FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2017918095> ?p ?o ?g. }

• W2017918095 endingPage "49750" @default.
• W2017918095 startingPage "49743" @default.
• W2017918095 abstract "Heat shock results in inhibition of general protein synthesis. In thermotolerant cells, protein synthesis is still rapidly inhibited by heat stress, but protein synthesis recovers faster than in naive heat-shocked cells, a phenomenon known as translational thermotolerance. Here we investigate the effect of overexpressing a single heat shock protein on cap-dependent and cap-independent initiation of translation during recovery from a heat shock. When overexpressing αB-crystallin or Hsp27, cap-dependent initiation of translation was protected but no effect was seen on cap-independent initiation of translation. When Hsp70 was overexpressed however, both cap-dependent and -independent translation were protected. This finding indicates a difference in the mechanism of protection mediated by small or large heat shock proteins. Phosphorylation of αB-crystallin and Hsp27 is known to significantly decrease their chaperone activity; therefore, we tested phosphorylation mutants of these proteins in this system. αB-crystallin needs to be in its non-phosphorylated state to give protection, whereas phosphorylated Hsp27 is more potent in protection than the unphosphorylatable form. This indicates that chaperone activity is not a prerequisite for protection of translation by small heat shock proteins after heat shock. Furthermore, we show that in the presence of 2-aminopurine, an inhibitor of kinases, among which is double-stranded RNA-activated kinase, the protective effect of overexpressing αB-crystallin is abolished. The synthesis of the endogenous Hsps induced by the heat shock to test for thermotolerance is also blocked by 2-aminopurine. Most likely the protective effect of αB-crystallin requires synthesis of the endogenous heat shock proteins. Translational thermotolerance would then be a co-operative effect of different heat shock proteins. Heat shock results in inhibition of general protein synthesis. In thermotolerant cells, protein synthesis is still rapidly inhibited by heat stress, but protein synthesis recovers faster than in naive heat-shocked cells, a phenomenon known as translational thermotolerance. Here we investigate the effect of overexpressing a single heat shock protein on cap-dependent and cap-independent initiation of translation during recovery from a heat shock. When overexpressing αB-crystallin or Hsp27, cap-dependent initiation of translation was protected but no effect was seen on cap-independent initiation of translation. When Hsp70 was overexpressed however, both cap-dependent and -independent translation were protected. This finding indicates a difference in the mechanism of protection mediated by small or large heat shock proteins. Phosphorylation of αB-crystallin and Hsp27 is known to significantly decrease their chaperone activity; therefore, we tested phosphorylation mutants of these proteins in this system. αB-crystallin needs to be in its non-phosphorylated state to give protection, whereas phosphorylated Hsp27 is more potent in protection than the unphosphorylatable form. This indicates that chaperone activity is not a prerequisite for protection of translation by small heat shock proteins after heat shock. Furthermore, we show that in the presence of 2-aminopurine, an inhibitor of kinases, among which is double-stranded RNA-activated kinase, the protective effect of overexpressing αB-crystallin is abolished. The synthesis of the endogenous Hsps induced by the heat shock to test for thermotolerance is also blocked by 2-aminopurine. Most likely the protective effect of αB-crystallin requires synthesis of the endogenous heat shock proteins. Translational thermotolerance would then be a co-operative effect of different heat shock proteins. Cells facing stress divert their resources to combating and surviving that stress. For example, during a heat shock, general macromolecular synthesis and processing is inhibited, and the set of transcription units that encode the heat shock proteins (Hsps) 1The abbreviations used are: Hspheat shock proteinsHspsmall heat shock proteinseIF2αeukaryotic initiation factor 2αSGstress granulesRT-PCRreverse transcriptase-PCRDMEMDulbecco's modified Eagle's