FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017772012> ?p ?o ?g. }

• W2017772012 endingPage "31849" @default.
• W2017772012 startingPage "31842" @default.
• W2017772012 abstract "Dynamin and its related proteins are a group of mechanochemical proteins involved in the modulation of lipid membranes in various biological processes. Here we investigate the nature of membrane binding of the Arabidopsis dynamin-like 6 (ADL6) involved in vesicle trafficking from the trans-Golgi network to the central vacuole. Fractionation experiments by continuous sucrose gradients and gel filtration revealed that the majority of ADL6 is associated with membranes in vivo. Amino acid sequence analysis revealed that ADL6 has a putative pleckstrin homology (PH) domain. In vitro lipid binding assays demonstrated that ADL6 showed high affinity binding to phosphatidylinositol 3-phosphate (PtdIns-3-P) and that the PH domain was responsible for this interaction. However, the PH domain alone binds equally well to both PtdIns-3-P and phosphatidylinositol 4-phosphate (PtdIns-4-P). Interestingly, the high affinity binding of the PH domain to PtdIns-3-P was restored by a protein-protein interaction between the PH domain and the C-terminal region. In addition, deletion of the inserted regions within the PH domain results in high affinity binding of the PH domain to PtdIns-3-P. These results suggest that ADL6 binds specifically to PtdIns-3-P and that the lipid binding specificity is determined by the interaction between the PH domain and the C-terminal domain of ADL6. Dynamin and its related proteins are a group of mechanochemical proteins involved in the modulation of lipid membranes in various biological processes. Here we investigate the nature of membrane binding of the Arabidopsis dynamin-like 6 (ADL6) involved in vesicle trafficking from the trans-Golgi network to the central vacuole. Fractionation experiments by continuous sucrose gradients and gel filtration revealed that the majority of ADL6 is associated with membranes in vivo. Amino acid sequence analysis revealed that ADL6 has a putative pleckstrin homology (PH) domain. In vitro lipid binding assays demonstrated that ADL6 showed high affinity binding to phosphatidylinositol 3-phosphate (PtdIns-3-P) and that the PH domain was responsible for this interaction. However, the PH domain alone binds equally well to both PtdIns-3-P and phosphatidylinositol 4-phosphate (PtdIns-4-P). Interestingly, the high affinity binding of the PH domain to PtdIns-3-P was restored by a protein-protein interaction between the PH domain and the C-terminal region. In addition, deletion of the inserted regions within the PH domain results in high affinity binding of the PH domain to PtdIns-3-P. These results suggest that ADL6 binds specifically to PtdIns-3-P and that the lipid binding specificity is determined by the interaction between the PH domain and the C-terminal domain of ADL6. trans-Golgi network Arabidopsisdynamin-like pleckstrin homology C-terminal domain maltose-binding protein phosphatidylcholine phosphatidylethanolamine phosphatidylinositol phospholipase C GTPase effector domain Dynamin, a high molecular weight GTP-binding protein originally found in rat brain tissue, has been shown to play an important role in vesicle formation during endocytosis. Since the discovery of dynamin I, numerous dynamin-related proteins have been identified from various organisms such as yeasts, plants, and humans (1Obar R.A. Collins C.A. Hammarback J.A. Shpetner H.S. Vallee R.B. Nature. 1990; 347: 256-261Crossref PubMed Scopus (286) Google Scholar, 2Rothman J.H. Raymond C.K. Gilbert T. O'Hara P.J. Stevens T.H. Cell. 1990; 61: 1063-1074Abstract Full Text PDF PubMed Scopus (214) Google Scholar, 3Chen M.S. Obar R.A. Schroeder C.C. Austin T.W. Poodry C.A. Wadsworth S.C. Vallee R.B. Nature. 