane-bound proteins from the trans-Golgi network to lysosomal/endosomal compartments is achieved by preferential inclusion into clathrin-coated vesicles. Contained within the cytoplasmic domains of such proteins, specific sequence motifs have been identified (tyrosine-based and/or di-leucine-based) that are essential for targeting and are recognized by a family of heterotetrameric adaptor complexes, which then recruit clathrin. These cytosolic protein complexes, which have been found in a wide variety of higher eukaryotic organisms, are essential for the development of multicellular organisms. In trypanosomatids, the adaptin-mediated sorting of proteins is largely uncharacterized. In order to identify components of the adaptor-complex machinery, this study reports the cloning and characterization of σ1- and μ1-adaptin gene homologues from the eukaryotic protozoan parasite, Leishmania mexicana. Generation of σ1- and μ1-adaptin gene deletion mutants shows that these promastigote parasites are viable in culture, but are unable to establish infection of macrophages or mice, indicating that adaptin function is crucial for pathogenesis in these unicellular organisms. The sorting of membrane-bound proteins from the trans-Golgi network to lysosomal/endosomal compartments is achieved by preferential inclusion into clathrin-coated vesicles. Contained within the cytoplasmic domains of such proteins, specific sequence motifs have been identified (tyrosine-based and/or di-leucine-based) that are essential for targeting and are recognized by a family of heterotetrameric adaptor complexes, which then recruit clathrin. These cytosolic protein complexes, which have been found in a wide variety of higher eukaryotic organisms, are essential for the development of multicellular organisms. In trypanosomatids, the adaptin-mediated sorting of proteins is largely uncharacterized. In order to identify components of the adaptor-complex machinery, this study reports the cloning and characterization of σ1- and μ1-adaptin gene homologues from the eukaryotic protozoan parasite, Leishmania mexicana. Generation of σ1- and μ1-adaptin gene deletion mutants shows that these promastigote parasites are viable in culture, but are unable to establish infection of macrophages or mice, indicating that adaptin function is crucial for pathogenesis in these unicellular organisms. Several coat proteins have been described that are involved in the formation of carrier vesicles at different points in the secretory and endocytic trafficking pathways (1Schekman R. Orci L. Science. 1996; 271: 1526-1533Crossref PubMed Scopus (809) Google Scholar, 2Boehm M. Bonifacino J.S. Mol. Biol. Cell. 2001; 12: 2907-2920Crossref PubMed Scopus (355) Google Scholar, 3Robinson M.S. Bonifacino J S. Curr. Opin. Cell Biol. 2001; 13: 444-453Crossref PubMed Scopus (437) Google Scholar). Clathrin-coated vesicles (CCVs), 1The abbreviations used are: CCVs, clathrin-coated vesicles; TGN, trans-Golgi network; PM, plasma membrane; AP, adaptor protein; DIG, digoxygenin; ORF, open reading frame; PBS, phosphate-buffered saline; DAPI, 4′,6-diamidino-2-phenylindole; WT, wild type; PV, parasitophorous vacuole.1The abbreviations used are: CCVs, clathrin-coated vesicles; TGN, trans-Golgi network; PM, plasma membrane; AP, adaptor protein; DIG, digoxygenin; ORF, open reading frame; PBS, phosphate-buffered saline; DAPI, 4′,6-diamidino-2-phenylindole; WT, wild type; PV, parasitophorous vacuole. which were the first coated transport vesicles to be identified, belong to one of the major classes of transport vesicles for the trafficking of proteins from the trans-Golgi network (TGN) and plasma membrane (PM) to the endosomal/lysomal system (4Pearse B.M.F. J. Mol. Biol. 1975; 97: 93-98Crossref PubMed Scopus (347) Google Scholar). Essential to vesicle trafficking is the initiating step of cargo recognition by heterotetrameric adaptor protein (AP) complexes in association with regulatory molecules, followed by the recruitment of clathrin to the membrane for budding and vesicle formation (5Brodsky F.M. Chen C.