mediumPKRdouble-stranded RNA-activated kinaseIRESinternal ribosome entry siteFGFfibroblast growth factor. is activated (1.Laszlo A. Exp. Cell Res. 1988; 178: 401-414Crossref PubMed Scopus (71) Google Scholar, 2.Brostrom C.O. Brostrom M.A. Prog. Nucleic Acid Res. Mol. Biol. 1998; 58: 79-125Crossref PubMed Scopus (250) Google Scholar). Synthesis of the Hsps is required for optimal survival of heat (or other) stress. The Hsps are a complex group of proteins, ranging in size between 90 and 20 kDa. The small heat shock proteins (sHsps) belong to a family of proteins distinguished by sharing a common protein domain, the so-called α-crystallin domain (for review, see Ref. 3.de Jong W.W. Leunissen J.A. Voorter C.E. Mol. Biol. Evol. 1993; 10: 103-126PubMed Google Scholar). In man, there are 10 different sHsps (4.Kappé G. Franck E. Verschuure P. Boelens W.C. Leunissen J.A.M. de Jong W.W. Cell Stress Chaperones. 2003; 8: 53-61Crossref PubMed Scopus (383) Google Scholar); of these, Hsp27 and αB-crystallin are traditional heat shock proteins in the sense that their synthesis is induced by a heat shock (5.Kato K. Ito H. Inaguma Y. Prog. Mol. Subcell. Biol. 2002; 28: 129-150Crossref PubMed Scopus (28) Google Scholar). All sHsps, including the stress-inducible sHsps, are constitutively expressed in different tissues; αB-crystallin, for example, is abundant in lens, heart, skeletal muscle, and brain (5.Kato K. Ito H. Inaguma Y. Prog. Mol. Subcell. Biol. 2002; 28: 129-150Crossref PubMed Scopus (28) Google Scholar, 6.Van Montfort R. Slingsby C. Vierling E. Adv. Protein Chem. 2001; 59: 105-156Crossref PubMed Scopus (386) Google Scholar, 7.Davidson S.M. Loones M.T. Duverger O. Morange M. Prog. Mol. Subcell. Biol. 2002; 28: 103-128Crossref PubMed Scopus (22) Google Scholar). The best known property of Hsp27 and of αB-crystallin is their in vitro chaperone activity: they keep their substrates in solution but cannot refold them (for review, see Refs. 6.Van Montfort R. Slingsby C. Vierling E. Adv. Protein Chem. 2001; 59: 105-156Crossref PubMed Scopus (386) Google Scholar and 8.Narberhaus F. Microbiol. Mol. Biol. Rev. 2002; 66: 64-93Crossref PubMed Scopus (470) Google Scholar). In vivo, they might act as a reservoir of unfolded proteins for the large Hsps, which are ATP-dependent refoldases. The sHsps are also thought to stabilize the cytoskeleton during stress (9.Quinlan R. Prog. Mol. Subcell. Biol. 2002; 28: 219-233Crossref PubMed Scopus (77) Google Scholar); in addition, they interact with some components of the apoptotic pathway, thereby protecting the cell from apoptosis (10.Arrigo A.P. Paul C. Ducasse C. Manero F. Kretz-Remy C. Virot S. Javouhey E. Mounier N. Diaz-Latoud C. Prog. Mol. Subcell. Biol. 2002; 28: 185-204Crossref PubMed Scopus (55) Google Scholar). heat shock protein small heat shock proteins eukaryotic initiation factor 2α stress granules reverse transcriptase-PCR Dulbecco's modified Eagle's medium double-stranded RNA-activated kinase internal ribosome entry site fibroblast growth factor. sHsps can be regulated in their activity by phosphorylation. αB-crystallin has three phosphorylation sites. Serine 59 is phosphorylated when cells are stressed, and serines 19 and 45 are found phosphorylated when cells are going into mitosis (11.Hoover H.E. Thuerauf D.J. Martindale J.J. Glembotski C.C. J. Biol. Chem. 2000; 275: 23825-23833Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 12.Kato K. Ito H. Kamei K. Inaguma Y. Iwamoto I. Saga S. J. Biol. Chem. 1998; 273: 28346-28354Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar). The overall level of phosphorylation of αB-crystallin remains low (13.Ito H. Okamoto K. Nakayama H. Isobe T. Kato K. J. Biol. Chem. 1997; 272: 29934-29941Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar). Hsp27 has two (rodents) or three (man) phosphorylation sites. At normal temperature, Hsp27 is mainly unphosphorylated: after different kinds of stress, including heat shock, Hsp27 is extensively phosphorylated (5.Kato K. Ito H. Inaguma Y. Prog. Mol. Subcell. Biol. 2002; 28: 129-150Crossref PubMed Scopus (28) Google Scholar, 14.Gaestel M. Prog. Mol. Subcell. Biol. 2002; 28: 151-169Crossref PubMed Scopus (40) Google Scholar). For Hsp27 and αB-crystallin, phosphorylation has been shown to prevent complex formation in vitro (15.Lambert H. Charette S.J. Bernier