1991; 351: 583-586Crossref PubMed Scopus (441) Google Scholar, 4Dombrowski J.E. Raikhel N.V. Plant Mol. Biol. 1995; 28: 1121-1126Crossref PubMed Scopus (35) Google Scholar, 5Gu X. Verma D.P.S. EMBO J. 1996; 15: 695-704Crossref PubMed Scopus (141) Google Scholar, 6Kang S.G. Jin J.B. Piao H.L. Pih K.T. Jang H.J. Lim J.H. Hwang I. Plant Mol. Biol. 1998; 38: 437-447Crossref PubMed Scopus (52) Google Scholar). The mechanism by which dynamin I plays a role in endocytosis has been extensively studied (7Gout I. Dhand R. Hiles I.D. Fry M.J. Panayotou G. Das P. Truong O. Totty N.F. Husan J. Booker G.W. Campbell I.D. Waterfield M.D. Cell. 1993; 75: 25-36Abstract Full Text PDF PubMed Scopus (485) Google Scholar, 8Herskovits J.S. Burgess C.C. Obar R.A. Vallee R.B. J. Cell Biol. 1993; 122: 565-578Crossref PubMed Scopus (398) Google Scholar, 9Damke H. Baba T. Warnock D.E. Schmid S.L. J. Cell Biol. 1994; 127: 915-934Crossref PubMed Scopus (1046) Google Scholar, 10Hinshaw J.E. Schmid S.L. Nature. 1995; 374: 190-192Crossref PubMed Scopus (665) Google Scholar, 11Takei K. McPherson P.S. Schmid S.L. De Camilli P. Nature. 1995; 374: 186-190Crossref PubMed Scopus (657) Google Scholar, 12Sever S. Damke H. Schmid S.L. J. Cell Biol. 2000; 150: 1137-1148Crossref PubMed Scopus (196) Google Scholar). From these numerous studies, dynamin I has been shown to function as a mechanochemical enzyme that pinches off the neck of invaginated membranes, thereby releasing the budding membrane as a vesicle (10Hinshaw J.E. Schmid S.L. Nature. 1995; 374: 190-192Crossref PubMed Scopus (665) Google Scholar, 11Takei K. McPherson P.S. Schmid S.L. De Camilli P. Nature. 1995; 374: 186-190Crossref PubMed Scopus (657) Google Scholar, 13Takei K. Haucke V. Slepnev V. Farsad K. Salazar M. Chen H. De Camilli P. Cell. 1998; 94: 131-141Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar). Unlike the dynamin I protein, which is involved in endocytosis in animal cells, other members of the dynamin family have been proposed to play roles in other biological processes, such as maintenance of mitochondrial morphology (14Mozdy A.D. McCaffery J.M. Shaw J.M. J. Cell Biol. 2000; 151: 367-380Crossref PubMed Scopus (542) Google Scholar, 15Fukushima N.H. Brisch E. Keegan B.R. Bleazard W. Shaw J.M. Mol. Biol. Cell. 2001; 12: 2756-2766Crossref PubMed Scopus (83) Google Scholar, 16Arimura Si S. Tsutsumi N. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5727-5731Crossref PubMed Scopus (161) Google Scholar), cell plate formation in plant cells (5Gu X. Verma D.P.S. EMBO J. 1996; 15: 695-704Crossref PubMed Scopus (141) Google Scholar), thylakoid membrane biogenesis (17Park J.M. Cho J.H. Kang S.G. Jang H.J. Pih K.T. Piao H.L. Cho M.J. Hwang I. EMBO J. 1998; 17: 859-867Crossref PubMed Scopus (50) Google Scholar), and vacuolar trafficking of proteins at the trans-Golgi network (TGN)1 (18Jin J.B. Kim Y.A Kim S.J. Lee S.H. Kim D.H. Cheong G.W. Hwang I. Plant Cell. 2001; 13: 1511-1526Crossref PubMed Scopus (304) Google Scholar). Although the exact mechanism of action of these proteins remains to be elucidated, they appear to be involved in various biological processes, including the modulation of membrane structures such as membrane fission (19Yoon Y. Pitts K.R. McNiven M.A. Mol. Biol. Cell. 2001; 12: 2894-2905Crossref PubMed Scopus (242) Google Scholar). To modulate membrane structure, these proteins must be able to bind to membranes. The membrane association of dynamin I has been shown to be mediated by the PH domain of the protein that binds specifically to phosphatidylinositol 4,5-bisphosphate (PtdIns-4,5-P2) (20Salim K. Bottomley M.J Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Crossref PubMed Scopus (495) Google Scholar,21Achiriloaie M. Barylko B. Albanesi J.P. Mol. Cell. Biol. 1999; 19: 1410-1415Crossref PubMed Scopus (145) Google Scholar). Also, other members of the dynamin family, such asArabidopsis dynamin-like 1 (ADL1), ADL2, and phragmoplastin also have been shown to bind to membranes in vivo (22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 23Gu X. Verma D.P. Plant Cell. 1997; 9: 157-169Crossref PubMed Scopus (118) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar). Among these, ADL2 has been shown to bind