-Y. Knuehl C. Towler M.C. Wakeham D.E. Annu. Rev. Cell Dev. Biol. 2001; 17: 517-568Crossref PubMed Scopus (533) Google Scholar, 6Kirchhausen T. Annu. Rev. Cell Dev. Biol. 1999; 15: 705-732Crossref PubMed Scopus (418) Google Scholar). Each heterotetramer of the TGN- and PM-associated AP complexes, AP-1 and AP-2 respectively, consist of two large adaptins (γ and α are found together with β1 and β2, respectively, ∼100 kDa), one medium-sized adaptin (μ1or μ2, ∼50 kDa) and one small adaptin (σ1or σ2, ∼20 kDa) (2Boehm M. Bonifacino J.S. Mol. Biol. Cell. 2001; 12: 2907-2920Crossref PubMed Scopus (355) Google Scholar, 6Kirchhausen T. Annu. Rev. Cell Dev. Biol. 1999; 15: 705-732Crossref PubMed Scopus (418) Google Scholar, 7Hirst J. Robinson M.S. Biochim. Biophy. Acta. 1998; 1404: 173-193Crossref PubMed Scopus (324) Google Scholar). The corresponding subunits of each AP complex are homologous to one another (25–84% amino acid identity), which suggest functional similarity, and each adaptin has been shown to fulfill a different function. Their predominant role is as follows: the β subunits are important for clathrin binding (8Ahle S. Ungewickell E. J. Biol. Chem. 1989; 264: 20089-20093Abstract Full Text PDF PubMed Google Scholar, 9Shih W. Gallusser A. Kirchhausen T. J. Biol. Chem. 1995; 270: 31083-31090Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar); γ- and α-adaptins target the AP complexes to specific membranes (10Robinson M.S. J. Cell Biol. 1993; 123: 67-77Crossref PubMed Scopus (59) Google Scholar, 11Page L.J. Robinson M S. J. Cell Biol. 1995; 131: 619-630Crossref PubMed Scopus (128) Google Scholar); μ-adaptins recognize and bind cargo for selection into CCVs via distinct sorting signals found in the cytoplasmic domains of certain transmembrane proteins: tyrosine-based motifs YXXϕ (where ϕ is a bulky hydrophobic residue) or NPXY and di-leucine/acidic residues (12Bonifacino J.S. Dell'Angelica E.C. J. Cell Biol. 1999; 145: 923-926Crossref PubMed Scopus (365) Google Scholar). To date there is no function assigned to the σ subunits. Recently, two structurally related AP complexes, AP-3 and AP-4 have been identified (2Boehm M. Bonifacino J.S. Mol. Biol. Cell. 2001; 12: 2907-2920Crossref PubMed Scopus (355) Google Scholar, 3Robinson M.S. Bonifacino J S. Curr. Opin. Cell Biol. 2001; 13: 444-453Crossref PubMed Scopus (437) Google Scholar). Previously, the functional roles of the AP complexes were based on biochemical and morphological experiments; however, more recent investigations have used targeted disruptions or naturally occurring mutants for the study of the physiological roles of these adaptor proteins (13Boehm M. Bonifacino J.S. Gene (Amst.). 2002; 286: 175-186Crossref PubMed Scopus (117) Google Scholar). In contrast to Saccharomyces cerevisiae where AP-1 and AP-2 are not essential for cell viability, it has been demonstrated that AP-1, although not required for cell viability in culture, is essential for the development of Caenorhabditis elegans and mice, and AP-2 is necessary for C. elegans embryonal development (14Huang K.M. D'Hondt K. Riezman H. Lemmon S.K. EMBO J. 1999; 18: 3897-3908Crossref PubMed Scopus (110) Google Scholar, 15Shim J. Sternberg P.W. Lee J. Mol. Biol. Cell. 2000; 11: 2743-2756Crossref PubMed Scopus (56) Google Scholar, 16Zizioli D. Meyer C. Guhde G. Saftig P. von Figura K. Schu P. J. Biol. Chem. 1999; 274: 5385-5390Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 17Shim J. Lee J. Mol. Cell. 2000; 10: 309-316Google Scholar).Leishmania are kinetoplastid protozoan parasites that are responsible for several important human diseases, ranging from mild skin ulcers to fatal visceral disease. These organisms lead a digenetic life style, where several forms of extracellular, flagellated, motile promastigotes colonize the digestive tract of vector sandflies. Upon transmission to the mammalian host during bloodfeeding by the insect, the promastigotes transform to non-flagellated, intracellular amastigotes, which reside in the phagolysosomes of macrophages (18Alexander J. Russell D.G. Adv. Parasitol. 1992; 31: 175-254Crossref PubMed Scopus (273) Google Scholar). Extensive studies have shown that the cell surface of both life cycle stages of these pathogens are coated with high levels of varying GPI-anchored glycoprotein, glycoconjugates, and glycolipids, which, depending on the Leishmania species studied, are vital for survival and virulence in the harsh environments that are encountered by the parasite (19Turco S.J. Spath G.F. Beverley S.M. Trends Parasitol. 