A.F. Guimond A. Landry J. J. Biol. Chem. 1999; 274: 9378-9385Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 16.Rogalla T. Ehrnsperger M. Preville X. Kotlyarov A. Lutsch G. Ducasse C. Paul C. Wieske M. Arrigo A.P. Buchner J. Gaestel M. J. Biol. Chem. 1999; 274: 18947-18956Abstract Full Text Full Text PDF PubMed Scopus (625) Google Scholar, 17.Ito H. Kamei K. Iwamoto I. Inaguma Y. Nohara D. Kato K. J. Biol. Chem. 2001; 276: 5346-5352Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar), resulting in significant decrease in chaperone activity (16.Rogalla T. Ehrnsperger M. Preville X. Kotlyarov A. Lutsch G. Ducasse C. Paul C. Wieske M. Arrigo A.P. Buchner J. Gaestel M. J. Biol. Chem. 1999; 274: 18947-18956Abstract Full Text Full Text PDF PubMed Scopus (625) Google Scholar, 17.Ito H. Kamei K. Iwamoto I. Inaguma Y. Nohara D. Kato K. J. Biol. Chem. 2001; 276: 5346-5352Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 18.Kamei A. Hamaguchi T. Matsuura N. Masuda K. Biol. Pharm. Bull. 2001; 24: 96-99Crossref PubMed Scopus (37) Google Scholar). Phosphorylation-mimicked Hsp27 protects cells from heat stress but not from oxidative stress (16.Rogalla T. Ehrnsperger M. Preville X. Kotlyarov A. Lutsch G. Ducasse C. Paul C. Wieske M. Arrigo A.P. Buchner J. Gaestel M. J. Biol. Chem. 1999; 274: 18947-18956Abstract Full Text Full Text PDF PubMed Scopus (625) Google Scholar, 19.Geum D. Son G.H. Kim K. J. Biol. Chem. 2002; 277: 19913-19921Abstract Full Text Full Text PDF PubMed Scopus (112) Google Scholar, 20.Arrigo A.P. Paul C. Ducasse C. Sauvageot O. Kretz-Remy C. Prog. Mol. Subcell. Biol. 2002; 28: 171-184Crossref PubMed Scopus (32) Google Scholar). Cells having a full complement of Hsps because of an earlier stress are more resistant to subsequent heat stress, a phenomenon known as thermotolerance. Thermotolerance can be induced by expression of a single Hsp, such as Hsp70, Hsp27, or αB-crystallin (21.Carper S.W. Rocheleau T.A. Cimino D. Storm F.K. J. Cell. Biochem. 1997; 66: 153-164Crossref PubMed Scopus (31) Google Scholar, 22.Lavoie J.N. Gingras-Breton G. Tanguay R.M. Landry J. J. Biol. Chem. 1993; 268: 3420-3429Abstract Full Text PDF PubMed Google Scholar, 23.Nollen E.A. Brunsting J.F. Roelofsen H. Weber L.A. Kampinga H.H. Mol. Cell. Biol. 1999; 19: 2069-2079Crossref PubMed Scopus (191) Google Scholar, 24.Gabai V.L. Meriin A.B. Mosser D.D. Caron A.W. Rits S. Shifrin V.I. Sherman M.Y. J. Biol. Chem. 1997; 272: 18033-18037Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 25.Haslbeck M. Buchner J. Prog. Mol. Subcell. Biol. 2002; 28: 37-59Crossref PubMed Scopus (66) Google Scholar). In thermotolerant cells, protein synthesis is still rapidly inhibited by heat stress, but protein synthesis recovers faster than in naive heat-shocked cells, a phenomenon known as translational thermotolerance (26.Hallberg E.M. Hallberg R.L. Cell Stress Chaperones. 1996; 1: 70-77Crossref PubMed Scopus (7) Google Scholar, 27.Beck S.C. De Maio A. J. Biol. Chem. 1994; 269: 21803-21811Abstract Full Text PDF PubMed Google Scholar, 28.De Maio A. Beck S.C. Buchman T.G. Eur. J. Biochem. 1993; 218: 413-420Crossref PubMed Scopus (44) Google Scholar, 29.De Maio A. Beck S.C. Buchman T.G. Circ. Shock. 1993; 40: 177-186PubMed Google Scholar). The mechanism of inhibition of translation by a heat shock (as well as by other types of stress; Ref. 30.Sheikh M.S. Fornace Jr., A.J. Oncogene. 1999; 18: 6121-6128Crossref PubMed Scopus (104) Google Scholar) and thus also the mechanism of translational thermotolerance is still a matter of debate. The main block seems to be at the level of translation initiation. Phosphorylation and thus inhibition of eIF2α is commonly found after stress (31.Patel J. McLeod L.E. Vries R.G. Flynn A. Wang X. Proud C.G. Eur. J. Biochem. 2002; 269: 3076-3085Crossref PubMed Scopus (140) Google Scholar, 32.Dever T.E. Cell. 2002; 108: 545-556Abstract Full Text Full Text PDF PubMed Scopus (620) Google Scholar), but other factors must be affected as well because the inactivation of eIF2B in rat hepatoma cells did not correlate directly with the level of phosphorylation of eIF2α (33.Scheper G.C. Mulder J. Kleijn M. Voorma H.O. Thomas A.A. van Wijk R. J. Biol. Chem. 1997; 272: 26850-26856Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). The cap-binding complex must also be affected because cap-independent initiation of translation is more stress-resistant than is cap-dependent initiation of translation (34.Fernandez J. Yaman I. Sarnow P. Snider M.D. Hatzoglou M. J. Biol. Chem. 2002; 277: 19198-19205Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar, 35.Kim Y.K. Jang S.K. Biochem. Biophys. Res. Commun. 