specifically to PtdIns-4-Pin vitro (24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar). However, except for dynamin I, the nature of membrane association of dynamin-related proteins is unclear because the PH domain is apparently absent from certain members of the dynamin family, such as Vsp1p and ADL2 (2Rothman J.H. Raymond C.K. Gilbert T. O'Hara P.J. Stevens T.H. Cell. 1990; 61: 1063-1074Abstract Full Text PDF PubMed Scopus (214) Google Scholar, 6Kang S.G. Jin J.B. Piao H.L. Pih K.T. Jang H.J. Lim J.H. Hwang I. Plant Mol. Biol. 1998; 38: 437-447Crossref PubMed Scopus (52) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar). Another important biochemical characteristic of these proteins for their role in membrane modulation is high molecular weight complex formation (10Hinshaw J.E. Schmid S.L. Nature. 1995; 374: 190-192Crossref PubMed Scopus (665) Google Scholar, 22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar, 25Shin H.W. Takatsu H. Mukai H. Munekata E. Murakami K. Nakayama K. J. Biol. Chem. 1999; 274: 2780-2785Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 26Zhang Z. Hong Z. Verma D.P. J. Biol. Chem. 2000; 275: 8779-8784Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). These proteins have been shown to self-assemble into a homopolymeric form through the intermolecular interaction between self-assembly domains (25Shin H.W. Takatsu H. Mukai H. Munekata E. Murakami K. Nakayama K. J. Biol. Chem. 1999; 274: 2780-2785Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 26Zhang Z. Hong Z. Verma D.P. J. Biol. Chem. 2000; 275: 8779-8784Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 27Smirnova E. Shurland D.L. Newman-Smith E.D. Pishvaee B. van der Bliek A.M. J. Biol. Chem. 1999; 274: 14942-14947Abstract Full Text Full Text PDF PubMed Scopus (116) Google Scholar). Previously, we have shown that ADL6 is localized to the TGN and involved in trafficking of cargo proteins from the TGN to the central vacuole in Arabidopsis (18Jin J.B. Kim Y.A Kim S.J. Lee S.H. Kim D.H. Cheong G.W. Hwang I. Plant Cell. 2001; 13: 1511-1526Crossref PubMed Scopus (304) Google Scholar). To further understand the role of ADL6 in vivo, we characterized the nature of its interaction with membranes. In this study, we present evidence that ADL6 binds to phosphatidylinositol 3-phosphate with high affinity and that the lipid binding specificity of the PH domain is determined through an intermolecular interaction between the PH domain and the C-terminal domain (CTD). Arabidopsis thaliana (ecotype Columbia) was grown in a greenhouse under a 16/8 h light/dark cycle at a temperature of 20 °C and relative humidity of 70%. Also, plants were grown on Murashige and Skoog plates in a growth chamber at 20 °C with a 16/8 h light/dark cycle. The PH domain of ADL6 (amino acid residues 558–759) was amplified by the polymerase chain reaction using two specific primers (GAGACGCCGGAGGTCTCTGG and GGATCCGAACAACAGCCTTTGG). To generate the 1877 mutant containing the PH domain and the C-terminal domain (amino acid residues 558–914), a DNA fragment was amplified by two specific primers (GAGACGCCGGAGGTCTCTGG and ATACCTGTAAGCTGAACC). The CTD of ADL6 (amino acid residues 760–914) was PCR-amplified using two specific primers, TGTCAAGTAGAGAAAGCAAA and ATACCTGTAAGCTGAACC. To generate PHD(ΔI1), N- and C-terminal regions of the PH domain were amplified using two sets of primers: GAGACGCCGGAGGTCTCTGG and AATAGTGCATTCCTCC and AAGGACCAGGCCTTGT and GGATCCGAACAACAGCCTTTGG, respectively, and the resulting fragments were ligated. Similarly, the N- and C-terminal regions of PHD(ΔI2) were amplified using two sets of primers: GAGACGCCGGAGGTCTCTGG and AAGGGCATTGTGAGCTT and AACGAGTGGATTAATA and GGATCCGAACAACAGCCTTTGG, respectively. The N- and C-terminal regions of PHD(ΔI3) were PCR-amplified using two sets of primers: GAGACGCCGGAGGTCTCTGG and tccacgagcctggat and GGATCCGAACAACAGCCTTTGG and CCAGAAGAGGAGCTC, respectively. The N- and C-terminal fragments for PHD(ΔI1), PHD(ΔI2) and PHD(ΔI3) were then ligated. DNA fragments encoding