FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2018285405> ?p ?o ?g. }

• W2018285405 endingPage "37618" @default.
• W2018285405 startingPage "37612" @default.
• W2018285405 abstract "The yeast PHO2 gene encodes a homeodomain protein that exemplifies combinatorial control in transcriptional activation. Pho2 alone binds DNA in vitrowith low affinity, but in vivo it activates transcription with at least three disparate DNA-binding proteins: the zinc finger protein Swi5, the helix-loop-helix factor Pho4, and Bas1, an myb-like activator. Pho2 + Swi5 activates HO, Pho2 + Pho4 activatesPHO5, and Pho2 + Bas1 activates genes in the purine and histidine biosynthesis pathways. We have conducted a genetic screen and identified 23 single amino acid substitutions in Pho2 that differentially affect its ability to activate its specific target genes. Analysis of the mutations suggests that the central portion of Pho2 serves as protein-protein interactive surface, with a requirement for distinct amino acids for each partner protein. The yeast PHO2 gene encodes a homeodomain protein that exemplifies combinatorial control in transcriptional activation. Pho2 alone binds DNA in vitrowith low affinity, but in vivo it activates transcription with at least three disparate DNA-binding proteins: the zinc finger protein Swi5, the helix-loop-helix factor Pho4, and Bas1, an myb-like activator. Pho2 + Swi5 activates HO, Pho2 + Pho4 activatesPHO5, and Pho2 + Bas1 activates genes in the purine and histidine biosynthesis pathways. We have conducted a genetic screen and identified 23 single amino acid substitutions in Pho2 that differentially affect its ability to activate its specific target genes. Analysis of the mutations suggests that the central portion of Pho2 serves as protein-protein interactive surface, with a requirement for distinct amino acids for each partner protein. 5-bromo-4-chloro-3-β-d-galactopyranoside analysis of variance Eukaryotic genomes encode a large number of DNA-binding factors. There are 168 and 104 genes encoding homeodomain DNA-binding proteins in humans and Drosophila, respectively, and 607 and 232 genes for zinc finger DNA-binding proteins in these two organisms (1Venter J.C. Adams M.D. Myers E.W., Li, P.W. Mural R.J. Sutton G.G. Smith H.O. Yandell M. Evans C.A. Holt R.A. Gocayne J.D. Amanatides P. Ballew R.M. Huson D.H. Wortman J.R. Zhang Q. Kodira C.D. Zheng X.H. Chen L. Skupski M. Subramanian G. Thomas P.D. Zhang J. Gabor Miklos G.L. Nelson C. Broder S. Clark A.G. Nadeau J. McKusick V.A. Zinder N. Levine A.J. Roberts R.J. Simon M. Slayman C. Hunkapiller M. Bolanos R. Delcher A. Dew I. Fasulo D. Flanigan M. Florea L. Halpern A. Hannenhalli S. Kravitz S. Levy S. Mobarry C. Reinert K. Remington K. Abu-Threideh J. Beasley E. Biddick K. Bonazzi V. Brandon R. Cargill M. Chandramouliswaran I. Charlab R. Chaturvedi K. Deng Z., Di Francesco V. Dunn P. Eilbeck K. Evangelista C. Gabrielian A.E. Gan W., Ge, W. Gong F., Gu, Z. Guan P. Heiman T.J. Higgins M.E., Ji, R.R., Ke, Z. Ketchum K.A. Lai Z. Lei Y., Li, Z., Li, J. Liang Y. Lin X., Lu, F. Merkulov G.V. Milshina N. Moore H.M. Naik A.K. Narayan V.A. Neelam B. Nusskern D. Rusch D.B. Salzberg S. Shao W. Shue B. Sun J. Wang Z. Wang A. Wang X. Wang J. Wei M. Wides R. Xiao C. Yan C. et al.Science. 2001; 291: 1304-1351Crossref PubMed Scopus (10387) Google Scholar). However, many of these proteins contain very similar DNA-binding domains and may recognize the same DNA sequence in vitro. The Drosophila homeodomain proteins have been well analyzed, and although genetic studies show that these proteins activate different sets of genes in vivo, in vitroDNA-binding experiments show that many of these proteins recognize very similar DNA sequences (2Laughon A. Biochemistry. 1991; 30: 11357-11372Crossref PubMed Scopus (259) Google Scholar). This apparent conundrum has led to the view that regulatory specificity results from increased DNA binding specificity through cooperative interactions between multiple transcription factors. Cooperativity between transcription factors acts positively to increase affinity and specificity in promoter site recognition (3Wolberger C. Curr. Opin. Genet. Dev. 1998; 8: 552-559Crossref PubMed Scopus (47) Google Scholar). Combinatorial mechanisms also allow a transcription factor to act at different genes by interacting with multiple distinct partners. The yeast PHO2 gene (also known as BAS2 orGRF10) encodes a homeodomain transcription factor that activates transcription in a combinatorial manner. It appears that Pho2 does not act alone, but with several partner proteins. By itself, Pho2 binds DNA with low affinity (4Brazas R.M. Stillman D.