FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2018713088> ?p ?o ?g. }

• W2018713088 endingPage "26508" @default.
• W2018713088 startingPage "26499" @default.
• W2018713088 abstract "During endochondral ossification, chondrocytes undergo hypertrophic differentiation and die by apoptosis. The level of inorganic phosphate (Pi) elevates at the site of cartilage mineralization, and when chondrocytes were treated with Pi, they underwent rapid apoptosis. Gene silencing of the proapoptotic Bcl-2 homology 3-only molecule bnip3 significantly suppressed Pi-induced apoptosis. Conversely, overexpression of Bcl-xL suppressed, and its knockdown promoted, the apoptosis of chondrocytes. Bnip3 was associated with Bcl-xL in chondrocytes stimulated with Pi. Bcl-xL was expressed uniformly in the growth plate chondrocytes, whereas Bnip3 expression was exclusively localized in the hypertrophic chondrocytes. Finally, we generated chondrocyte-specific bcl-x knock-out mice using the Cre-loxP recombination system, and we provided evidence that the hypertrophic chondrocyte layer was shortened in those mice because of an increased apoptosis of prehypertrophic and hypertrophic chondrocytes, with the mice afflicted with dwarfism as a result. These results suggest the pivotal role of Bcl-2 family members in the regulation of chondrocyte apoptosis. During endochondral ossification, chondrocytes undergo hypertrophic differentiation and die by apoptosis. The level of inorganic phosphate (Pi) elevates at the site of cartilage mineralization, and when chondrocytes were treated with Pi, they underwent rapid apoptosis. Gene silencing of the proapoptotic Bcl-2 homology 3-only molecule bnip3 significantly suppressed Pi-induced apoptosis. Conversely, overexpression of Bcl-xL suppressed, and its knockdown promoted, the apoptosis of chondrocytes. Bnip3 was associated with Bcl-xL in chondrocytes stimulated with Pi. Bcl-xL was expressed uniformly in the growth plate chondrocytes, whereas Bnip3 expression was exclusively localized in the hypertrophic chondrocytes. Finally, we generated chondrocyte-specific bcl-x knock-out mice using the Cre-loxP recombination system, and we provided evidence that the hypertrophic chondrocyte layer was shortened in those mice because of an increased apoptosis of prehypertrophic and hypertrophic chondrocytes, with the mice afflicted with dwarfism as a result. These results suggest the pivotal role of Bcl-2 family members in the regulation of chondrocyte apoptosis. Endochondral ossification is an essential process for skeletal development, fracture healing, and pathologic conditions such as osteoarthritis and ectopic ossification (1Kronenberg H.M. Nature. 2003; 423: 332-336Crossref PubMed Scopus (2177) Google Scholar). In this process, chondrocytes first proliferate and then differentiate into mature hypertrophic chondrocytes, which mineralize the surrounding matrix that is finally replaced by bone (1Kronenberg H.M. Nature. 2003; 423: 332-336Crossref PubMed Scopus (2177) Google Scholar). There is controversy as to the cell fate of hypertrophic chondrocytes, and several studies have shown that they undergo apoptosis after terminal differentiation (2Farnum C.E. Wilsman N.J. Anat. Rec. 1987; 219: 221-232Crossref PubMed Scopus (112) Google Scholar, 3Gibson G.J. Kohler W.J. Schaffler M.B. Dev. Dyn. 1995; 203: 468-476Crossref PubMed Scopus (123) Google Scholar, 4Hatori M. Klatte K.J. Teixeira C.C. Shapiro I.M. J. Bone Miner. Res. 1995; 10: 1960-1968Crossref PubMed Scopus (176) Google Scholar). Apoptosis is a form of programmed cell death that is characterized by specific morphological and biochemical features, and is tightly regulated by extracellular stimuli and intracellular signaling pathways (5Kerr J.F. Wyllie A.H. Currie A.R. Br. J. Cancer. 1972; 26: 239-257Crossref PubMed Scopus (12927) Google Scholar). Morphologically, apoptosis is characterized by a series of structural changes in dying cells as follows: blebbing of the plasma membrane, condensation of the cytoplasm and the nucleus, and cellular fragmentation into membrane apoptotic bodies. Biochemically, apoptosis is characterized by the degradation of chromatin, initially into large fragments of 50–300 kb and subsequently into smaller fragments that are monomers and multimers of 200 bases. Not only does apoptosis regulate various aspects of the biological activity, but it also can trigger cancer, autoimmune diseases, and degenerative disorders (6Thompson C.B. Science. 