all the deletion mutants and the full-length ADL6 were ligated in-frame with the maltose-binding protein (MBP) at the XbaI and EcoRI sites of pMAL-c2 (New England Biolabs, Beverly, MA). Also, DNA encoding these deletion mutants was ligated to pGEX-5X-1 (Amersham Biosciences) to generate glutathione S-transferase (GST) fusion proteins. To express MBP or GST fusion proteins, the expression constructs were introduced into JM109. Expression of recombinant proteins was induced with 0.3 mmisopropyl-d-thiogalactopyranoside for 4 h at 28 °C or for 1 h at 37 °C. The cultures were harvested by centrifugation at 5,000 × g for 5 min at 4 °C. The pellets were resuspended in ice-cold resuspension buffer (20 mm Tris-HCl, pH 7.4, 200 mm NaCl, 1 mm EDTA, 1 mm dithiothreitol, and 1 mm phenylmethylsulfonyl fluoride) containing protease inhibitors (1 μg/ml aprotinin, 1 μg/ml antipain) and sonicated with 30-s bursts at a maximal setting at 4 °C. Cell debris was then removed by centrifugation at 18,000 × g for 15 min at 4 °C. For purification of recombinant proteins, cleared supernatant was incubated with 1/100 volume of pre-equilibrated glutathione-Sepharose beads (for GST fusions) or amylose resin (for MBP fusions) on an orbital shaker for 30 min at 4 °C. The beads were collected by centrifugation at 1,000 × g for 1 min and washed three times with ice-cold suspension buffer. The fusion proteins were eluted by adding 5 mm glutathione, 50 mm Tris-HCl, pH 8.0 (for GST fusions), or 10 mm maltose, 50 mmTris-HCl, pH 8.0 (for MBP fusions). Various lipids, such as phosphatidylethanolamine (PE), phosphatidylcholine (PC), PtdIns, PtdIns-4-P, phosphatidylinositol 4,5-bisphosphate (PtdIns-4,5-P2), PtdIns-3-P, phosphatidylinositol 3,4-bisphosphate (PtdIns-3,4-P2), and phosphatidylinositol 3,4,5-trisphosphate (PtdIns-3,4,5-P3), were used for lipid binding analysis. The lipid binding assays were done by Fat Western blot analysis (24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar, 28Stevenson J.M. Perera I.Y. Boss W.F. J. Biol. Chem. 1998; 273: 22761-22767Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar) using affinity-purified recombinant proteins. Briefly, 10-μl volumes of various concentrations of lipids dissolved in chloroform were applied to nitrocellulose membranes. The membranes were blocked with 10 ml of buffer containing 20 mmTris-HCl, pH 7.5, 140 mm NaCl, and 0.1% Tween 20 (TTBS) overnight at 4 °C and then incubated with 0.5 μg/ml purified recombinant protein in 10 ml of TTBS containing 3% fatty acid-free bovine serum albumin for 1 h at room temperature. After washing three times with TTBS, the blot was incubated with the primary antibody for 1 h at room temperature and washed three times for 20 min each time. A secondary antibody was then incubated and washed under the same conditions as the primary antibody. The ECL detection system was used for visualization (Amersham Biosciences). Purified proteins were dialyzed against HP buffer (10 mm Hepes, pH 7.5, 1 mmdithiothreitol, 1 mm MgCl2, 1 mmEGTA, 1 mm phenylmethylsulfonyl fluoride) containing 100 mm NaCl and then centrifuged at 18,000 × gfor 15 min to remove aggregated proteins. Liposomes were prepared by mixing phosphatidylcholine, phosphatidylethanolamine, phosphatidylinositol, PtdIns-3-P, and PtdIns-4-P at the ratio indicated in each experiment, drying the mixture under nitrogen, and resuspending to a final concentration of 2 mg of total phospholipid/ml buffer containing 50 mm Hepes-NaOH (pH 7.4), 100 mm NaCl, and 0.5 mm EDTA (29Patki V. Virbasius J. Lane W.S. Toh B.H. Shpetner H.S. Corvera S. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7326-7330Crossref PubMed Scopus (203) Google Scholar). The resuspended lipids were sonicated until a homogenous suspension was formed. Liposomes were collected by centrifugation at 16,000 ×g for 10 min. Liposome (50 μl) was mixed with proteins (5 μg in 50 μl in the same buffer) and incubated for 15 min at room temperature. Proteins bound to the liposomes were sedimented by centrifugation at 16,000 × g for 30 min. Proteins present in the pellet and supernatant were fractionated by SDS-PAGE and the presence of MBP fusion proteins was detected by Western blot analysis using anti-MBP antibody. For GST pull-down assays, cleared supernatant containing 10 μg of recombinant GST fusion proteins and cleared supernatant containing 20 μg of MBP fusion proteins were mixed in 10 ml of protein pull-down buffer (20 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1 mm EDTA, 1 mm EGTA, 1 mm dithiothreitol, 0.2% Triton X-100, 0.1% Nonidet P-40) and incubated with agitation at 4 °C for 1 h with glutathione-Sepharose beads. The beads were then pelleted by centrifugation at 2,000 × g for 1 min at 4 °C and washed four times with protein pull-down buffer. The bound proteins were eluted, fractionated by 10% SDS-PAGE, and subjected to Western blot analysis using an anti-MBP antibody. ADL6 is a homolog of the mechanochemical protein dynamin and has been shown to be involved in intracellular trafficking of cargo proteins from the trans-Golgi network to the central vacuole (18Jin J.B. Kim Y.A Kim S.J. Lee S.H. Kim D.H. Cheong G.W. Hwang I. Plant Cell. 2001; 13: 1511-1526Crossref PubMed Scopus (304) Google Scholar). As in the case of other members of the dynamin family (20Salim K. Bottomley M.J Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Crossref PubMed Scopus (495) Google Scholar, 22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar,24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar), it is likely that ADL6 is associated with membranes. To enhance our understanding of the molecular mechanism by which ADL6 plays a rolein vivo, we investigated the nature of membrane association of ADL6. First we investigated the subcellular distribution of ADL6in vivo by ultracentrifugation through a sucrose gradient. As shown in Fig. 1, the majority of ADL6 was found in the region of 37–41% sucrose, indicating that ADL6 may be associated with membranes, as in the case of dynamin and its related proteins (20Salim K. Bottomley M.J Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Crossref PubMed Scopus (495) Google Scholar, 22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar). To further confirm that ADL6 is associated with membranes, total protein extracts were treated with Triton X-100 and then fractionated in a continuous sucrose gradient by ultracentrifugation. The presence of ADL6 in these fractions was examined by Western blot analysis. As shown in Fig. 1A, ADL6 was detected in the region of 30–37% sucrose in the gradient after treatment with Triton X-100, compared with 37–41% sucrose in the gradient without Triton X-100 treatment. Interestingly, the behavior of ADL6 in the sucrose gradient was rather unusual. When protein extracts treated with Triton X-100, an agent that can solubilize membranes, are fractionated in a sucrose gradient by ultracentrifugation, membrane proteins are found at the top fractions (the soluble fractions) in the sucrose gradient. However, in contrast to this notion, ADL6 was detected in the region of 30–37% sucrose of the gradient after Triton X-100 treatment but not at the top of the gradient. The behavior of ADL6 was quite similar to ADL1 and ADL2 found in plant cells (22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar,30Warnock D.E. Hinshaw J.E. Schmid S.L. J. Biol. Chem. 1996; 271: 22310-22314Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). The fact that ADL6 migrated at the low percentage of sucrose in the gradient strongly suggests that Triton X-100 may have removed membranes associated with ADL6. At the same time, the fact that it did not migrate at the top of the gradient (soluble fraction) after Triton X-100 treatment suggests that ADL6 may be present as a high molecular weight complex as in the case of dynamin and ADL isoforms (22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar, 30Warnock D.E. Hinshaw J.E. Schmid S.L. J. Biol. Chem. 1996; 271: 22310-22314Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). Previously, it