2002; 297: 224-231Crossref PubMed Scopus (50) Google Scholar). Deficiency in eIF4E strongly inhibits general translation in HeLa cells, but translation of Hsp mRNAs and cap-independent mRNAs still takes place (36.Joshi-Barve S. De Benedetti A. Rhoads R.E. J. Biol. Chem. 1992; 267: 21038-21043Abstract Full Text PDF PubMed Google Scholar), a situation that resembles the pattern of translation in cells recovering from heat stress and which suggests that eIF4E is down-regulated during a heat shock. Stalled translation initiation complexes containing almost all components of the 48S preinitiation complex but not the 60S ribosomal subunit accumulate in the cytoplasm as stress granules (SG). Hsp27 has been detected in SGs as well (37.Kedersha N.L. Gupta M. Li W. Miller I. Anderson P. J. Cell Biol. 1999; 147: 1431-1442Crossref PubMed Scopus (914) Google Scholar), possibly in complex with eIF4G (38.Cuesta R. Laroia G. Schneider R.J. Genes Dev. 2000; 14: 1460-1470PubMed Google Scholar). Assembly in SGs is a highly dynamic process, and untranslated mRNAs are thought to be sorted and processed there for either reinitiation, degradation, or packaging into nonpolysomal messenger ribonucleo-protein complexes (39.Kedersha N. Cho M.R. Li W. Yacono P.W. Chen S. Gilks N. Golan D.E. Anderson P. J. Cell Biol. 2000; 151: 1257-1268Crossref PubMed Scopus (598) Google Scholar). This indicates that during and after stress, SGs are important checkpoints for initiation of translation. Thus far, translational tolerance has only been assayed at the level of the overall rate of protein synthesis, and no distinction has been made between cap-dependent and cap-independent translation initiation. We show here that overexpression of either αB-crystallin or Hsp27 protects cap-dependent but not cap-independent translation initiation, whereas overexpression of Hsp70 affects both. Further, we show that the phosphorylation state of αB-crystallin or Hsp27 affects its ability to confer translational tolerance. Finally, we show that 2-aminopurine, a kinase inhibitor that inhibits eIF2α kinases such as double-stranded RNA-activated kinase (PKR) (40.Jarrous N. Osman F. Kaempfer R. Mol. Cell. Biol. 1996; 16: 2814-2822Crossref PubMed Scopus (44) Google Scholar, 41.Ben-Asouli Y. Banai Y. Pel-Or Y. Shir A. Kaempfer R. Cell. 2002; 108: 221-232Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar), blocks the establishment of translational tolerance by overexpression of an sHsp. Cell Culture—C2 cells (mouse myoblast cells) were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) with penicillin and streptomycin (Roche Applied Science) and supplemented with 20% fetal calf serum (PAA Laboratories) to prevent differentiation of these cells. T-REx cells (HeLa cells stably transfected with tetracycline repressor protein; Invitrogen) were cultured in minimum Eagle's medium (BioWhittaker) with glutamax (Invitrogen), 10% fetal calf serum, penicillin, streptomycin, and blasticydin (Invitrogen). SDS-PAGE and Western Blot Analysis of Heat-shocked Cells—For heat shock assays, 6-well plates were seeded with ∼2.5 × 105 cells/well for C2 cells and ∼6.5 × 105 cells/well for T-REx cells. The next day, cells were submitted to a heat shock by submerging plates in a 45 °C water bath. C2 cells were heat shocked for 30 min; T-REx cells were heat shocked for 60 min at 45 °C. Cells were harvested at various times during recovery at 37 °C by scraping in 100 μl of lysis buffer (20% glycerol, 6% SDS, and 120 mm Tris·HCl, pH 6.8). Protein concentrations were measured by using the BCA protein assay kit (Pierce) according to the manufacturer's protocol for 96-well plates. After addition of SDS sample buffer (20% glycerol, 4% SDS, 200 mm dithiothreitol, 200 mm Tris·HCl, pH 6.8, and bromphenol blue), 40 μg of the sample was loaded on gel, separated, and Western blotted. Blots were blocked for 1 h in blocking buffer (10 mm Tris·HCl, pH 7.5, 150 mm NaCl, 0.05% Tween-20, and 5% dried low-fat milk) and incubated with primary antibodies in appropriate dilutions in blocking