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11237-11241Crossref PubMed Scopus (39) Google Scholar) and comparison of in vitrobinding sites reveals a relatively nonspecific consensus, ATTA or TAAT (4Brazas R.M. Stillman D.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11237-11241Crossref PubMed Scopus (39) Google Scholar, 5Arndt K.T. Styles C. Fink G.R. Science. 1987; 237: 874-880Crossref PubMed Scopus (175) Google Scholar, 6Barbaric S. Munsterkotter M. Svaren J. Horz W. Nucleic Acids Res. 1996; 24: 4479-4486Crossref PubMed Scopus (62) Google Scholar), similar to the consensus for Drosophila homeodomain proteins (2Laughon A. Biochemistry. 1991; 30: 11357-11372Crossref PubMed Scopus (259) Google Scholar). Pho2 binds DNA cooperatively with the Pho4 helix-loop-helix factor to activate expression of the PHO5 acid phosphatase (7Barbaric S. Munsterkotter M. Goding C. Horz W. Mol. Cell. Biol. 1998; 18: 2629-2639Crossref PubMed Google Scholar). Similarly, Pho2 and the Swi5 zinc finger protein bind cooperatively to the HO promoter and contribute to its transcriptional activation (4Brazas R.M. Stillman D.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11237-11241Crossref PubMed Scopus (39) Google Scholar, 8McBride H.J. Brazas R.M., Yu, Y. Nasmyth K. Stillman D.J. Mol. Cell. Biol. 1997; 17: 2669-2678Crossref PubMed Scopus (24) Google Scholar, 9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar). Bas1, an myb-like transcription factor, works with Pho2 in the activation of a set of biosynthetic genes, includingHIS4, ADE1, and ADE5,7 (5Arndt K.T. Styles C. Fink G.R. Science. 1987; 237: 874-880Crossref PubMed Scopus (175) Google Scholar, 10Rolfes R.J. Zhang F. Hinnebusch A.G. J. Biol. Chem. 1997; 272: 13343-13354Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 11Daignan-Fornier B. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6746-6750Crossref PubMed Scopus (157) Google Scholar, 12Denis V. Boucherie H. Monribot C. Daignan-Fornier B. Mol. Microbiol. 1998; 30: 557-566Crossref PubMed Scopus (62) Google Scholar).In vitro studies have not shown cooperative DNA binding between Bas1 and Bas2 (13Tice-Baldwin K. Fink G.R. Arndt K.T. Science. 1989; 246: 931-935Crossref PubMed Scopus (124) Google Scholar), however, these experiments were conducted with in vitro expressed proteins that may not reflect their native state in vivo (14Pinson B. Gabrielsen O.S. Daignan-Fornier B. Mol. Microbiol. 2000; 36: 1460-1469Crossref PubMed Scopus (8) Google Scholar). Additionally, two-hybrid analyses detect an interaction between Pho2 and each of its partners, Pho4, Bas1, and Swi5 (9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar, 15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar, 16Hirst K. Fisher F. McAndrew P.C. Goding C.R. EMBO J. 1994; 13: 5410-5420Crossref PubMed Scopus (84) Google Scholar, 17Pinson B. Kongsrud T.L. Ording E. Johansen L. Daignan-Fornier B. Gabrielsen O.S. Nucleic Acids Res. 2000; 28: 4665-4673Crossref PubMed Scopus (21) Google Scholar), and Pho2 Bas1 interaction has been demonstrated by co-immunoprecipitation (18Hannum C. Kulaeva O.I. Sun H. Urbanowski J.L. Wendus A. Stillman D.J. Rolfes R.J. J. Biol. Chem. 2002; (July 10, 10.1074/jbc.M206168200)PubMed Google Scholar). Previous experiments have identified specific amino acids in Swi5 that are important for cooperativity with Pho2, because Swi5 mutant alleles with substitutions at these residues are defective in both cooperative DNA binding and transcriptional activation (9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar). In this report we describe a reciprocal but expanded strategy to identify Pho2 amino acid residues with discrete roles in activation of a subset of its target genes due to specific defects in individual partner protein interactions. The strains used in this study are listed in TableI. Strains DY1921, DY2187, and DY5075 are isogenic strains in the W303 strain background. The HO(Site B)-CYC1::lacZ reporter integrated at the URA3 locus has been described previously (9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar), except that in DY5075 LEU2 was inserted into URA3 using plasmid pUL9 (19Cross F.R. Yeast. 