was shown that ADL1 and other dynamin-related proteins are found as high molecular weight complexes (22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar, 30Warnock D.E. Hinshaw J.E. Schmid S.L. J. Biol. Chem. 1996; 271: 22310-22314Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). Thus, ADL6 may also be present as a high molecular weight complex. To examine this possibility, we performed a gel filtration assay using protein extracts obtained from leaf tissues. As shown in Fig. 1B, ADL6 was found in two positions. The first peak was eluted much earlier than the rubisco complex (560 kDa), whereas the other eluted at a position corresponding to an ADL6 dimer (200 kDa). When protein extracts were treated with Triton X-100, the first peak of ADL6 was eluted in later fractions, whereas the second peak was at the same dimer position, indicating that Triton X-100 treatment may have removed membranes associated with ADL6 present in the first peak. These results strongly support the notion that ADL6 may be a high molecular weight complex in vivo, as in the case of dynamin, ADL1, and ADL2 (22Park J.M. Kang S.G. Pih K.T. Jang H.J. Piao H.L. Yoon H.W. Cho M.J. Hwang I. Plant Physiol. 1997; 115: 763-771Crossref PubMed Scopus (40) Google Scholar, 24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar, 30Warnock D.E. Hinshaw J.E. Schmid S.L. J. Biol. Chem. 1996; 271: 22310-22314Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar). In the case of dynamin, the PH domain shows high affinity binding to phosphatidylinositol phosphates such as phosphatidylinositol 4,5-bisphosphate PtdIns-4,5-P2 (20Salim K. Bottomley M.J Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Crossref PubMed Scopus (495) Google Scholar, 21Achiriloaie M. Barylko B. Albanesi J.P. Mol. Cell. Biol. 1999; 19: 1410-1415Crossref PubMed Scopus (145) Google Scholar). Also, ADL2 has been shown to bind to phosphatidylinositol 4-phosphate (PtdIns-4-P) (24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar). Binding to these phospholipids by the PH domain or similar lipid-binding domains is thought to allow the proteins with these domains to associate with membranes. Thus, to further understand the nature of the membrane association of ADL6, we wanted to investigate whether ADL6 also binds to any of these phospholipids. To address this question, we prepared recombinant ADL6 protein from Escherichia coli as a MBP fusion protein. MBP:ADL6 was affinity-purified using amylose resin beads and used for lipid binding assays (Fig. 2) (24Kim Y.W. Park D.S. Park S.C. Kim S.H. Cheong G.W. Hwang I. Plant Physiol. 2001; 127: 1243-1255Crossref PubMed Scopus (49) Google Scholar, 28Stevenson J.M. Perera I.Y. Boss W.F. J. Biol. Chem. 1998; 273: 22761-22767Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). MBP:PHD(PLC-δ), which shows a high affinity binding to PtdIns-4,5-P2 (31Garcia P. Gupta R. Shah S. Morris A.J. Rudge S.A. Scarlata S. Petrova V. McLaughlin S. Rebecchi M.J. Biochemistry. 1995; 34: 16228-16234Crossref PubMed Scopus (255) Google Scholar), was expressed and purified for use as a positive control for the lipid binding assays. In addition, MBP alone was included as a negative control. Among various phospholipid molecules examined, MBP:ADL6 showed high affinity binding to PtdIns-3-P by Fat Western blot analysis (Fig. 3). As expected, PHD(PLC-δ) showed a high affinity interaction with PtdIns-4,5-P2 when used as a MBP fusion protein (31Garcia P. Gupta R. Shah S. Morris A.J. Rudge S.A. Scarlata S. Petrova V. McLaughlin S. Rebecchi M.J. Biochemistry. 