2001; 17: 223-226Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 20Ilg T. EMBO J. 2000; 19: 1953-1962Crossref PubMed Scopus (110) Google Scholar, 21Hilley J.D. Zawadzki J.L. McConville M.J. Coombs G.H. Mottram J.C. Mol. Biol. Cell. 2000; 11: 1183-1195Crossref PubMed Scopus (74) Google Scholar).Leishmania cells are highly polarized structures with an elongated shape in most life cycle stages. A microtubular corset lines the plasma membrane maintaining the morphology of the cell and appears to prohibit membrane fusion. All endocytosis and exocytosis occurs at an anterior specialized invagination of the cell surface membrane at the point of the emerging flagellum, termed the flagellar pocket (22Webster P. Russell D.G. Parasitol. Today. 1993; 9: 201-206Abstract Full Text PDF PubMed Scopus (110) Google Scholar, 23Overath P. Stierhof Y.-D. Wiese M. Trends Cell Biol. 1997; 7: 27-33Abstract Full Text PDF PubMed Scopus (121) Google Scholar). Organelles involved in the secretory/endocytic pathways are located between the flagellar pocket and the nucleus (24Weise F. Stierhof Y.-D. Kuehn C. Wiese M. Overath P. J. Cell Sci. 2000; 113: 4587-4603Crossref PubMed Google Scholar). These morphological features make Leishmania and related organisms, such as Trypansoma brucei, interesting models for protein trafficking studies. For both Leishmania and T. brucei, several transmembrane proteins have been identified that have the potential to be used in protein trafficking studies (23Overath P. Stierhof Y.-D. Wiese M. Trends Cell Biol. 1997; 7: 27-33Abstract Full Text PDF PubMed Scopus (121) Google Scholar). In particular, a membrane-bound acid phosphatase of L. mexicana contains within its cytoplasmic domain both tyrosine-based and diisoleucine sorting signals (25Wiese M. Berger O. Stierhof Y.D. Wolfram M. Fuchs M. Overath P. Mol. Biochem. Parasitol. 1996; 82: 153-165Crossref PubMed Scopus (41) Google Scholar) and in T. brucei, p67, a lysosomal membrane glycoprotein contains within its carboxyl terminus two di-leucine motifs (26Kelley R.J. Alexander D.L. Cowan C. Balber A.E. Bangs J.D. Mol. Biochem. Parasitol. 1999; 98: 17-28Crossref PubMed Scopus (59) Google Scholar). Both of these proteins localize to endosomal/lysosomal compartments of each respective organism, but little is known about their intracellular trafficking. The presence of these putative sorting motifs suggests that the molecular machinery for adaptin-mediated sorting maybe conserved in these highly divergent group of unicellular eukaryotes. With the recent advent of the genome sequencing projects for both L. major and T. brucei, several sequences encoding potential components of the secretory/endocytic pathways have been identified. Homologues for several Rab proteins and clathrin of T. brucei are now being used as markers for the identification of subcellular compartments involved in protein trafficking (27McConville M.J. Mullin K.A. Ilgoutz S.C. Teasdale R.D. Microbiol. Mol. Biol. Rev. 2002; 66: 122-154Crossref PubMed Scopus (202) Google Scholar, 28Morgan G.W. Hall B.S. Denny P.W. Field M.C. Carrington M. Trends Parasitol. 2002; 18: 540-546Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar).In order to identify components of the adaptor-complex machinery of L. mexicana, a PCR-based homology approach was used. This article describes the cloning and initial characterization of two AP complex subunits of L. mexicana that are potential σ1- and μ1-adaptins, due to their significant homology to other adaptins of these classes.EXPERIMENTAL PROCEDURESParasite Maintenance and Transfections—L. mexicana promastigotes (MNYC/BZ/62/M379 strain) and derived gene deletion mutant cell lines were maintained in vitro at 27 °C in semidefined medium 79 (SDM-79) supplemented with 5% heat-inactivated fetal calf serum (Invitrogen, Inc.) and 8 μg/ml hemin (Sigma). Transfections were performed as described previously (29LeBowitz J.H. Coburn C.M. McMahon-Pratt D. Beverley S.M. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 9736-9740Crossref PubMed Scopus (191) Google Scholar), and recombinant clones were isolated by limiting dilution on 96-well plates in SDM medium containing the appropriate drug for the selectable markers, used at the following concentrations of 32 μg/ml hygromycin (Sigma), 2.5 μg/ml phleomycin (Sigma), and 80 μm puromycin (Sigma).DNA Techniques—Restriction enzyme digests, DNA ligations, transformation of Escherichia coli, isolation of λ-phage and colony lifts, agarose gel electrophoresis, Southern blotting were performed according to standard methods (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Large- and small-scale parasite genomic DNA were purified according to protocols previously described (31Coulson R.M.R. Smith D.F. Mol. Biochem. Parasitol. 1990; 40: 63-75Crossref PubMed Scopus (54) Google Scholar, 32Medina-Acosta E. Cross G.A.M. Mol. Biochem. Parasitol. 1993; 59: 327-330Crossref PubMed Scopus (231) Google Scholar). Plasmid DNA and DNA fragments from agarose gels were isolated using commercial kits according to the manufacturer's instructions (Qiagen). Polymerase chain reactions (PCR) were performed using the Expand™ high fidelity PCR system (Roche Applied Science). All PCR products were subcloned into the TA cloning vector (Invitrogen) and sequenced by the dideoxy chain termination method using an ALFexpress automated sequencer (Amersham Biosciences). DNA probes were generated using a PCR-DIG labeling kit (Roche Applied Science). On nucleic acid blots the labeled DNA was detected using anti-DIG-Fab fragments coupled to alkaline phosphatase (Roche Applied Science) and CDP-Star™ as the chemiluminescent substrate according to the manufacturer's instructions.Cloning of the L. mexicana Lmxσ1-adaptin Gene and Generation of Deletion and Addback Constructs—The Block Maker program (www.blocks.fhcrc.org) was used to align ungapped, highly conserved regions of the σ1 subunit amino acid sequence from the organisms (SWISS-PROT accession codes given in parentheses): Homo sapiens (P56377), Mus musculus (Q00382), S. cerevisiae (P35181), and Arabidopsis thaliana (AAB96887). Peptide sequences from the resulting conserved blocks were used to design a series of degenerate primers: 5′-CA(A/G)GG(A/G/C/T)AA(A/G)ITICG(A/G/C/T)CT(A/G/C/T)I(A/C)IAA(A/G)TGGTA, CA(A/G)GG(A/G/C/T)AA(A/G)ITICG(A/G/C/T)TT(A/G)I(A/C)IAA(A/G)TGGTA, CA(A/G)GG(A/G/C/T)AA(A/G)ITIAG(A/G)CT(A/G/C/T)I(A/C)IAA(A/G)TGGTA, CA(A/G)GG(A/G/C/T)AA(A/G)ITIAG(A/G)TT(A/G)I(A/C)IAA(A/G)TGGTA, and 3′-AA(A/G/T)AT(A/G/T)AT(A/G)TC(A/G/C/T)AG(C/T)TC(A/G)CA(A/G/C/T)AC. PCR was performed using this mixture of oligonucleotides with L. mexicana genomic DNA, and the derived 284-bp fragment was subcloned into the TA cloning vector (Invitrogen) and sequenced. This DIG-labeled PCR product was used to screen a λ-DashII L. mexicana genomic DNA library (25Wiese M. Berger O. Stierhof Y.D. Wolfram M. Fuchs M. Overath P. Mol. Biochem. Parasitol. 1996; 82: 153-165Crossref PubMed Scopus (41) Google Scholar), and a ∼3.3-kb NotI fragment from positive clones was subcloned into pBSK+ (Stratgene) and sequenced on both strands. Using data base searches the ORF corresponding to Lmxσ1-adaptin was identified by homology to other known σ-adaptins. The sequence data for the Lmxσ1-adaptin-containing genomic DNA fragment has been submitted to the DDBJ/EMBL/GenBank™ data base under accession code AF514805. For the derivation of double targeting gene replacement cassettes, PCR was carried out for amplification of the 5′-upstream region of Lmxσ1- adaptin using the primers GTCGAGCGGCCGCGCGGCCTCGCCG and CCATGCCATGGCGCCCACACGCGCGTGCAG (where a NcoI restriction site was introduced at the translation initiation codon of Lmxσ1-adaptin ORF), and for the 3′-downstream region ATACGCCCTAGGGGGTGTAGGTTGCCCGTC (where an AvrII site was inserted at the stop codon of the Lmxσ1-adaptin ORF) and ACGCGTCGACGCGGCCGCGCCTCGTCTGCA. The NotI/NcoI-digested Lmxσ1- adaptin 5′-upstream, the AvrII/NotI-digested Lmxσ1- adaptin 3′-downstream PCR DNA fragments and a NcoI/AvrII DNA fragment encoding the hygromycin phosphotransferase ORF (HYG) (33Cruz A. Coburn C.M. Beverley S.M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7170-7174Crossref PubMed Scopus (276) Google Scholar) were consecutively ligated into pBSK+. A NcoI/AvrII DNA fragment containing the phleomycin gene (PHLEO) was used for the second Lmxσ1- adaptin gene replacement construct. For chromosomal integration, linear DNA fragments for transfection of L. mexicana promastigotes containing the HYG- and PHLEO- Lmxσ1- adaptin gene replacement cassettes were excised by NotI digestion. For episomal and chromosomal protein expression in the gene deletion mutant background, vectors containing the ORF were constructed. The Lmxσ1-adaptin ORF obtained by PCR (see “Antibodies” below), was excised from the TA cloning vector by BamHI digestion and subcloned into the pX63PAC episomal vector (34Freedman D.J. Beverley S.M. Mol. Biochem. Parasitol. 