buffer (anti-αB-crystallin mouse monoclonal 1:500, anti-Hsp25 rabbit polyclonal 1:5000, anti-Hsp70 1:1000; Stressgen) for 1 h at room temperature. After three 10-min washes in blocking buffer, the blot was incubated with the secondary antibody with a conjugated alkaline phosphatase (Promega) for 1 h. The blots were washed again in blocking buffer, rinsed once with AP buffer (100 mm Tris·HCl, pH 9.5, 100 mm NaCl, and 5 mm MgCl2) and stained with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in AP buffer, dried, and analyzed with Molecular Analyst version 1.4.1 software (Bio-Rad) after scanning with a Bio-Rad GS700 imaging densitometer. Pulse Labeling—C2 cells were cultured in DMEM with penicillin, streptomycin, and 20% fetal calf serum to 80% confluence in 25-cm2 flasks. Cells were starved for 2 h in DMEM without methionine with 20% fetal calf serum, penicillin, and streptomycin. Cells were heat shocked for 30 min at 45 °C and assayed for the level of protein synthesis at different time points during recovery. At these time points, medium was replaced by 2 ml of DMEM without methionine with 20% fetal calf serum, penicillin, and streptomycin and 20 μCi of [35S]methionine (Amersham Biosciences). After 1-h incubation at 37 °C, cells were harvested by scraping in 1 ml of phosphate-buffered saline and centrifuging for 2 min at 5000 rpm. The cell pellet was resuspended in 50 μl of SDS sample buffer. After 10 min at 95 °C and 15 min in a sonicator bath, 25 μl of the sample were loaded on an SDS-PAGE gel. To enhance the 35S signal, the gel was incubated in Amplify (Amersham Biosciences) for 30 min after fixing with 0.1% Coomassie Brilliant Blue in 40% methanol and 10% acetic acid and destaining in 7.5% methanol and 7.5% acetic acid. After drying, the gel was autoradiographed overnight, and results were analyzed with Molecular Analyst software (Bio-Rad) after scanning with a Bio-Rad GS700 imaging densitometer. Transfections—C2 cells were transfected with LipofectAMINE plus (Invitrogen). Approximately 6.5 × 104 cells were plated in DMEM with penicillin, streptomycin, and 10% fetal calf serum in 6-well plates. After 24 h, cells were transfected with a total of 1 μg of DNA per well using 4 μl of LipofectAMINE and 6 μl of LipofectAMINE plus reagent. As a transfection control, 0.1 μg of CMV-β-galactosidase was co-transfected, and the other 0.9 μg of DNA was divided over the various constructs, pHsp-Cap-Luc or pHsp-IRES-Luc and expression vectors for αB-crystallin, Hsp27, Hsp70, βB2-crystallin, or the empty vectors as control in a 1:1 ratio (except where indicated otherwise). 48 h after transfection, cells were heat shocked for 30 min at 45 °C (unless mentioned otherwise) and assayed for reporter gene activity during recovery at 37 °C. Approximately 2.5 × 105 T-REx cells were plated in minimum Eagle's medium with glutamax, 10% fetal calf serum, penicillin, and streptomycin in 6-well plates and transfected after 24 h with 1 μg of DNA using 3 μl of Fugene reagent (Roche Applied Science) per well. As a control for the transfection efficiency, 0.2 μg of the pGL3 control vector (Promega) was co-transfected. The pcDNA4TO LacZ (Invitrogen) and αB-crystallin, Hsp27, or empty expression vectors were used in a 1:1 ratio. 48 h after transfection, cells were heat shocked for 1 h at 45 °C. Where indicated, cells were pre-heat shocked for 30 min at 45 °C 6 h earlier. Cells were treated with 1 μg/ml doxycycline for 3 h, starting 3.5 h before the heat shock to induce the pcDNA4TO LacZ construct. After 3 h of induction, cells were washed with phosphate-buffered saline and fresh DMEM with penicillin, streptomycin, and 10% fetal calf serum. Cells were harvested during recovery at 37 °C and assayed for β-galactosidase and luciferase activity. Transfections were done in triplicate and repeated at least twice with different batches of DNA. Unless otherwise indicated, results of representative experiments are shown. RT-PCR—Transfected cells were scraped in 0.5 ml of TRIzol (Invitrogen) per well. After transfer into a tube, 100 μl of chloroform was added and the mixture was vortexed for 15 s. After 15 min on ice and centrifuging for 15 min at 13,000 rpm at 4 °C, 200 μl of the upper phase was precipitated with an equal amount of isopropanol. At this step, material from three wells was pooled. Samples were left at –20 °C for at least 3 h. After centrifuging for 30 min at 13,000 rpm at 4 °C, the pellet was washed twice with cold 70% ethanol and then air-dried for 5 min. The pellet was dissolved in 45 μl of H2O and stored at –20 °C. The RNA was treated with 7.5 units of RNase-free DNase per μg of RNA for 15 min at 37 °C, and DNase was then inactivated for 10 min at 70 °C. The reverse transcription reaction was performed using the 1st-strand cDNA synthesis kit for RT-PCR (Roche Applied Science) according to the manufacturer's instructions with 1 μg of RNA and random primers in a total volume of 20 μl. Primers used for the PCR were luciferase mRNA primers (at position +1330, TGGATGGCTACATTCTGGAGAC, and at position +1720, CCTTCTTGGCCTTTATGAGGATC) and, as a transfection control, β-galactosidase mRNA primers (at position +155, TGGCGTTACCCAACTTAATC, and at position +630, TCAGACGGCAAACGACTGT). The PCR was performed in a total of 25 μl, using 5 μl of cDNA, a mixture of luciferase and β-galactosidase mRNA primers, cDNA PCR buffer, dNTPs, and Advantage HF polymerase (Advantage-HF PCR kit, BD Biosciences). A parallel reaction was performed on 0.25 μg of the DNase-treated RNA to test for DNA contamination. The DNA was denatured at 94 °C for 60 s, primers were annealed at 66 °C for 30 s, and then elongation was performed at 68 °C for 90 s. PCR samples were taken after 20, 25, and 30 cycles and separated on 5% acrylamide gels in 1× Tris-borate-EDTA buffer. Results were quantitated using Molecular Analyst software (Bio-Rad) after scanning on a Bio-Rad Geldoc 1000 system. Samples shown did not contain DNA contamination. Treatment with 2-Aminopurine—For the pre-heat shock, cells were transfected with pcDNA4TO LacZ and pGL3 control vector in a 2:1 ratio with a total of 1 μg of DNA per well. 48 h after transfection, cells were pre-heat shocked for 30 min at 45 °C. The LacZ construct was induced as described in the transfection section of “Experimental Procedures.” 2-Aminopurine (Sigma) was added to a final concentration of 10 mm after washing away the doxycycline. 2-Aminopurine was dissolved in phosphate-buffered saline/acetic acid (17.5 m; 200:1) to a 100 mm stock and adjusted to pH 7.5 with NaOH. As a negative control, phosphate-buffered saline/acetic acid (200:1 adjusted to pH 7.5 with NaOH) was added to non-treated cells. Cells were harvested after 6-h incubation at 37 °C. For the αB-crystallin-transfected cells, 2-aminopurine was added 30 min before heat shock. Cells were harvested after 6 h of recovery with 2-aminopurine at 37 °C. Cells were assayed for luciferase and β-galactosidase activity and Western blotted for Hsp expression. Reporter Assays—After transfection in 6-well plates, heat shock and recovery, cells were harvested by scraping or vigorously shaking in 200 μl of reporter lysis mix (25 mm Bicine, pH 7.5, 0.05% Tween-20, and 0.05% Tween-80) per well. For the β-galactosidase assay, 1:100 galacton (Tropix) was added to a 100 mm phosphate buffer, pH 8.1, with 5 mm MgCl2; 200 μl of this mixture was added to 20 μl of the cell lysate. After 30-min incubation at room temperature, 300 μl of light emission accelerator (Tropix) was added. For the luciferase assay, 100 μl of luciferase reagent (Promega) was added to 20 μl of the cell lysate immediately before measurement. Measurements were performed on a Lumat LB 9507 luminometer for 10 s. In C2 cells, luciferase values were corrected for transfection efficiencies using the β-galactosidase values. In T-REx cells, β-galactosidase values were corrected for transfection efficiencies using the luciferase values of non-heat-shocked cells transfected in parallel. Constructs—The two reporter constructs (Fig. 1) were made in the pGL3 basic vector (Promega). For the pHsp-Cap-Luc, the Drosophila melanogaster Hsp70 promoter was excised from the pBN247 construct (42.Torok I. Karch F. Nucleic Acids Res. 1980; 8: 3105-3123Crossref PubMed Scopus (68) Google Scholar) using HindIII blunt/SalI and cloned in front of the luciferase gene using SmaI and XhoI sites from the vector. For the pHsp-IRES-Luc construct, the rat FGF-2 IRES (532 bp) was excised from pRObFGF503 (43.Shimasaki S. Emoto N. Koba A. Mercado M. Shibata F. Cooksey K. Baird A. Ling N. Biochem. Biophys. Res. Commun. 