1995; 267: 1456-1462Crossref PubMed Scopus (6205) Google Scholar). Several molecules such as Sox5, -6, and -9 and Runx2 have been reported to regulate proliferation and hypertrophic differentiation of chondrocytes (7Ikeda T. Kamekura S. Mabuchi A. Kou I. Seki S. Takato T. Nakamura K. Kawaguchi H. Ikegawa S. Chung U.I. Arthritis Rheum. 2004; 50: 3561-3573Crossref PubMed Scopus (288) Google Scholar, 8Inada M. Yasui T. Nomura S. Miyake S. Deguchi K. Himeno M. Sato M. Yamagiwa H. Kimura T. Yasui N. Ochi T. Endo N. Kitamura Y. Kishimoto T. Komori T. Dev. Dyn. 1999; 214: 279-290Crossref PubMed Scopus (508) Google Scholar, 9Yoshida C.A. Yamamoto H. Fujita T. Furuichi T. Ito K. Inoue K. Yamana K. Zanma A. Takada K. Ito Y. Komori T. Genes Dev. 2004; 18: 952-963Crossref PubMed Scopus (462) Google Scholar). However, the physiologic and pathologic significance of chondrocyte apoptosis and key molecules that regulate this process remain to be elucidated. Previous studies have shown the possible involvement of cytokines, such as tumor necrosis factor-α and Fas ligand, and hormones, such as glucocorticoids and parathyroid hormone-related peptide (PTHrP), 2The abbreviations used are: PTHrPparathyroid hormone-related peptideRTreverse transcriptioncKOconditional knock-outRNAiRNA interferenceBH3Bcr homology domain 3Zbenzyloxycarbonylfmkfluoromethyl ketoneLMlittermateBH3Bcl-2 homology 3. in the localized hypoxia and increased generation of reactive oxygen species in chondrocyte apoptosis. Shapiro and co-workers (10Boyde A. Shapiro I.M. Histochemistry. 1980; 69: 85-94Crossref PubMed Scopus (40) Google Scholar, 11Mansfield K. Rajpurohit R. Shapiro I.M. J. Cell. Physiol. 1999; 179: 276-286Crossref PubMed Scopus (100) Google Scholar, 12Mansfield K. Teixeira C.C. Adams C.S. Shapiro I.M. Bone (Elmsford). 2001; 28: 1-8Crossref PubMed Scopus (114) Google Scholar) and Poole and co-workers (13Mwale F. Tchetina E. Wu C.W. Poole A.R. J. Bone Miner. Res. 2002; 17: 275-283Crossref PubMed Scopus (81) Google Scholar) reported that the terminal differentiation of chondrocytes is accompanied by marked accumulation of extracellular phosphate ions, which may lead to chondrocyte apoptosis through a plasma membrane phosphate transporter mechanism. The importance of phosphate ions in chondrocyte apoptosis was also confirmed by Demay and co-workers (14Sabbagh Y. Carpenter T.O. Demay M.B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9637-9642Crossref PubMed Scopus (201) Google Scholar), who reported that hypophosphatemia leads to impaired apoptosis of hypertrophic chondrocytes and subsequent expansion of the late hypertrophic chondrocyte layer in vitamin D receptor-null mice, which was reversed by feeding with a high phosphate diet. Although these reports indicate that Pi entry into the cells induces apoptosis in growth plate chondrocytes, the precise molecular mechanism that results in the apoptosis of chondrocytes is still an enigma. parathyroid hormone-related peptide reverse transcription conditional knock-out RNA interference Bcr homology domain 3 benzyloxycarbonyl fluoromethyl ketone littermate Bcl-2 homology 3. There are two distinct signaling pathways of apoptosis in mammals. One is initiated by death receptors (death receptor pathways) (15Nagata S. Cell. 1997; 88: 355-365Abstract Full Text Full Text PDF PubMed Scopus (4561) Google Scholar), and the other is regulated by anti- and pro-apoptotic Bcl-2 family members and involves release of cytochrome c from mitochondria into the cytoplasm (mitochondrial pathways) (16Gross A. McDonnell J.M. Korsmeyer S.J. Genes Dev. 1999; 13: 1899-1911Crossref PubMed Scopus (3268) Google Scholar, 17Strasser A. O'Connor L. Dixit V.M. Annu. Rev. Biochem. 