1993; 62: 37-44Crossref PubMed Scopus (58) Google Scholar). For protein expression under the control of the rRNA promoter, PCR was performed with the following primers: ATCGATATGATTCAGTTCCTG and TCTAGATCATACACCCTTGATGGC and a Lmxσ1- adaptin gene containing DNA fragment, to introduce ClaI and XbaI restriction enzymes sites for subcloning of the ORF into the pSSU-int plasmid (35Miβlitz A. Mottram J.C. Overath P. Aebischer T. Mol. Biochem. Parasitol. 2000; 107: 251-261Crossref PubMed Scopus (122) Google Scholar). The integration cassette was excised by digestion with PacI and PmeI for transfection of L. mexicana promastigotes.Cloning of the L. mexicana Lmxμ1-adaptin Gene and Generation of Deletion and Addback Constructs—A potential partial μ1-adaptin L. major sequence was found using the keyword search of the Leishmania Proteome data base (www.ebi.ac.uk/parasite/LGN/Proteome/proteome.html), deposited in the GenBank™ data base under the accession code AQ846242. Based on this sequence, the following primers were designed and used in PCR with L. mexicana genomic DNA: TACACCTTCGTGCGCGAGAA and ATCGAGCAGGTCGACATGCT. After subcloning into the TA cloning vector (Invitrogen) and sequencing of the derived 410-bp PCR product, this DIG-labeled DNA fragment was used to screen a λ-DashII L. mexicana genomic DNA library (25Wiese M. Berger O. Stierhof Y.D. Wolfram M. Fuchs M. Overath P. Mol. Biochem. Parasitol. 1996; 82: 153-165Crossref PubMed Scopus (41) Google Scholar) and a ∼6-kb EcoRI fragment from positive clones was subcloned into pBSK+ (Stratgene) and sequenced on both strands. Using data base searches the ORF corresponding to Lmxμ1-adaptin was identified by homology to other known μ1-adaptins. The sequence data for the Lmxμ1- adaptin-containing genomic DNA fragment has been submitted to the DDBJ/EMBL/GenBank™ data base under accession code AF514806. For the construction of double targeting gene replacement cassettes, PCR was carried out for amplification of the 5′-upstream region of Lmxμ1- adaptin using the primers GCGGCCGCTGGATGTGTGTGCAT and CCATGGCACCTGCGGACGTAC (where a NotI restriction site was introduced at the 5′-end of this fragment, and a NcoI site was introduced at the translation initiation codon of Lmxμ1-adaptin ORF). For the 3′-downstream region the primers pairs CCTAGGGACGGAATGATGGGC and GCGGCCGCACGCACTGCAGCTGC (where at the 5′-end of this DNA fragment an AvrII site was inserted at the stop codon of the Lmxμ1-adaptin ORF and a NotI site at the 3′end) were used. The NotI/NcoI digested Lmxμ1- adaptin 5′-upstream, the AvrII/NotI-digested Lmxμ1- adaptin 3′-downstream PCR DNA fragments and a NcoI/AvrII DNA fragment encoding the hygromycin phosphotransferase ORF (HYG) (33Cruz A. Coburn C.M. Beverley S.M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 7170-7174Crossref PubMed Scopus (276) Google Scholar) were consecutively ligated into pBSK+. A NcoI/AvrII DNA fragment containing the phleomycin gene (PHLEO) was used for the second Lmxμ1- adaptin gene replacement construct. For chromosomal integration, linear DNA fragments for transfection of L. mexicana promastigotes containing the HYG- and PHLEO- Lmxμ1- adaptin gene replacement cassettes were excised by NotI digestion. For episomal and chromosomal protein expression in the gene deletion mutant background, vectors containing the ORF were constructed. The amplified Lmxμ1-adaptin ORF (see “Antibodies” section below) was excised from the TA cloning vector by BamHI/HindIII digestion and the ends filled in with Klenow enzyme (Roche Applied Science) to yield a blunt-ended fragment, followed by ligation into BamHI-digested/ends-filled-in pX63PAC episomal vector (34Freedman D.J. Beverley S.M. Mol. Biochem. Parasitol. 1993; 62: 37-44Crossref PubMed Scopus (58) Google Scholar). For protein expression under the control of the rRNA promoter this blunt-ended Lmxμ1-adaptin ORF-containing DNA fragment was subcloned into ClaI/XbaI-digested/ends-filled-in pSSU-int plasmid (35Miβlitz A. Mottram J.C. Overath P. Aebischer T. Mol. Biochem. Parasitol. 