1997; 13: 647-653Crossref PubMed Scopus (140) Google Scholar), a ura3:LEU2 converter. Strains RR87 and RR88 are isogenic in the S288C background and have been previously described (15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar).Table IStrain and plasmid listStrainGenotypeSourceDY1921MAT a pho2:LEU2 ade2–1 can1–100 his3–11, 15 leu2–3, 112 trp1–1 ura3–1(9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar)DY2187MAT a gcn4:ADE2 pho2:LEU2 ade2–1 can1–100 leu2–3,112 trp1–1 ura3–1(30Jiang Y.W. Stillman D.J. Genetics. 1995; 140: 103-114Crossref PubMed Google Scholar)DY5075MAT a ace2::HIS3 pho2::hisG gcn4::ADE2 ura3::LEU2::HO (Site B)-CYC1::lacZ ade2–1 can1–100 his3–11,15 leu2–3,112 trp1–1 ura3–1This studyRR87MATα BAS1 pho2–2 leu2::(lexAop)6-LEU2 his3 trp1 ura3–1(15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar)RR88MATαbas1–2 pho2–2 leu2::(lexAop)6-LEU2 his3 trp1 ura3–1(15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar)PlasmidDescriptionSourcepRS316YCp vector withURA3(31Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar)M3570PHO2in pRS316 without BamHI siteThis studyM3589PHO2 in pRS316 with BamHI sites at aa 273 and 442This studyM2295HIS4-lacZ reporter (YRp-TRP1)This studypL10–2xADE5, 7-lacZ reporter (YCp-TRP1)This studypR335lexAop-lacZ reporter (YEp-TRP1)This studyp2099lexA-Bas1 fusion (YEp-HIS3)(15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar) Open table in a new tab The plasmids used in this study are listed in Table I, except for the plasmids with PHO2 point mutations, which are listed in Table II. Plasmid M3570 contains aHindIII fragment with PHO2 cloned into a pRS316 (YCp-URA3) derivative that lacks the BamHI site in the polylinker. M3589 was constructed from M3570 by site-directed mutagenesis with primers F471 (CAATACAGGGATCCCCAC) and F470 (TTCAGGATCCTTTTCCC) to introduce BamHI sites that make conservative amino acid substitutions (F273L and A422G). Thus, plasmid M3589 has two BamHI sites, at amino acids 273 and 442 of thePHO2 insert. Plasmid M2295 with an HIS4-lacZreporter was constructed by cloning a 5-kb SalI fragment with HIS4-lacZ into a YRp-TRP1 plasmid. Plasmid pL10–2x was prepared by cloning a fragment of ∼8 kb SalI to BspE1 encoding ADE5,7-lacZ into the SalI andXmaI sites of a derivative of pRS314 lacking theNaeI to NcoI fragment encodinglacZα. Plasmid pR335 with an lexAop-lacZ reporter was constructed by inserting a DNA fragment with TRP1 into theApaI site of the URA3 gene of plasmid pSH18–34 (20Finley Jr., R.L. Brent R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 12980-12984Crossref PubMed Scopus (240) Google Scholar). Plasmid p2099 expressing an LexA-Bas1 fusion protein has been described previously (15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar).Table IIPhosphatase and HO(Site B)-lacZ reporter assaysAcid phosphataseHO(Site B)-lacZPho2 mutantNormalized toNormalized toSubstitutionPlasmidRaw valueWild-typeProteinRaw valueWild-typeProteinVectorpRS3160.04 ± 0.01008 ± 0.300WT Pho2M35700.66 ± 0.08100100360 ± 40100100D319AM41170.81 ± 0.08120167400 ± 45110149K331GM41180.59 ± 0.0489136415 ± 75120178R343KM39190.15 ± 0.04175460 ± 61546F347LM41220.06 ± 0.012328 ± 268V349GM39210.03 ± 0.01>0>034 ± 0.2716N363SM41230.11 ± 0.02113324 ± 3.8514S367AM39230.71 ± 0.0210993370 ± 2010088C369YM41240.11 ± 0.01102025 ± 359D370GM41250.07 ± 0.015715 ± 423D371GM39220.08 ± 0.016208 ± 0.600D371NM41260.08 ± 0.0261515 ± 125F372LM39240.07 ± 0.014815 ± 324E374GM41290.16 ± 0.01192032 ± 978E374VM41310.05 ± 0.031121 ± 744V378GM41190.05 ± 0.011232 ± 3716N387SM41330.33 ± 0.03465288 ± 42326I388VM41340.50 ± 0.12736780 ± 82019I415VM41350.38 ± 0.07553493 ± 452415For acid phosphatase assays, plasmids were transformed into DY1921 (pho2) and grown in medium lacking inorganic phosphate and assayed for acid phosphatase activity. For HO(Site B)-lacZ reporter assays, plasmids were transformed into DY5075 (ace2 pho2 gcn4 ura3::LEU2::HO (Site B)-CYC1::lacZ), and transformants were grown in medium lacking racil and assayed for β-galactosidase activity. Three