2000; 69: 217-245Crossref PubMed Scopus (1387) Google Scholar). The anti-apoptotic Bcl-2 family members include mammalian Bcl-2, Bcl-xL, and Mcl-1, and more than 20 pro-apoptotic Bcl-2 family proteins have been identified to date in mammals, which are divided into two groups as follows: multidomain members (Bax, Bak, Bok/Mtd, etc.) and BH3 domain-only members (Bid, Bad, Bim, Bik, Puma, Noxa, Bmf, Hrk, Bnip3, Nix, etc.) (18Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (902) Google Scholar). Although the BH3-only family members display tissue-specific distribution patterns, multidomain pro-apoptotic members are ubiquitously expressed, indicating that BH3-only proteins play a tissue/cell-specific and a stimulus-specific role in apoptosis and that the other members play an essential role further downstream (18Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (902) Google Scholar). We report here that the balance between the anti-apoptotic Bcl-2 family member Bcl-xL and the pro-apoptotic family member Bnip3 critically regulates the apoptosis of terminally differentiated chondrocytes both in vitro and in vivo. We first showed that the Bcl-xL/Bnip3 axis plays an essential role in Pi-induced chondrocyte apoptosis in vitro. Subsequently, we generated mutant mice conditionally deficient in the bcl-x gene using the Cre-loxP recombination system, and we found that the hypertrophic chondrocyte layer was shortened in these mice because of increased apoptosis. Plasmids and Viral Vectors—For the production of retrovirus, full-length cDNA of mouse bcl-xL, bcl-2, mcl-1, and bnip3 was amplified by PCR, subcloned into pCR-TOPO II vectors (Invitrogen), and inserted into pMx vectors (19Kitamura T. Int. J. Hematol. 1998; 67: 351-359Crossref PubMed Google Scholar). The production of the retroviral vectors was performed as reported previously (20Morita S. Kojima T. Kitamura T. Gene Ther. 2000; 7: 1063-1066Crossref PubMed Scopus (1377) Google Scholar). Briefly, Plat-E cells (2 × 106 cells) were plated in 60-mm dishes and transfected with 2 μg of pMx vector using FuGENE (Roche Applied Science) on the following day. After 24 h, the medium was replaced with fresh medium, which was collected and used as the retroviral supernatant 48 h after the transfection. The puromycin-resistant gene and blasticidin-resistant gene were inserted into a pMx vector for the selection of stable cells. For gene silencing, RNAi sequences were designed for each of the mouse Bcl-2 family genes. Targeting sequences used were as follows: GCGTTCAGTGATCTAACATCC for Bcl-xL; GGATGCCTTTGTGGAACTATA for Bcl-2; GGACTGGCTTGTCAAACAAAG for Mcl-1; GGTAGGACAGAAACTAGAT for Bim; GGGTCAGCTATTATCTCAA for Bid; GAGCCAAACCTGACCACTA for Puma; GGTGGAGAGTTCAATTAAG for Bik; GAAGAGAAGTTGAAAGTAT for Bnip3; GGAAGAAAGTAAGTCTGAT for Nix; GGAAGGAAGCAGAATTGTA for Hrk; GCTCAAAGAAAGATGGCTT for Bmf; and GCTACGTCCAGGAGCGCACCA for green fluorescent protein. RNAi expression vectors for these genes were constructed with piGENEmU6 vector (for mouse) (iGENE Therapeutics) as described (21Miyagishi M. Taira K. Methods Mol. Biol. 2004; 252: 483-491PubMed Google Scholar). For retrovirus expressing RNAi, the U6 promoter and inserts in piGENE vectors were cloned into pMx vectors. The adenovirus vector expressing FADDDN, which lacks the N-terminal domain that is responsible for recruiting and activating caspase-8 at the death receptor complex (22Newton K. Harris A.W. Bath M.L. Smith K.G. Strasser A. EMBO J. 1998; 17: 706-718Crossref PubMed Scopus (402) Google Scholar), was created as described previously (7Ikeda T. Kamekura S. Mabuchi A. Kou I. Seki S. Takato T. Nakamura K. Kawaguchi H. Ikegawa S. Chung U.I. Arthritis Rheum. 2004; 50: 3561-3573Crossref PubMed Scopus (288) Google Scholar). Adenovirus vectors expressing bacterial Cre recombinase was a generous gift from Kojiro Ueki (University of Tokyo). Adenoviruses were amplified in HEK293 cells and purified with the AdenoX virus purification kit (Clontech). Viral titers were determined by the end point dilution assay, and the viruses were used at 50 multiplicities of infection. DNA Transfection—For the gene transduction or knockdown of Bcl-2 family molecules, growth plate chondrocytes or ATDC5 cells (3 × 105 per well) were seeded onto 60-mm cell culture dishes. After 24 h, the cells were left untreated or treated with the retrovirus vectors together with Polybrene at 8 μg/ml. Thereafter, the medium was replaced with fresh medium containing 1 μg/ml of puromycin and/or 10 μg/ml of blasticidin until they became confluent. Selective overexpression or inhibition of Bcl-2 family member molecules was confirmed by real time RT-PCR or Western blotting. Cell Culture—Growth plate chondrocytes were isolated from the ribs (excluding the sternum) of C57BL6 or bcl-xfl/fl mice embryos (E18.5). About 1 × 105 cells can be obtained from one mouse. They were cultured in high glucose Dulbecco's modified Eagle's medium (Sigma) containing 10% fetal bovine serum (Sigma) and 1% penicillin/streptomycin (Sigma). They are mainly composed of proliferating chondrocytes and were differentiated into hypertrophic chondrocytes and underwent apoptosis in the presence of Pi. Mouse chondrogenic ATDC5 cells were obtained from the RIKEN Cell Bank (Saitama, Japan). The cells were cultured in Dulbecco's modified Eagle's medium/F-12 (1:1) (Sigma) with 5% fetal bovine serum and 1% penicillin/streptomycin. To induce hypertrophic differentiation, ATDC5 cells were cultured in the presence of ITS supplement (10 μg/ml bovine insulin (I), 5.5 μg/ml human transferrin (T), and 5 ng/ml sodium selenite (S)) (Sigma) for 14 days. To induce apoptosis in ATDC5 cells, the medium was changed to α-minimum Eagle's medium, 5% fetal bovine serum supplemented with ascorbic acid 2-phosphate (0.05 mm) and phosphate (NaH2PO4) at concentrations of 0–20 mm for 24–48 h. These cells were maintained at 37 °C in a humidified 5% CO2, 95% air atmosphere. The medium was replaced every other day. Cell Viability Assay—Cell viability was determined by Cell Count Kit-8 (Dojindo) to count the living cells. Briefly, the cells were placed (1 ×105 cells per well) in a 96-well plate. After incubation with the indicated concentrations of Pi for 24 h, 10 μl of kit reagent was added and incubated for an additional 3 h. Cell viability was determined by scanning the samples with a microplate reader at 450 nm. Western Blotting—Western blot analysis was performed with cell extracts from growth plate chondrocytes or ATDC5 cells. Cells were washed twice with ice-cold phosphate-buffered saline, and proteins were extracted with an M-PER, NE-PER (Pierce), or ApoAlert cell fractionation kit (Clontech), according to the manufacturer's instructions. Protein concentrations of the cell lysates were measured with a Protein Assay kit II (Bio-Rad). For Western blot analysis, lysates were fractionated by SDS-PAGE with 7.5–15% Tris-glycine gradient gel or 15% Tris-glycine gel and transferred onto nitrocellulose membranes (Bio-Rad). After blocking with 6% milk/TBS-T, membranes were incubated with primary antibodies to Bcl-xL, Puma, Bik, Bid, cleaved caspase-3 and -7, cleaved lamin A (Cell Signaling Technology), Mcl-1, Hrk (Santa Cruz Biotechnology), Bcl-2, Bim (Pharmingen), Bnip3, Nix, Bmf, FLAG, β-actin (Sigma), cytochrome c, and Cox4 (Clontech), followed by horseradish peroxidase-conjugated goat anti-mouse IgG or goat anti-rabbit IgG (Promega). Immunoreactive bands were visualized with ECL Plus (Amersham Biosciences), according to the manufacturer's instructions. For co-immunoprecipitation, cells were lysed in 0.2% Nonidet P-40 isotonic buffer (0.2% Nonidet P-40, 142.5 mm KCl, 5 mm MgCl2, 1 mm EGTA, 20 mm HEPES, pH 7.5). Cell lysates were immunoprecipitated with anti-Bcl-xL antibody (Cell Signaling Technology) and separated by SDS-PAGE with a 15% Tris-glycine gradient gel. Real Time Quantitative RT-PCR—Total RNA was extracted with ISOGEN (Wako Pure Chemicals Industries, Ltd.), and an aliquot (1 μg) was reverse-transcribed using a Takara RNA PCR kit (avian myeloblastosis virus) version 2.1 (Takara Shuzo Co., Ltd.) to make single-stranded cDNA. PCR was performed on an ABI Prism 7000 sequence detection system (Applied Biosystems Inc.) using QuantiTect SYBR Green PCR Master Mix (Qiagen) according to the manufacturer's instructions. After data collection by the ABI Prism 7000 sequence detection system, the mRNA copy number of a specific gene in the total RNA was calculated, and a standard curve generated with serially diluted plasmids containing PCR amplicon sequences, and normalized to rodent total RNA (Applied Biosystems) with mouse β-actin as an internal control. Standard plasmids were synthesized with a TOPO TA cloning kit (Invitrogen), according to the manufacturer's instruction. Primer Information—Each primer sequence of mouse target genes is described as follows: 5′-TGCAGAGGATGATTGCTGAC-3′ and 5′-GATCAGCTCGGGCACTTTAG-3′ for Bax; 5′-AGGTGACAAGTGACGGTGGT-3′ and 5′-AAGATGCTGTTGGGTTCCAG-3′ for Bak; 5′-ACATGGGGCAAGGTAGTGTC-3′ and 5′-GCTGACCACACACTTGAGGA-3′ for Bok; 5′-TTCGGTGTGATGTACCTGGA-3′ and 5′-CCAGGATGTTGTCACTGTCG-3′ for Bcl-Rambo; 