2000; 107: 251-261Crossref PubMed Scopus (122) Google Scholar). The integration cassette was excised by digestion with PacI and PmeI for transfection of L. mexicana promastigotes.Antibodies—For high level expression and purification of L. mexicana σ1- and μ1-adaptin recombinant proteins the pQE-8 vector (Qiagen) was used. In order to subclone the full-length ORFs into the BamHI/HindIII sites of this plasmid, PCR was carried out to introduce these restriction sites using the primer pairs: CGCGGATCCATGATTCAGTTCCTGCTG and AAGCTTTCATACACCCTTGATGGCGTT for Lmxσ1- adaptin and GGATCCATGGCGTCGGTGCTGTA and AAGCTTTCAGTCCGTTCGTAT for Lmxμ1- adaptin. To avoid sequencing the entire Lmxμ1- adaptin amplified ORF, an internal AatII/BspEI of this PCR product was replaced by the same DNA fragment excised from the genomic subclone. The sequences of these constructs were verified and used for transformation of competent E. coli M15 cells. Cell culture, induction of recombinant protein expression, and batch purification of solubilized inclusion bodies (8 m urea) by Ni-nitrilotriacetic acid-agarose chromatography were performed according to the manufacturer's instructions (Qiagen). Rabbits were immunized with 200 μg of each purified recombinant protein or with 300 μg of a 15-residue peptide corresponding to the carboxyl terminus of Lmxσ1-adaptin (coupled to KLH (Calbiochem) via an inserted amino-terminal cysteine residue as described previously, Ref. 30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar), emulsified with 50% (v/v) complete Freund's adjuvant for primary immunizations and with 50% (v/v) incomplete Freund's adjuvant for all subsequent boosts. Polyclonal antisera were collected 14 days after each booster immunization. Anti-Lmxσ1-adaptin peptide antibodies were affinity-purified using as the ligand the peptide immobilized to SulfoLink™ coupling gel (Pierce) according to the supplier's instructions. In order to remove unspecific antibodies, antisera raised against the L. mexicana σ1- and μ1-adaptin full-length ORFs were absorbed using the respective L. mexicana-null mutant cell lines. Late logarithmic phase promastigotes were harvested, followed by a fixation step (rotating for 1 h at room temperature in PBS containing 0.05% glutaraldehyde and 2% formaldehyde), centrifuged at 30,000 × g for 1 h, permeabilized (rotating for 1 h at room temperature in PBS containing 1% skimmed milk powder, 0.5% bovine serum albumin, and 0.1% saponin) and centrifuged as before. The pellets were resuspended in the permeabilization buffer, and an aliquot of this was added to antiserum, rotated for 1 h at room temperature or overnight at 4 °C, followed by centrifugation. This latter step was repeated several times using a fresh portion of permeabilized cells added to the resulting supernatant. The final supernatant was ultracentrifuged at 140,000 × g for 30 min.Analytic Procedures—To obtain protein for Western blot analysis, L. mexicana parasites were washed twice in PBS, followed by extraction of lipids by addition of CHCl3-CH3OH-H2O at a ratio of 1:2:0.8. Cells were immediately vortexed, incubated at room temperature for 30 min then centrifuged at 10,000 rpm in a benchtop microcentrifuge at room temperature. Solvents were removed from pellets by evaporation at 30 °C. The protein was then resuspended at the equivalent of 5 × 108 cells/ml in 50 mm Tris-HCl pH 8.0 containing 5 mm MgCl2, 0.5 mm phenylmethysulfonyl fluoride, 20 μm leupeptin, 5 mm o-phenanthroline, and 100 units/ml benzonuclease (Merck). After incubation at 37 °C for 30 min to digest nucleic acids, one-fifth volume of 5× sample buffer (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar) was added. Discontinuous SDS-PAGE on 4% stacking gels over 7.5–20% resolving gradient gels, electrotransfer of proteins onto polyvinylidene difluoride membranes (Millipore) and incubations of the membranes with primary and secondary antibodies were performed as described previously (36Harlow E. Lane D. Antibodies- A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY1988Google Scholar). Horseradish peroxidase-labeled antibodies were detected using the ECL system (Amersham Biosciences) and stripping of blots for re-probing were both carried out