independent transformants were assayed and standard errors are shown. After subtracting the value assayed in thepho2 (vector), the normalized levels are also shown as a percentage of WT and normalized to the protein levels quantitated from Fig. 2. Open table in a new tab For acid phosphatase assays, plasmids were transformed into DY1921 (pho2) and grown in medium lacking inorganic phosphate and assayed for acid phosphatase activity. For HO(Site B)-lacZ reporter assays, plasmids were transformed into DY5075 (ace2 pho2 gcn4 ura3::LEU2::HO (Site B)-CYC1::lacZ), and transformants were grown in medium lacking racil and assayed for β-galactosidase activity. Three independent transformants were assayed and standard errors are shown. After subtracting the value assayed in thepho2 (vector), the normalized levels are also shown as a percentage of WT and normalized to the protein levels quantitated from Fig. 2. Residues 171 to 503 ofPHO2 were PCR-amplified using oligonucleotides F400 (CTTCATCCATATTTCACGATGAAG) and F401 (GCATTATGATTGTTATTGCTGTTG) using an error-prone mutagenesis protocol as described (9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar). PCR products were transformed into strain DY5075, along with the gapped plasmid (BamHI-digested M3589), and Ura+ transformants were selected. Following replica plating, the transformants were screened for defects in interaction with Swi5, Pho2, and Bas1 as follows: TheHO(Site B)-lacZ reporter requires Swi5 and Pho2 for activation, and reporter activity was examined using the chromogenic substrate 5-bromo-4-chloro-3-β-d-galactopyranoside (X-gal)1 in a blue/white colony lift assay (21Dohrmann P.R. Voth W.P. Stillman D.J. Mol. Cell. Biol. 1996; 16: 1746-1758Crossref PubMed Scopus (66) Google Scholar). Poor growth on -Ura-Ade and -Ura-His plates was used to assess a defect in activation of Ade or His biosynthetic genes by Bas1 and Pho2. Additionally, limited growth on media lacking inorganic phosphate was used to assess defect inPHO5 activation by Pho4 and Pho2. Mutants showing defects in all phenotypic assays tested were discarded as likely null mutants. Plasmids were then isolated after passage through Escherichia coli and re-transformed into DY5075 to confirm phenotypes. Site-directed mutagenesis by the dut- ung- method was performed as described (22Ausubel F.M. Brent R. Kingston R.E. Moore D.E. Seidman J.G. Smith J.A. Struhl K. Current Protocols Molecular Biology. Wiley and Sons, New York1987: 8.1.1-8.1.6Google Scholar), and all mutations were confirmed by dideoxy sequencing. Extracts were prepared and quantitative assays for β-galactosidase activity were performed using the chromogenic reagento-nitrophenyl-β-d-galactopyranoside as described (23Breeden L. Nasmyth K. Cell. 1987; 48: 389-397Abstract Full Text PDF PubMed Scopus (285) Google Scholar). Low phosphate media was prepared, and phosphatase assays were performed as described (24Dorland S. Deegenaars M.L. Stillman D.J. Genetics. 2000; 154: 573-586Crossref PubMed Google Scholar). Western immunoblots were performed with anti-Pho2 and anti-Pgk1 antibodies and developed with an ECL Western kit (Amersham Biosciences). The rabbit antisera to Pho2 was generated against an His-tagged Pho2 fusion protein expressed from plasmid M2025 (4Brazas R.M. Stillman D.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11237-11241Crossref PubMed Scopus (39) Google Scholar), and the rabbit anti-Pgk1 antibody was from Molecular Probes Inc. The immunoblots were quantitated with IMAGE software (National Institutes of Health, rsb.info.nih.gov/nih-image/), and the Pho2 protein levels were normalized to Pgk1. Strain DY5075 was designed to allow simultaneous screening ofPHO2 mutations that affect activation of specific target genes, HO, HIS4, and PHO5. In addition to a PHO2 gene disruption, the strain has an integratedHO(Site B)-lacZ reporter, which contains the Swi5 binding site from the Site B region of the HO promoter acting as a UAS driving expression of lacZ. This reporter turns SWI5 PHO2 colonies blue in the presence of the chromogenic substrate X-gal, but either a swi5 or a pho2 mutation causes colonies to remain white (9Bhoite L.T. Stillman D.J. Mol. Cell. Biol. 1998; 18: 6436-6446Crossref PubMed Scopus (22) Google Scholar). HIS4 expression can be activated either by the Pho2/Bas1 pathway or by the Gcn4 pathway (5Arndt K.T. Styles C. Fink G.R. Science. 