5′-CAGACCCTCAGTCCAGCTTC-3′ and 5′-CGTATGAAGCCGATGGAACT-3′ for Bmf; 5′-ACAACCGCGAGCCAGGTA-3′ and 5′-CAGGGCATAGAACTCGGAAG-3′ for Bcl2l12; 5′-CGGGCAGAGCTACCACCT-3′ and 5′-CGAGCGTTTCTCTCATCACA-3′ for Noxa; 5′-CTCAGCTTGGCAGAACACAT-3′ and 5′-GCAGACACAGGTCCATCTCA-3′ for Bik; 5′-GCCCAGACATTTGGTCAGTT-3′ and 5′-TGCACACACACACAGAGGAA-3′ for Bim; 5′-CGAGCAACAGGTTAGCGAAA-3′ and 5′-TGCACAGGTACGGAATTTTG-3′ for Hrk; 5′-CCACAGCTCTCAGTCAGAAGAA-3′ and 5′-GTGTGCTCAGTCGTTTTCCA-3′ for Nix; 5′-GCCCAGCAGCACTTAGAGTC-3′ and 5′-TGTCGATGCTGCTCTTCTTG-3′ for Puma; 5′-GCTTGGGGATCTACATTGGA-3′ and 5′-TCAGGAACACCGCATTTACA-3′ for Bnip3; 5′-CTCTGCGTTCAGCTTGAGTG-3′ and 5′-CAGAAGCCCACCTACATGGT-3′ for Bid; 5′-AGGGATGGAGGAGGAGCTTA-3′ and 5′-TAGAGTTCCGGGATGTGGAG-3′ for Bad; 5′-GCCAAGACCTGAAACTCTGC-3′; and 5′-GCCATAGCTGAAGTGGAAGC-3′ for col2; 5′-CATAAAGGGCCCACTTGCTA-3′ and 5′-TGGCTGATATTCCTGGTGGT-3′ for col10; 5′-AGATGTGGATCAGCAAGCAG-3′;and 5′-GCGCAAGTTAGGTTTTGTCA-3′ for β-actin. Mice—Mice carrying the bcl-x gene with two loxP sequences at the promoter region and the second intron (bcl-xfl/fl mice) were generated as reported previously (23Rucker III, E.B. Dierisseau P. Wagner K.U. Garrett L. Wynshaw-Boris A. Flaws J.A. Hennighausen L. Mol. Endocrinol. 2000; 14: 1038-1052Crossref PubMed Scopus (177) Google Scholar). The mice are on a 129SvEv and C57BL6 mixed background. The presence of the floxed bcl-x gene was determined by PCR around the 5′ loxP site using the primers 5′-CGG TTGCCT AGC AAC GGG GC-3′ and 5′-CTC CCA CAG TGG AGA CCTCG-3′, giving a wild-type band of 200 bp and a floxed gene product of 300 bp. These bcl-xfl/fl mice have been used successfully to examine the role of Bcl-xL in a variety of cell types, including those in the liver, ovary, mammary gland, and substantia nigra, as well as in erythroid cells and dendritic cells (23Rucker III, E.B. Dierisseau P. Wagner K.U. Garrett L. Wynshaw-Boris A. Flaws J.A. Hennighausen L. Mol. Endocrinol. 2000; 14: 1038-1052Crossref PubMed Scopus (177) Google Scholar, 24Hon H. Rucker III, E.B. Hennighausen L. Jacob J. J. Immunol. 2004; 173: 4425-4432Crossref PubMed Scopus (47) Google Scholar, 25Riedlinger G. Okagaki R. Wagner K.U. Rucker III, E.B. Oka T. Miyoshi K. Flaws J.A. Hennighausen L. Biol. Reprod. 2002; 66: 438-444Crossref PubMed Scopus (24) Google Scholar, 26Savitt J.M. Jang S.S. Mu W. Dawson V.L. Dawson T.M. J. Neurosci. 2005; 25: 6721-6728Crossref PubMed Scopus (115) Google Scholar, 27Wagner K.U. Claudio E. Rucker III, E.B. Riedlinger G. Broussard C. Schwartzberg P.L. Siebenlist U. Hennighausen L. Development (Camb.). 2000; 127: 4949-4958Crossref PubMed Google Scholar, 28Walton K.D. Wagner K.U. Rucker III, E.B. Shillingford J.M. Miyoshi K. Hennighausen L. Mech. Dev. 2001; 109: 281-293Crossref PubMed Scopus (70) Google Scholar). To generate chondrocyte-specific bcl-x knock-out mice, bcl-xfl/fl mice were crossed with type II collagen (Col2a1)-Cre transgenic mice, which express the Cre recombinase gene under the control of the col2a1 gene promoter (29Ovchinnikov D.A. Deng J.M. Ogunrinu G. Behringer R.R. Genesis. 2000; 26: 145-146Crossref PubMed Scopus (312) Google Scholar). Col2a1-Cre+/- bcl-xfl/fl (cKO), and Col2a1-Cre-/- bcl-xfl/fl (normal littermates) mice were generated by mating Col2a1-Cre+/-bcl-xfl/+ male mice with Col2a1-Cre-/- bcl-xfl/fl female mice. All animals were housed under specific pathogen-free conditions and treated with humane care under approval from the Animal Care and Use Committee of the University of Tokyo. Histological Analysis—Tissues were fixed in 4% paraformaldehyde/phosphate-buffered saline, decalcified in 10% EDTA, embedded in paraffin, and cut into sections of 5-μm thickness. Hematoxylin and eosin staining as well as von Kossa staining were performed according to the standard procedure. For immunohistochemistry, sections were incubated overnight at 4 °C with primary antibodies against Bcl-xL (1:200; Cell Signaling Technology), Bnip3 (1:200; Sigma), COL10 (1:500; LSL) and cleaved caspase-7 (1:100; Cell Signaling Technology). The localization of the antigens was visualized by incubation with horseradish peroxidase-conjugated secondary antibodies (Promega) followed by incubation with 3,3′-diaminobenzidine according to the manufacturer's protocol. For fluorescent visualization, a secondary antibody conjugated with Alexa 488 (Molecular