1988; 157: 256-263Crossref PubMed Scopus (207) Google Scholar) using HindIII/NcoI and inserted between the Hsp70 promoter and the luciferase reporter gene. Rat αB-crystallin cDNA was cloned NcoI-XhoI/SalI into β-actin vector (44.Gunning P. Leavitt J. Muscat G. Ng S.Y. Kedes L. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 4831-4835Crossref PubMed Scopus (667) Google Scholar). The human αB-crystallin coding sequence (kindly provided by P. Muchowski, University of Washington, Seattle) and phosphorylation mutants, made by site-directed mutagenesis (Stratagene), were cloned into the pIRESneo vector (Clontech). The constructs pSV Ha Hsp27 wt and phosphorylation mutants S15A, S90A, S15A/S90A, and S15E/S90E were a kind gift from J. Landry (15.Lambert H. Charette S.J. Bernier A.F. Guimond A. Landry J. J. Biol. Chem. 1999; 274: 9378-9385Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar). The Hsp70 clone was constructed by PCR on mRNA isolated from heat-shocked HeLa cells. The primers used were at position +1 (CAAGCTAACGGCTAGCCTGAGGAGC) and at position +2390 (AAGGCCCCTAATCTACCTCCTCAATGGTGGG) of the Hsp70 mRNA. PCR fragments were cloned into pGEM-T-Easy vector (Promega) and, after sequencing, the Hsp70 coding sequence was cloned into the β-actin vector using SphI blunt/SalI for the insert and NcoI blunt/SalI for the vector. The rat βB2-crystallin expression construct was described previously (45.van den IJssel P.R. Overkamp P. Knauf U. Gaestel M. de Jong W.W. FEBS Lett. 1994; 355: 54-56Crossref PubMed Scopus (104) Google Scholar). αB-crystallin Protects Cap-dependent but Not Cap-independent Translation—Overall translation in C2 cells (mouse myoblasts) was severely inhibited after a 30-min heat shock at 45 °C and did not recover within 7 h at 37 °C (Fig. 2). Accumulation of the endogenous small heat shock proteins Hsp27 and αB-crystallin was first detectable after 3 h; the level of Hsp27 reached a steady state after about 4.5 h, while the level of αB-crystallin continued to increase up to 7.5 h (Fig. 2). Hence, even though general protein synthesis was inhibited, special mRNAs, such as those encoding heat shock proteins, were still translated under these conditions. To determine whether prior expression of a small heat shock protein provides a measure of translational thermotolerance under these conditions, C2 cells were transfected with an expression construct for αB-crystallin together with constructs designed to report translation efficiency after heat shock (Fig. 1). Two different constructs were used. In one, pHsp-Cap-Luc, the luciferase coding region was placed under control of the Hsp70 promoter without altering the 5′ non-coding region of the pGL3 basic vector; in the second, pHsp-IRES-Luc, the 5′ non-coding region of the FGF-2 mRNA was inserted between the Hsp70 promoter and the luciferase coding region. Both reporter gene constructs are driven by the Hsp70 promoter, and the reporter mRNA should thus accumulate only after a heat shock; to decrease background resulting from possible promoter leakage prior to the heat shock, luciferase was used as the reporter. This enzyme is heat labile and inactivated by heat shock. The only difference between the mRNAs encoded by these two reporter constructs is in the 5′ non-coding region. The pHsp-Cap-Luc mRNA has a short, non-structured 5′ non-coding region and is predicted to be initiated via the default mechanism for translation initiation, namely, cap-dependent translation initiation. The pHsp-IRES-Luc mRNA contains the FGF-2 internal ribosome entry site (IRES) known to be used during stress (46.Vagner S. Touriol C. Galy B. Audigier S. Gensac M.C. Amalric F. Bayard F. Prats H. Prats A.C. J. Cell Biol. 1996; 135: 1391-1402Crossref PubMed Scopus (128) Google Scholar) and should be initiated by means of a cap-independent mechanism. In support of this proposed difference in the mechanism of translation initiation, we foun" @default.
• W2017918095 created "2016-06-24" @default.
• W2017918095 creator A5000613587 @default.
• W2017918095 creator A5032998470 @default.
• W2017918095 creator A5054130199 @default.
• W2017918095 creator A5070360216 @default.
• W2017918095 creator A5090480006 @default.
• W2017918095 date "2003-12-01" @default.
• W2017918095 modified "2023-09-28" @default.
• W2017918095 title "Translational Thermotolerance Provided by Small Heat Shock Proteins Is Limited to Cap-dependent Initiation and Inhibited by 2-Aminopurine" @default.