1987; 237: 874-880Crossref PubMed Scopus (175) Google Scholar). This strain has mutations in both PHO2 and GCN4, and thus it is a histidine auxotroph. Finally, PHO5expression depends on PHO2, and this strain is unable to grow in the absence of inorganic phosphate. Thus, DY5075 has a White, His-, Pho- phenotype, but transformation with a PHO2 plasmid results in a Blue, His+, Pho+ phenotype. Deletion analysis demonstrated that the DNA-binding domain of Pho2 is not sufficient for cooperative DNA binding with Swi5 at theHO promoter (25Brazas R.M. Bhoite L.T. Murphy M.D., Yu, Y. Chen Y. Neklason D.W. Stillman D.J. J. Biol. Chem. 1995; 270: 29151-29161Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). Amino acids 77–136 comprise the Pho2 homeodomain DNA-binding domain (see Fig.1), and a large C-terminal region was shown to be required for interaction with Swi5 in vitro. To more precisely identify the regions of Pho2 that interact with its partner proteins, we decided to isolate Pho2 point mutations that interfered with its ability to activate specific target genes. Our strategy combined PCR-mediated random mutagenesis with plasmid gap repair (26Muhlrad D. Hunter R. Parker R. Yeast. 1992; 8: 79-82Crossref PubMed Scopus (416) Google Scholar) to generate a mutagenized plasmid library ofPHO2. A fragment of Pho2 encoding amino acids 171–504 was subjected to error-prone PCR (Fig. 1). The PCR product was then co-transformed into yeast along with plasmid M3589 that had been cleaved withBamHI. This digestion creates a linearized yeast plasmid with a gap between codons 273 and 422 (Fig. 1). In vivorecombination using the homology between the PCR product and the linearized plasmid repairs the gap and allows formation of a circular plasmid, whereas the URA3 marker on the plasmid allows for selection of these events. Co-transformation of DY5075 with thePHO2 PCR product and linearized M3589 resulted in Ura+ transformants that were screened for either decreased Blue color on X-gal (the White phenotype), reduced growth on media lacking histidine (the His- phenotype), or reduced growth on media lacking inorganic phosphate (the Pho- phenotype). Any mutant showing either a White, His-, or Pho- phenotype was re-screened by the original assay and screened by the other two phenotypic assays. Clearly, a vast majority of these PHO2 mutations were characterized as White, His-, Pho- phenotypes and subsequently discarded as potential null mutants. We only retained mutants where activation of at least one of the reporters was greater than a pho2 null mutant strain carrying the URA3 vector. A total of 12,000 yeast transformants containing plasmids bearing potential mutations in Pho2 were screened, and 290 candidates with either decreased expression of the HO(Site B)-lacZ reporter, decreased growth on -His plates, or decreased growth on -Pho plates were identified. After DNA purification, re-transformation and testingin vivo phenotypes, 40 were subjected to DNA sequence analysis. Some clones had single mutations, whereas other clones had multiple amino acid substitutions. Among the group with multiple mutations, clones with single amino acid substitutions were generated either by subcloning or by site-directed mutagenesis. We created a set of 23 YCp-URA3 plasmids, each with a single amino acid substitution in PHO2. Although a 334-amino acid region in the center of the protein from 171 to 504 was subjected to mutagenesis, we observed that the mutations tended to fall in two regions (Fig. 1). The first region of ∼30 residues was defined by four mutations in positions 244–270, and the second region of ∼50 residues was defined by 16 mutations in positions 343–390. Two mutations are on the edge of an acidic patch from 286 to 326 that lies between the two clusters of mutations, and one mutation is found at position 415 in a region implicated in activation function (15Zhang F. Kirouac M. Zhu N. Hinnebusch A.G. Rolfes R.J. Mol. Cell. Biol. 1997; 17: 3272-3283Crossref PubMed Scopus (42) Google Scholar). Western immunoblots were performed to determine whether the point mutations in Pho2 affected protein levels. Yeast strain DY5075 was transformed with plasmids containing the