Probes) was used. A bone radiograph of whole bodies, femurs, and tibiae was taken with a soft x-ray apparatus (SOFTEX, CMB-2, Tokyo, Japan). Statistical Analysis—Statistical analyses were performed using two-tailed unpaired Student's t test for the real time PCR and cell viability assay. A p value of <0.05 was considered to be statistically significant. The results are presented as means ± S.D. Pi Induces Apoptosis of Chondrocytes through Mitochondrial Pathways—We first evaluated the effect of Pi on the viability of primary chondrocytes in vitro. When mouse primary chondrocytes were stimulated with Pi, a dose- and time-dependent increase in cell death was observed (Fig. 1A). Only about 40% of the chondrocytes survived 24 h after stimulation with 20 mm Pi. Phosphonoformic acid, which inhibits Pi entry into the cells, almost completely restored Pi-induced cell death, as reported previously (data not shown), indicating that the intracellular Pi transport stimulated chondrocyte cell death. In addition, administration of the caspase inhibitor Z-VAD-fmk dose-dependently blocked cell death (Fig. 1B), indicating that Pi-induced cell death is a caspase-dependent process, i.e. apoptosis. Next, we investigated the molecular mechanisms that lead to hypertrophic differentiation, mineralization, and apoptosis of chondrocytes, using a chondrogenic cell line, ATDC5. ATDC5 cells express markers of hypertrophic chondrocytes and mineralize the surrounding matrix under ITS treatment and subsequent Pi stimulation (30Magne D. Bluteau G. Faucheux C. Palmer G. Vignes-Colombeix C. Pilet P. Rouillon T. Caverzasio J. Weiss P. Daculsi G. Guicheux J. J. Bone Miner. Res. 2003; 18: 1430-1442Crossref PubMed Scopus (121) Google Scholar, 31Shukunami C. Shigeno C. Atsumi T. Ishizeki K. Suzuki F. Hiraki Y. J. Cell Biol. 1996; 133: 457-468Crossref PubMed Scopus (346) Google Scholar). During ITS treatment, the expression of a chondrocyte marker type II collagen increased earlier than day 7 and remained high levels on day 14. In contrast, the expression of a hypertrophic chondrocyte marker type X collagen was low on day 7, and gradually increased thereafter, and was highly expressed on day 14 (Fig. 1C). Neither mineralization nor caspase activation was observed (Fig. 1D). After Pi stimulation, the cells underwent mineralization and apoptosis within 24 h (Fig. 1E). To examine the localization of cytochrome c in the course of the apoptosis of ATDC5 cells, we performed cell fractionation experiments. Cytochrome c was mainly detected in the mitochondrial fractions, which is positive for Cox4, before Pi stimulation, and was released into the cytoplasm in response to Pi stimulation (Fig. 1F). The differentiation and apoptosis of chondrocytes are independently regulated since overexpression of ranx2 or dominant negative ranx2 did not affect Pi-induced apoptosis. Adenovirus vector-mediated introduction of dominant negative FADD (FADDDN), which blocks death receptor-initiated apoptosis, almost completely abolished tumor necrosis factor-α-induced cell death (data not shown) but did not affect Pi-induced apoptosis in ATDC5 cells (Fig. 1G). These results suggest that the mitochondrial pathway, but not the death receptor pathway, is mainly involved in the Pi-induced apoptosis of ATDC5 cells. Bcl-xL Regulates Chondrocyte Apoptosis—Because mitochondrial pathways are primarily regulated by Bcl-2 family member proteins, we next examined the expression levels and functions of Bcl-2 family molecules during the differentiation and apoptosis of chondrocytes. We first examined the effect of gain or loss of function of anti-apoptotic Bcl-2 family members, Bcl-2, Bcl-xL, and Mcl-1, on the cell viability of ATDC5 cells. Among these three molecules, Bcl-xL most efficiently suppressed Pi-induced chondrocyte apoptosis when overexpressed by retroviral vectors (Fig. 2A). Conversely, the knockdown of bcl-xL gene through RNAi efficiently reduced the cell viability compared with the knockdown of the bcl-2 or mcl-1 gene (Fig. 2B). Western blot analysis revealed that cleaved caspase-7 expression was suppressed by Bcl-xL overexpression and increased by its knockdown in differentiated ATDC5 cells treated with Pi (Fig. 2, C and D). The important role of Bcl-xL was further confirmed by the experiments using primary chondrocytes obtained