1995; 34: 16228-16234Crossref PubMed Scopus (255) Google Scholar). In contrast, the negative control MBP did not show binding to any of these phospholipids. These results strongly suggest that ADL6 binds specifically to PtdIns-3-P.FIG. 3ADL6 shows a high affinity binding to PtdIns-3-P. The phospholipid binding assay was carried out using the purified recombinant proteins, MBP·ADL6 (a), MBP (b), and MBP·PHD(PLC-δ) (c), as described under “Experimental Procedures.” Binding of the recombinant proteins to the lipid was detected by Western blot analysis using the polyclonal anti-MBP antibody as the primary antibody. PC, phosphatidylcholine; PE, phosphatidylethanolamine;PI, phosphatidylinositol; 3P, phosphatidylinositol 3-phosphate; 4P, phosphatidylinositol 4-phosphate; 3,4P, phosphatidylinositol 3,4-bisphosphate;3,5P, phosphatidylinositol 3,5-bisphosphate;4,5P, phosphatidylinositol 4,5-bisphosphate;3,4,5P, phosphatidylinositol 3,4,5-trisphosphate.View Large Image Figure ViewerDownload (PPT) To enhance our understanding of the lipid binding of ADL6, we wanted to investigate which region of ADL6 is responsible for binding to PtdIns-3-P. We first compared the amino acid sequence of ADL6 to other members of the dynamin family. Amino acid sequence analysis using Blastp from the NCBI server suggested that ADL6 has a PH domain (data not shown). In addition, as shown in Fig.4, the region from amino acid residues 558–759 showed a significant degree of amino acid sequence homology to the PH domains of various proteins. Similar to the PH domains of other proteins, this region was predicted to consist of 7 β-sheets followed by an α-helix (20Salim K. Bottomley M.J Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Crossref PubMed Scopus (495) Google Scholar, 32Soisson S.M. Nimnual A.S. Uy M. Bar-Sagi D. Kuriyan J. Cell. 1988; 16: 259-268Google Scholar) using the protein secondary structure prediction program of the ExPASy Molecular Biology Server. However, the PH domain of ADL6 was slightly larger than the PH domain found in dynamin I and phospholipase C-δ. Amino acid sequence alignment of these PH domains revealed that the PH domain of ADL6 has additional amino acids inserted between the β-sheet structures in the PH domain (Fig. 4). With this information, several deletion mutants were generated, as shown in Fig. 5A, and expressed as MBP fusion proteins, as shown in Fig. 2. Using these recombinant proteins, the lipid binding assay was performed. As in the case of the full-length ADL6 protein, fusion proteins with the PH domain bound to PtdIns-3-P (Fig. 5B). However, interestingly, the fusion protein between MBP and the PH domain (MBP:PHD) showed a slightly different binding pattern than the full-length ADL6 protein (Fig. 6, PHD). The wild-type ADL6 and 1877 showed ∼4-fold higher binding affinity to PtdIns-3-P than to PtdIns-4-P (Fig. 5C). In contrast, as shown in Fig. 5, B and C, the PH domain alone showed nearly equal binding affinity to both PtdIns-3-P and PtdIns-4-P. In addition, the binding affinity of MBP:PHD to these lipids was lower than that of the full-length ADL6. Thus, these results suggest two points: 1) the PH domain is responsible for the binding of ADL6 to phospholipids and 2) the lipid binding specificity of the PH domain is different from that of ADL6. This is quite unexpected because in most cases the PH domain alone is responsible for phospholipid binding (20Salim K. Bottomley M.J Querfurth E. Zvelebil M.J. Gout I. Scaife R. Margolis R.L. Gigg R. Smith C.I. Driscoll P.C. Waterfield M.D. Panayotou G. EMBO J. 1996; 15: 6241-6250Crossref PubMed Scopus (495) Google Scholar). To further confirm the lipid binding of ADL6" @default.
• W2017772012 created "2016-06-24" @default.
• W2017772012 creator A5021781137 @default.
• W2017772012 creator A5033446344 @default.
• W2017772012 creator A5037553901 @default.
• W2017772012 creator A5072118184 @default.
• W2017772012 creator A5083020137 @default.
• W2017772012 creator A5084449471 @default.
• W2017772012 creator A5085510614 @default.
• W2017772012 date "2002-08-01" @default.
• W2017772012 modified "2023-09-30" @default.
• W2017772012 title "The Intermolecular Interaction between the PH Domain and the C-terminal Domain of Arabidopsis Dynamin-like 6 Determines Lipid Binding Specificity" @default.
• W2017772012 cites W107621778 @default.
• W2017772012 cites W1566581202 @default.
• W2017772012 cites W1857386042 @default.
• W2017772012 cites W1967965496 @default.
• W2017772012 cites W1970909818 @default.