various Pho2 mutants, the wild-type PHO2 gene or the vector control. Extracts were prepared from log phase cells and size-separated on SDS gels for immunoblot analysis (Fig. 2). The blots were probed with antibody specific to Pho2, as well as with as an antibody to Pgk1 as an internal loading control. The results were quantified and are listed in Fig. 2. Most of the Pho2 mutants are expressed at normal levels (defined as expressing between one-fourth to 2-fold of wild-type), with the exception of L244S, F258L and F259L, which showed a severe reduction in Pho2 protein levels (<5%), and F270L and H390L, which showed a strong reduction (10–15%). With the exception of H390L, all of the mutations that exhibit a strong or severe decrease in Pho2 protein levels are found in a cluster of mutation amino-terminal to the acidic patch. Because these mutations have a strong effect on Pho2 protein levels, and most likely can account for the decrease in gene expression detected, we have largely excluded them from the analyses below. The secreted acid phosphatases are encoded by three genes, PHO5,PHO11, and PHO10 (27Oshima Y. Ogawa N. Harashima S. Gene. 1996; 179: 171-177Crossref PubMed Scopus (90) Google Scholar). The better studied of these, PHO5, encodes the major form, whereas the other two genes encode minor species. The expression of these genes is repressed when cells are grown in medium containing inorganic phosphate, and derepression requires the activity of Pho4 and Pho2 (27Oshima Y. Ogawa N. Harashima S. Gene. 1996; 179: 171-177Crossref PubMed Scopus (90) Google Scholar). To determine the ability of the Pho2 mutants to activate expression of these genes, we measured acid phosphatase activity in cellular extracts (TableII) and normalized the expression data to both wild-type expression and Pho2 protein levels. Ten of the remaining eighteen mutations greatly affected expression of the secreted phosphatases (less than 26% activity remaining). These ten mutations are found tightly clustered between positions 347 and 378 and exhibit phosphatase activities that are undetectable and up to 20% of the wild-type. Phosphatase expression was affected in strains with the mutations F347L, V349G, C369Y, D370G, D371G, D371N, F372L, E374G, E374V, and V378G. Interestingly, each of these mutations also affect expression of the Swi5- and Bas1-dependent reporters (described below), indicating that these mutations either alter the overall structure of the region, or affect critical contacts required for all three partners. We did not identify any Pho2 alleles that specifically diminished phosphatase expression (Pho4-dependent) while retaining expression of the other reporters. Strain DY5075 contains the integrated HO(Site B)-lacZ reporter, the expression of which is dependent on Swi5 and Pho2. We next determined the effect of the PHO2 mutations on expression of this reporter. Extracts were prepared from log phase cells and used for quantitative β-galactosidase assays (Table II). β-Galactosidase activities are presented as specific activities and as a percentage normalized to the PHO2 wild-type and Pho2 protein levels. Fourteen mutations in PHO2 affected expression of this reporter leading to β-galactosidase activities that were less than 26% of wild-type. These mutations include the ten substitutions described above that affect acid phosphatase expression and mutations N387S, I388V, and I415V. The N363S mutation strongly affected expression of HO(Site B)-lacZ and the two Bas1-dependent reporters (see below) but only weakly affected phosphatase expression. Strikingly, mutations in the adjacent residues N387S and I388V strongly decreased expression ofHO(Site B)-lacZ. These two mutations had only a moderate affect on the expression of the other reporters (expression was decreased to 52–80%) or they retained expression at wild-type or higher levels. I415V lies farther to the C terminus than all of the other mutations and strongly affects both the HO(Site B)-lacZ and HIS4-lacZ reporters. Thus, we can provisionally identify two positions within Pho2, amino acids N387 and I388, as making specific contacts with Swi5. Almost twenty genes require the combination of Bas1 and Pho2 for expression, including genes required for metabolism of histidine, purine, and pyrimidine nucleotides and one-carbon units (5Arndt K.T. Styles C. Fink G.R. Science. 