• W2017918095 cites W138849845 @default.
• W2017918095 cites W1486005348 @default.
• W2017918095 cites W1523923451 @default.
• W2017918095 cites W1537274817 @default.
• W2017918095 cites W1540426161 @default.
• W2017918095 cites W1587891756 @default.
• W2017918095 cites W1876533241 @default.
• W2017918095 cites W1949632792 @default.
• W2017918095 cites W1964173713 @default.
• W2017918095 cites W1969314942 @default.
• W2017918095 cites W1990239053 @default.
• W2017918095 cites W1990549640 @default.
• W2017918095 cites W1994861776 @default.
• W2017918095 cites W2003316785 @default.
• W2017918095 cites W2008359273 @default.
• W2017918095 cites W2011994162 @default.
• W2017918095 cites W2013482681 @default.
• W2017918095 cites W2021796977 @default.
• W2017918095 cites W2023610686 @default.
• W2017918095 cites W2028866472 @default.
• W2017918095 cites W2032864246 @default.
• W2017918095 cites W2035172569 @default.
• W2017918095 cites W2036023681 @default.
• W2017918095 cites W2038954191 @default.
• W2017918095 cites W2045683458 @default.
• W2017918095 cites W2046015107 @default.
• W2017918095 cites W2047391267 @default.
• W2017918095 cites W2052707749 @default.
• W2017918095 cites W2061738083 @default.
• W2017918095 cites W2076805523 @default.
• W2017918095 cites W2077198961 @default.
• W2017918095 cites W2086158273 @default.
• W2017918095 cites W2086939601 @default.
• W2017918095 cites W2089559330 @default.
• W2017918095 cites W2092025619 @default.
• W2017918095 cites W2094740743 @default.
• W2017918095 cites W2106034419 @default.
• W2017918095 cites W2114258015 @default.
• W2017918095 cites W2116426914 @default.
• W2017918095 cites W2117529901 @default.
• W2017918095 cites W2135339028 @default.
• W2017918095 cites W2138267133 @default.
• W2017918095 cites W2142181775 @default.
• W2017918095 cites W2146976219 @default.
• W2017918095 cites W2149182598 @default.
• W2017918095 cites W2151013318 @default.
• W2017918095 cites W2154904733 @default.
• W2017918095 cites W2164060511 @default.
• W2017918095 cites W2172343762 @default.
• W2017918095 cites W2181372246 @default.
• W2017918095 cites W2203252197 @default.
• W2017918095 cites W2242222218 @default.
• W2017918095 cites W2332022882 @default.
• W2017918095 cites W3085817 @default.
• W2017918095 cites W31754513 @default.
• W2017918095 cites W40094174 @default.
• W2017918095 cites W2018729278 @default.
• W2017918095 doi "https://doi.org/10.1074/jbc.m302914200" @default.
• W2017918095 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14523008" @default.
• W2017918095 hasPublicationYear "2003" @default.
• W2017918095 type Work @default.
• W2017918095 sameAs 2017918095 @default.
• W2017918095 citedByCount "18" @default.
• W2017918095 countsByYear W20179180952014 @default.
• W2017918095 countsByYear W20179180952019 @default.
• W2017918095 crossrefType "journal-article" @default.
• W2017918095 hasAuthorship W2017918095A5000613587 @default.
• W2017918095 hasAuthorship W2017918095A5032998470 @default.
• W2017918095 hasAuthorship W2017918095A5054130199 @default.
• W2017918095 hasAuthorship W2017918095A5070360216 @default.
• W2017918095 hasAuthorship W2017918095A5090480006 @default.
• W2017918095 hasBestOaLocation W20179180951 @default.
• W2017918095 hasConcept C100631289 @default.
• W2017918095 hasConcept C104317684 @default.
• W2017918095 hasConcept C12554922 @default.
• W2017918095 hasConcept C137984847 @default.
• W2017918095 hasConcept C181199279 @default.
• W2017918095 hasConcept C185592680 @default.
• W2017918095 hasConcept C205260736 @default.
• W2017918095 hasConcept C55493867 @default.
• W2017918095 hasConcept C86803240 @default.
• W2017918095 hasConcept C95444343 @default.
• W2017918095 hasConceptScore W2017918095C100631289 @default.
• W2017918095 hasConceptScore W2017918095C104317684 @default.
• W2017918095 hasConceptScore W2017918095C12554922 @default.
• W2017918095 hasConceptScore W2017918095C137984847 @default.
• W2017918095 hasConceptScore W2017918095C181199279 @default.
• W2017918095 hasConceptScore W2017918095C185592680 @default.

• next