from bcl-xfl/fl mice. Adenovirus vector-mediated overexpression of Cre recombinase efficiently down-regulated bcl-x gene in primary chondrocytes obtained from bcl-xfl/fl mice and induced caspase-7 activation (Fig. 2E, left) in the cells, and they became apoptotic morphologically (Fig. 2E, right). These results suggest that Bcl-xL primarily maintains the viability of chondrocytes. However, the expression levels of Bcl-xL did not appear to change in the course of chondrocytic differentiation or Pi-induced apoptosis in ATDC5 cells (Fig. 2F). In addition, immunohistological examination revealed that Bcl-xL is uniformly expressed in growth plate chondrocytes (Fig. 2G). It should be noted that the expression of another antiapoptotic member Bcl-2 increased in response to Pi stimulation, suggesting an important role of the molecule in regulating chondrocyte apoptosis (Fig. 2F). However, the increased level of Bcl-2 was not enough to suppress Pi-induced apoptosis of ATDC5 cell. Bnip3, a Pro-apoptotic Bcl-2 Family Member Protein, Promotes the Pi-induced Apoptosis of Chondrocytes—The fact that the expression level of Bcl-xL was not affected by Pi stimulation and that Bcl-xL is uniformly expressed in the chondrocyte layers prompted us to investigate the role of pro-apoptotic molecule(s) that may inhibit the anti-apoptotic function of Bcl-xL. Among 15 pro-apoptotic Bcl-2 family members, six molecules (Puma, Bid, Hrk, Bnip3, Bad, and Nix) increased in expression level during the course of hypertrophic differentiation (Fig. 3A), and two of them (Bnip3 and Bmf) in response to Pi stimulation (Fig. 3B). As shown in Fig. 3C, gene silencing of the proapoptotic BH3-only molecule bnip3 significantly suppressed Pi-induced apoptosis. Western blot analysis revealed that the protein levels of Bnip3 increased in response to Pi stimulation, followed by caspase-7 activation (Fig. 3D). Immunohistological examination of murine growth plates revealed that Bnip3 expression was exclusively localized in the prehypertrophic and hypertrophic layers of chondrocytes (Fig. 3E). Although overexpression of Bnip3 increased Pi-induced chondrocyte apoptosis, its overexpression alone failed to induce chondrocyte apoptosis in the absence of Pi (data not shown). Bnip3 Associates with Bcl-xL and Attenuates the Anti-apoptotic Effect of Bcl-xL on Chondrocytes—We then investigated the molecular interaction between Bcl-xL and Bnip3 in chondrocytes. Earlier studies have shown that Bnip3 heterodimerizes with Bcl-2 and Bcl-xL and facilitates cell death via mitochondrial pathways (32Ray R. Chen G. Vande Velde C. Cizeau J. Park J.H. Reed J.C. Gietz R.D. Greenberg A.H. J. Biol. Chem. 2000; 275: 1439-1448Abstract Full Text Full Text PDF PubMed Scopus (291) Google Scholar). As shown in Fig. 4A, Bnip3 was co-immunoprecipitated with Bcl-xL in Pi-treated chondrocytes. The susceptibility to apoptosis by bcl-xL knockdown was partially restored by simultaneous silencing of bnip3 (Fig. 4B). Conversely, overexpression of Bnip3 promoted Pi-induced cell death, which was almost completely rescued by the simultaneous transduction of Bcl-xL but not by that of Bcl-2 or Mcl-1 (Fig. 4C). Taken together, Bnip3 is up-regulated and associates with Bcl-xL in chondrocytes in response to Pi stimulation, impairs the anti-apoptotic function of Bcl-xL, and consequently causes apoptosis in these cells. Chondrocyte-specific Bcl-x Knock-out Mice Exhibit a Reduction in the Hypertrophic Layer of Growth Plate Chondrocytes—To further confirm the essential role of the Bcl-xL/Bnip3 axis in chondrocytes, we generated chondrocyte-specific conditional knock-out (cKO) mice of the bcl-x gene by mating bcl-xfl/fl mice with Col2a1-Cre transgenic mice, in which Cre recombinase is specifically expressed in chondrocytes under the control of the col2a1 promoter. The cKO mice (Col2a1-Cre+/- bcl-xfl/fl mice) were born at approximately a Mendelian frequency. Bcl-xL expression was markedly reduced in chondrocytes of the cKO mice, whereas its expression in othe" @default.
• W2018713088 created "2016-06-24" @default.
• W2018713088 creator A5001119229 @default.
• W2018713088 creator A5001575264 @default.
• W2018713088 creator A5035411012 @default.
• W2018713088 creator A5039464801 @default.
• W2018713088 creator A5046319105 @default.
• W2018713088 creator A5047079133 @default.