1987; 237: 874-880Crossref PubMed Scopus (175) Google Scholar, 10Rolfes R.J. Zhang F. Hinnebusch A.G. J. Biol. Chem. 1997; 272: 13343-13354Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 11Daignan-Fornier B. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 6746-6750Crossref PubMed Scopus (157) Google Scholar, 12Denis V. Boucherie H. Monribot C. Daignan-Fornier B. Mol. Microbiol. 1998; 30: 557-566Crossref PubMed Scopus (62) Google Scholar). The HIS4 gene is activated by one of two pathways, either by Pho2 in combination with Bas1 or by Gcn4 acting alone (5Arndt K.T. Styles C. Fink G.R. Science. 1987; 237: 874-880Crossref PubMed Scopus (175) Google Scholar). The ADE5,7 gene is activated by Bas1 and Pho2 but does not require Gcn4 (10Rolfes R.J. Zhang F. Hinnebusch A.G. J. Biol. Chem. 1997; 272: 13343-13354Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar, 28Rolfes R.J. Hinnebusch A.G. Mol. Cell. Biol. 1993; 13: 5099-5111Crossref PubMed Scopus (101) Google Scholar). TheHIS4 and ADE5,7 genes also differ in their dependence on Pho2 in an assay based on activation by Bas1-VP16 (17Pinson B. Kongsrud T.L. Ording E. Johansen L. Daignan-Fornier B. Gabrielsen O.S. Nucleic Acids Res. 2000; 28: 4665-4673Crossref PubMed Scopus (21) Google Scholar);HIS4 expression is strongly dependent on Pho2, whereasADE5,7 exhibits a moderate requirement. Several otherADE genes, typified by ADE1, have only a weak dependence on Pho2 (17Pinson B. Kongsrud T.L. Ording E. Johansen L. Daignan-Fornier B. Gabrielsen O.S. Nucleic Acids Res. 2000; 28: 4665-4673Crossref PubMed Scopus (21) Google Scholar). To determine the ability of the Pho2 mutants to activateHIS4 expression, a gcn4 pho2 strain was transformed with a HIS4-lacZ reporter plasmid and the set of Pho2 plasmids. Extracts were prepared from log phase cells and used for quantitative β-galactosidase assays (TableIII). β-Galactosidase activities are presented as normalized to the PHO2 wild-type and Pho2 protein levels. Eleven mutations exhibited substantial decreases in expression of HIS4-lacZ, largely overlapping with the ones described above that affect phosphatase expression. The Pho2 mutations R343K, F347L, V349G, N363S, C369Y, D370G, F372L, V378G, and I415V (but not the mutations at E374) strongly affected HIS4-lacZexpression. In addition to these mutations, R343K is strongly decreased for HIS4 expression, expressing only 2% of the wild-type level, and two mutations, D319A and K331G, appear to have completely lost the ability to activate HIS4 expression with Bas1, exhibiting empty-vector levels of β-galactosidase activity. These mutations are located within or immediately adjacent to the acidic region (positions 286–326). Finally, the I388V mutation described above as showing a strong decrease in expression of HO(Site B)-lacZ when paired with Swi5, exhibited a 3.25-foldincrease in HIS4-lacZ expression relative to WT Pho2. Thus, mutations D319A, K331G, and R343K appear to be specific for Bas1.Table IIIHIS4-lacZ and ADE5,7-lacZ reporter assaysHIS4-lacZADE5,7-lacZPho2 mutantNormalized toNormalized toSubstituionPlasmidRaw valueWild-typeProteinRaw valueWild-typeProteinVectorpRS3165 ± 10014 ± 500WT Pho2M3570120 ± 2410010067 ± 24100100D319AM41172 ± 0.3>0>047 ± 116284K331GM41182.7 ± 0.2>0>055 ± 1677118R343KM39195.5 ± 1.70234 ± 233-ap" @default.
• W2018285405 created "2016-06-24" @default.
• W2018285405 creator A5005145056 @default.
• W2018285405 creator A5012184673 @default.
• W2018285405 creator A5023506310 @default.
• W2018285405 creator A5030413393 @default.
• W2018285405 creator A5041751215 @default.
• W2018285405 creator A5047543829 @default.
• W2018285405 creator A5062969118 @default.
• W2018285405 creator A5072138736 @default.
• W2018285405 creator A5072166104 @default.
• W2018285405 date "2002-10-01" @default.
• W2018285405 modified "2023-09-30" @default.
• W2018285405 title "Mutations in the Pho2 (Bas2) Transcription Factor That Differentially Affect Activation with Its Partner Proteins Bas1, Pho4, and Swi5" @default.
• W2018285405 cites W1691149593 @default.
• W2018285405 cites W1750603985 @default.
• W2018285405 cites W1963142741 @default.
• W2018285405 cites W1975593876 @default.
• W2018285405 cites W2011523696 @default.