• W2017772012 cites W1978627586 @default.
• W2017772012 cites W1990134601 @default.
• W2017772012 cites W1994063020 @default.
• W2017772012 cites W1997784032 @default.
• W2017772012 cites W1999079263 @default.
• W2017772012 cites W2000426427 @default.
• W2017772012 cites W2006416359 @default.
• W2017772012 cites W2013112818 @default.
• W2017772012 cites W2018032056 @default.
• W2017772012 cites W2022658714 @default.
• W2017772012 cites W2026740840 @default.
• W2017772012 cites W2031234701 @default.
• W2017772012 cites W2037956598 @default.
• W2017772012 cites W2039873071 @default.
• W2017772012 cites W2040987875 @default.
• W2017772012 cites W2042438158 @default.
• W2017772012 cites W2042776102 @default.
• W2017772012 cites W2044005459 @default.
• W2017772012 cites W2054922048 @default.
• W2017772012 cites W2060934876 @default.
• W2017772012 cites W2070634601 @default.
• W2017772012 cites W2078748790 @default.
• W2017772012 cites W2082186646 @default.
• W2017772012 cites W2082530736 @default.
• W2017772012 cites W2082688327 @default.
• W2017772012 cites W2092081030 @default.
• W2017772012 cites W2093139459 @default.
• W2017772012 cites W2101693034 @default.
• W2017772012 cites W2108264768 @default.
• W2017772012 cites W2124540225 @default.
• W2017772012 cites W2125206853 @default.
• W2017772012 cites W2132021366 @default.
• W2017772012 cites W2137521656 @default.
• W2017772012 cites W2141345634 @default.
• W2017772012 cites W2149897005 @default.
• W2017772012 cites W2152928502 @default.
• W2017772012 cites W2153507794 @default.
• W2017772012 cites W2157510237 @default.
• W2017772012 cites W2162446789 @default.
• W2017772012 cites W4231183555 @default.
• W2017772012 cites W4376453135 @default.
• W2017772012 cites W50192545 @default.
• W2017772012 doi "https://doi.org/10.1074/jbc.m204770200" @default.
• W2017772012 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12105222" @default.
• W2017772012 hasPublicationYear "2002" @default.
• W2017772012 type Work @default.
• W2017772012 sameAs 2017772012 @default.
• W2017772012 citedByCount "33" @default.
• W2017772012 countsByYear W20177720122012 @default.
• W2017772012 countsByYear W20177720122013 @default.
• W2017772012 countsByYear W20177720122014 @default.
• W2017772012 countsByYear W20177720122015 @default.
• W2017772012 countsByYear W20177720122017 @default.
• W2017772012 countsByYear W20177720122018 @default.
• W2017772012 countsByYear W20177720122019 @default.
• W2017772012 countsByYear W20177720122022 @default.
• W2017772012 crossrefType "journal-article" @default.
• W2017772012 hasAuthorship W2017772012A5021781137 @default.
• W2017772012 hasAuthorship W2017772012A5033446344 @default.
• W2017772012 hasAuthorship W2017772012A5037553901 @default.
• W2017772012 hasAuthorship W2017772012A5072118184 @default.
• W2017772012 hasAuthorship W2017772012A5083020137 @default.
• W2017772012 hasAuthorship W2017772012A5084449471 @default.
• W2017772012 hasAuthorship W2017772012A5085510614 @default.
• W2017772012 hasBestOaLocation W20177720121 @default.
• W2017772012 hasConcept C104317684 @default.
• W2017772012 hasConcept C12554922 @default.
• W2017772012 hasConcept C134306372 @default.
• W2017772012 hasConcept C143065580 @default.
• W2017772012 hasConcept C156407911 @default.
• W2017772012 hasConcept C166950319 @default.
• W2017772012 hasConcept C170493617 @default.
• W2017772012 hasConcept C178790620 @default.
• W2017772012 hasConcept C185592680 @default.
• W2017772012 hasConcept C2779491563 @default.
• W2017772012 hasConcept C2779664074 @default.
• W2017772012 hasConcept C28005876 @default.
• W2017772012 hasConcept C32909587 @default.
• W2017772012 hasConcept C33923547 @default.
• W2017772012 hasConcept C36503486 @default.
• W2017772012 hasConcept C41008148 @default.

• next