according to the manufacturer's instructions.Infections of Mice and Peritoneal Macrophages—For mouse infection studies, groups of four Balb/c mice were used for each cell line. These experiments were performed in duplicate. The left hind footpad was injected with 107 stationary phase promastigotes resuspended in 30 μl of PBS. Using a caliper slide, the course of infections was followed by measuring footpad lesion size relative to the uninfected right hind footpad at 7–14-day intervals. For macrophage infection experiments, peritoneal cells were isolated from Balb/c mice by peritoneal lavage and seeded onto coverslips (13-mm diameter) at 2.5 × 105 to 106 cells per coverslip in complete Dulbecco's modified Eagle's medium (DMEM), which contained 10% heat-inactivated fetal calf serum, 100 μg/ml penicillin/streptomycin, and 2 mm glutamine. After overnight incubation at 37 °C with 5% CO2 in air, non-adherent cells were removed by three washes of the coverslips with pre-warmed complete DMEM. Approximately 50% of the cells, which had adhered to the coverslips, judged as peritoneal macrophages by their morphology, were infected with stationary phase promastigotes, which had been washed and resuspended in complete DMEM, at a parasite to macrophage ratio of 2:1. Two coverslips were used per cell line. Following incubation overnight at 33 °C with 5% CO2 in air, residual-free promastigotes were removed by three washes using pre-warmed complete DMEM. Incubation at 33 °C with 5% CO2 in air was continued and coverslips removed at the required time points, washed with pre-warmed PBS, and fixed and stained with DAPI (see below). The number of parasitized macrophages and the number of L. mexicana amastigotes per host cell were counted by inspection with a fluorescence microscope.Immunofluorescence Microscopy—Coverslips containing parasitised peritoneal macrophages were washed three times with pre-warmed PBS, fixed by submerging in PBS containing 2% formaldehyde and 0.05% glutaraldehyde for 30 min, washed twice with room temperature PBS, incubated at room temperature for 30 min with DAPI (10 μg/ml) in blocking solution of PBS containing 2% bovine serum albumin and 0.05 m NH4Cl, followed by three washes with room temperature PBS. The coverslips were mounted using Mowiol/Dabco and inspected by fluorescence microscopy. As duplicate infections were performed for each cell line, 300 macrophages were counted per coverslip, grouped according to parasite burden and the average taken.RESULTSCloning of the L. mexicana σ1- and μ1-adaptin Genes—For the cloning of the L. mexicana σ1-adaptin gene, σ1-adaptin protein sequences from other organisms were used to find conserved blocks. A series of degenerate oligonucleotides were designed based on the peptide sequences QGK(V/F)RL(T/Q/K)KWY and VCELDIIF and used in PCR with L. mexicana genomic DNA as the template. Sequencing of the amplified DNA identified a partial ORF with high homology to σ-adaptins. This PCR product was DIG-labeled and used to screen a λ-DashII L. mexicana genomic DNA library. Sequencing of a Lmxσ-adaptin gene-containing subcloned DNA fragment showed the presence of an ORF of 495 base pairs (bp, Fig. 2C) encoding a protein of a predicted molecular mass of ∼19.2 kDa (Figs. 1A and 3A) and a calculated isoelectric point of 7.9. Data base searches with the Lmxσ-adaptin ORF displayed significant homology of this sequence with other AP complex σ-adaptins from various organisms. Phylogenetic analysis of these sequences showed that the Lmxσ-adaptin ORF is grouped within the σ1 family of adaptins. The complied sequences of this group" @default.
• W2017644172 created "2016-06-24" @default.
• W2017644172 creator A5010421361 @default.
• W2017644172 date "2003-08-01" @default.
• W2017644172 modified "2023-09-27" @default.
• W2017644172 title "σ1- and μ1-Adaptin Homologues of Leishmania mexicana Are Required for Parasite Survival in the Infected Host" @default.
• W2017644172 cites W1485689124 @default.
• W2017644172 cites W1523341154 @default.
• W2017644172 cites W1555734844 @default.
• W2017644172 cites W1838334543 @default.
• W2017644172 cites W1965512878 @default.
• W2017644172 cites W1977929887 @default.
• W2017644172 cites W1981242537 @default.
• W2017644172 cites W1986111653 @default.
• W2017644172 cites W1987672004 @default.