• W2018713088 creator A5048462960 @default.
• W2018713088 creator A5049052056 @default.
• W2018713088 creator A5055584432 @default.
• W2018713088 creator A5057533040 @default.
• W2018713088 creator A5062385614 @default.
• W2018713088 creator A5070757616 @default.
• W2018713088 creator A5073995085 @default.
• W2018713088 creator A5077281223 @default.
• W2018713088 date "2008-09-01" @default.
• W2018713088 modified "2023-10-16" @default.
• W2018713088 title "Pivotal Role of Bcl-2 Family Proteins in the Regulation of Chondrocyte Apoptosis" @default.
• W2018713088 cites W17552899 @default.
• W2018713088 cites W1963714463 @default.
• W2018713088 cites W1981966393 @default.
• W2018713088 cites W1991865867 @default.
• W2018713088 cites W1995417238 @default.
• W2018713088 cites W2000596150 @default.
• W2018713088 cites W2002503549 @default.
• W2018713088 cites W2016192667 @default.
• W2018713088 cites W2019980431 @default.
• W2018713088 cites W2020396176 @default.
• W2018713088 cites W2022433413 @default.
• W2018713088 cites W2038461954 @default.
• W2018713088 cites W2039434926 @default.
• W2018713088 cites W2042932723 @default.
• W2018713088 cites W2048371464 @default.
• W2018713088 cites W2049232422 @default.
• W2018713088 cites W2052853635 @default.
• W2018713088 cites W2056418403 @default.
• W2018713088 cites W2058855556 @default.
• W2018713088 cites W2063230401 @default.
• W2018713088 cites W2065463926 @default.
• W2018713088 cites W2066829203 @default.
• W2018713088 cites W2068592712 @default.
• W2018713088 cites W2073098992 @default.
• W2018713088 cites W2076627274 @default.
• W2018713088 cites W2088288312 @default.
• W2018713088 cites W2090077833 @default.
• W2018713088 cites W2092566326 @default.
• W2018713088 cites W2094998020 @default.
• W2018713088 cites W2099437115 @default.
• W2018713088 cites W2099931271 @default.
• W2018713088 cites W2101873251 @default.
• W2018713088 cites W2102059629 @default.
• W2018713088 cites W2103461739 @default.
• W2018713088 cites W2115602286 @default.
• W2018713088 cites W2122433264 @default.
• W2018713088 cites W2131727825 @default.
• W2018713088 cites W2132411546 @default.
• W2018713088 cites W2150699859 @default.
• W2018713088 cites W2161201047 @default.
• W2018713088 cites W2170335058 @default.
• W2018713088 cites W4236608613 @default.
• W2018713088 cites W4239718055 @default.
• W2018713088 doi "https://doi.org/10.1074/jbc.m800933200" @default.
• W2018713088 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2546555" @default.
• W2018713088 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18632667" @default.
• W2018713088 hasPublicationYear "2008" @default.
• W2018713088 type Work @default.
• W2018713088 sameAs 2018713088 @default.
• W2018713088 citedByCount "34" @default.
• W2018713088 countsByYear W20187130882012 @default.
• W2018713088 countsByYear W20187130882013 @default.
• W2018713088 countsByYear W20187130882014 @default.
• W2018713088 countsByYear W20187130882015 @default.
• W2018713088 countsByYear W20187130882016 @default.
• W2018713088 countsByYear W20187130882017 @default.
• W2018713088 countsByYear W20187130882018 @default.
• W2018713088 countsByYear W20187130882019 @default.
• W2018713088 countsByYear W20187130882021 @default.
• W2018713088 countsByYear W20187130882022 @default.
• W2018713088 crossrefType "journal-article" @default.
• W2018713088 hasAuthorship W2018713088A5001119229 @default.
• W2018713088 hasAuthorship W2018713088A5001575264 @default.
• W2018713088 hasAuthorship W2018713088A5035411012 @default.
• W2018713088 hasAuthorship W2018713088A5039464801 @default.
• W2018713088 hasAuthorship W2018713088A5046319105 @default.
• W2018713088 hasAuthorship W2018713088A5047079133 @default.
• W2018713088 hasAuthorship W2018713088A5048462960 @default.
• W2018713088 hasAuthorship W2018713088A5049052056 @default.
• W2018713088 hasAuthorship W2018713088A5055584432 @default.
• W2018713088 hasAuthorship W2018713088A5057533040 @default.
• W2018713088 hasAuthorship W2018713088A5062385614 @default.
• W2018713088 hasAuthorship W2018713088A5070757616 @default.
• W2018713088 hasAuthorship W2018713088A5073995085 @default.
• W2018713088 hasAuthorship W2018713088A5077281223 @default.
• W2018713088 hasBestOaLocation W20187130881 @default.
• W2018713088 hasConcept C149150037 @default.
• W2018713088 hasConcept C185592680 @default.
• W2018713088 hasConcept C190283241 @default.

• next