• W2018285405 cites W2030712030 @default.
• W2018285405 cites W2033300927 @default.
• W2018285405 cites W2034094245 @default.
• W2018285405 cites W2044570013 @default.
• W2018285405 cites W2049738765 @default.
• W2018285405 cites W2052894840 @default.
• W2018285405 cites W2061688076 @default.
• W2018285405 cites W2070955414 @default.
• W2018285405 cites W2073239733 @default.
• W2018285405 cites W2077351082 @default.
• W2018285405 cites W2081772539 @default.
• W2018285405 cites W2101477162 @default.
• W2018285405 cites W2106126132 @default.
• W2018285405 cites W2106155082 @default.
• W2018285405 cites W2127230663 @default.
• W2018285405 cites W2139879863 @default.
• W2018285405 cites W2141687395 @default.
• W2018285405 cites W2143883076 @default.
• W2018285405 cites W2149006664 @default.
• W2018285405 cites W2151915132 @default.
• W2018285405 cites W2169333620 @default.
• W2018285405 cites W2275861305 @default.
• W2018285405 cites W4241302198 @default.
• W2018285405 cites W61379093 @default.
• W2018285405 doi "https://doi.org/10.1074/jbc.m206125200" @default.
• W2018285405 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12145299" @default.
• W2018285405 hasPublicationYear "2002" @default.
• W2018285405 type Work @default.
• W2018285405 sameAs 2018285405 @default.
• W2018285405 citedByCount "38" @default.
• W2018285405 countsByYear W20182854052012 @default.
• W2018285405 countsByYear W20182854052013 @default.
• W2018285405 countsByYear W20182854052014 @default.
• W2018285405 countsByYear W20182854052015 @default.
• W2018285405 countsByYear W20182854052018 @default.
• W2018285405 countsByYear W20182854052020 @default.
• W2018285405 countsByYear W20182854052023 @default.
• W2018285405 crossrefType "journal-article" @default.
• W2018285405 hasAuthorship W2018285405A5005145056 @default.
• W2018285405 hasAuthorship W2018285405A5012184673 @default.
• W2018285405 hasAuthorship W2018285405A5023506310 @default.
• W2018285405 hasAuthorship W2018285405A5030413393 @default.
• W2018285405 hasAuthorship W2018285405A5041751215 @default.
• W2018285405 hasAuthorship W2018285405A5047543829 @default.
• W2018285405 hasAuthorship W2018285405A5062969118 @default.
• W2018285405 hasAuthorship W2018285405A5072138736 @default.
• W2018285405 hasAuthorship W2018285405A5072166104 @default.
• W2018285405 hasBestOaLocation W20182854051 @default.
• W2018285405 hasConcept C104317684 @default.
• W2018285405 hasConcept C15744967 @default.
• W2018285405 hasConcept C185592680 @default.
• W2018285405 hasConcept C2776035688 @default.
• W2018285405 hasConcept C46312422 @default.
• W2018285405 hasConcept C54355233 @default.
• W2018285405 hasConcept C55493867 @default.
• W2018285405 hasConcept C86339819 @default.
• W2018285405 hasConcept C86803240 @default.
• W2018285405 hasConcept C95444343 @default.
• W2018285405 hasConceptScore W2018285405C104317684 @default.
• W2018285405 hasConceptScore W2018285405C15744967 @default.
• W2018285405 hasConceptScore W2018285405C185592680 @default.
• W2018285405 hasConceptScore W2018285405C2776035688 @default.
• W2018285405 hasConceptScore W2018285405C46312422 @default.
• W2018285405 hasConceptScore W2018285405C54355233 @default.
• W2018285405 hasConceptScore W2018285405C55493867 @default.
• W2018285405 hasConceptScore W2018285405C86339819 @default.
• W2018285405 hasConceptScore W2018285405C86803240 @default.
• W2018285405 hasConceptScore W2018285405C95444343 @default.
• W2018285405 hasIssue "40" @default.
• W2018285405 hasLocation W20182854051 @default.
• W2018285405 hasOpenAccess W2018285405 @default.
• W2018285405 hasPrimaryLocation W20182854051 @default.
• W2018285405 hasRelatedWork W2029633625 @default.
• W2018285405 hasRelatedWork W2030608039 @default.
• W2018285405 hasRelatedWork W2034625591 @default.
• W2018285405 hasRelatedWork W2070922469 @default.
• W2018285405 hasRelatedWork W2074557265 @default.
• W2018285405 hasRelatedWork W2116925118 @default.
• W2018285405 hasRelatedWork W2117063418 @default.

• next