• W2017644172 cites W1989316445 @default.
• W2017644172 cites W1995378703 @default.
• W2017644172 cites W2000491758 @default.
• W2017644172 cites W2002994480 @default.
• W2017644172 cites W2008576345 @default.
• W2017644172 cites W2011987706 @default.
• W2017644172 cites W2012848672 @default.
• W2017644172 cites W2024373248 @default.
• W2017644172 cites W2024996459 @default.
• W2017644172 cites W2027477868 @default.
• W2017644172 cites W2029731075 @default.
• W2017644172 cites W2030399625 @default.
• W2017644172 cites W2037410803 @default.
• W2017644172 cites W2039070421 @default.
• W2017644172 cites W2039677833 @default.
• W2017644172 cites W2048869016 @default.
• W2017644172 cites W2060087365 @default.
• W2017644172 cites W2062819360 @default.
• W2017644172 cites W2064649859 @default.
• W2017644172 cites W2065503544 @default.
• W2017644172 cites W2072607746 @default.
• W2017644172 cites W2087677809 @default.
• W2017644172 cites W2102828449 @default.
• W2017644172 cites W2114022699 @default.
• W2017644172 cites W2114410573 @default.
• W2017644172 cites W2114882855 @default.
• W2017644172 cites W2117352422 @default.
• W2017644172 cites W2118393965 @default.
• W2017644172 cites W2121284960 @default.
• W2017644172 cites W2123377654 @default.
• W2017644172 cites W2126472716 @default.
• W2017644172 cites W2143205348 @default.
• W2017644172 cites W2145089843 @default.
• W2017644172 cites W2145333947 @default.
• W2017644172 cites W2147822621 @default.
• W2017644172 cites W2164354626 @default.
• W2017644172 cites W2166175048 @default.
• W2017644172 doi "https://doi.org/10.1074/jbc.m304572200" @default.
• W2017644172 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12730207" @default.
• W2017644172 hasPublicationYear "2003" @default.
• W2017644172 type Work @default.
• W2017644172 sameAs 2017644172 @default.
• W2017644172 citedByCount "16" @default.
• W2017644172 countsByYear W20176441722012 @default.
• W2017644172 countsByYear W20176441722017 @default.
• W2017644172 crossrefType "journal-article" @default.
• W2017644172 hasAuthorship W2017644172A5010421361 @default.
• W2017644172 hasBestOaLocation W20176441721 @default.
• W2017644172 hasConcept C126831891 @default.
• W2017644172 hasConcept C136764020 @default.
• W2017644172 hasConcept C159047783 @default.
• W2017644172 hasConcept C2781092759 @default.
• W2017644172 hasConcept C2781371782 @default.
• W2017644172 hasConcept C41008148 @default.
• W2017644172 hasConcept C54355233 @default.
• W2017644172 hasConcept C71928629 @default.
• W2017644172 hasConcept C86803240 @default.
• W2017644172 hasConcept C89423630 @default.
• W2017644172 hasConceptScore W2017644172C126831891 @default.
• W2017644172 hasConceptScore W2017644172C136764020 @default.
• W2017644172 hasConceptScore W2017644172C159047783 @default.
• W2017644172 hasConceptScore W2017644172C2781092759 @default.
• W2017644172 hasConceptScore W2017644172C2781371782 @default.
• W2017644172 hasConceptScore W2017644172C41008148 @default.
• W2017644172 hasConceptScore W2017644172C54355233 @default.
• W2017644172 hasConceptScore W2017644172C71928629 @default.
• W2017644172 hasConceptScore W2017644172C86803240 @default.
• W2017644172 hasConceptScore W2017644172C89423630 @default.
• W2017644172 hasIssue "32" @default.
• W2017644172 hasLocation W20176441721 @default.
• W2017644172 hasOpenAccess W2017644172 @default.
• W2017644172 hasPrimaryLocation W20176441721 @default.
• W2017644172 hasRelatedWork W1981939182 @default.
• W2017644172 hasRelatedWork W2020703909 @default.
• W2017644172 hasRelatedWork W2024105453 @default.
• W2017644172 hasRelatedWork W2100928880 @default.
• W2017644172 hasRelatedWork W2129443427 @default.
• W2017644172 hasRelatedWork W2312421576 @default.
• W2017644172 hasRelatedWork W2321835289 @default.
• W2017644172 hasRelatedWork W2322103450 @default.
• W2017644172 hasRelatedWork W3180996806 @default.
• W2017644172 hasRelatedWork W2599619236 @default.
• W2017644172 hasVolume "278" @default.

• next