FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2019002699> ?p ?o ?g. }

• W2019002699 endingPage "106" @default.
• W2019002699 startingPage "99" @default.
• W2019002699 abstract "The orphan nuclear receptor estrogen-related receptor (ERR) α is a downstream effector of the transcriptional coactivator PGC-1α in the regulation of genes important for mitochondrial oxidative capacity. PGC-1α is also a potent activator of the transcriptional program required for hepatic gluconeogenesis, and in particular of the key gluconeogenic enzyme phosphoenolpyruvate carboxykinase (PEPCK). We report here that the regulatory sequences of the PEPCK gene harbor a functional ERRα binding site. However, in contrast to the co-stimulating effects of ERRα and PGC-1α on mitochondrial gene expression, ERRα acts as a transcriptional repressor of the PEPCK gene. Suppression of ERRα expression by small interfering RNA leads to reduced binding of ERRα to the endogenous PEPCK gene, and an increase in promoter occupancy by PGC-1α, suggesting that part of the ERRα function at this gene is to antagonize the action of PGC-1α. In agreement with the in vitro studies, animals that lack ERRα show increased expression of gluconeogenic genes, including PEPCK and glycerol kinase, but decreased expression of mitochondrial genes, such as ATP synthase subunit β and cytochrome c-1. Our findings suggest that ERRα has opposing effects on genes important for mitochondrial oxidative capacity and gluconeogenesis. The different functions of ERRα in the regulation of these pathways suggest that enhancing ERRα activity could have beneficial effects on glucose metabolism in diabetic subjects by two distinct mechanisms: increasing mitochondrial oxidative capacity in peripheral tissues and liver, and suppressing hepatic glucose production. The orphan nuclear receptor estrogen-related receptor (ERR) α is a downstream effector of the transcriptional coactivator PGC-1α in the regulation of genes important for mitochondrial oxidative capacity. PGC-1α is also a potent activator of the transcriptional program required for hepatic gluconeogenesis, and in particular of the key gluconeogenic enzyme phosphoenolpyruvate carboxykinase (PEPCK). We report here that the regulatory sequences of the PEPCK gene harbor a functional ERRα binding site. However, in contrast to the co-stimulating effects of ERRα and PGC-1α on mitochondrial gene expression, ERRα acts as a transcriptional repressor of the PEPCK gene. Suppression of ERRα expression by small interfering RNA leads to reduced binding of ERRα to the endogenous PEPCK gene, and an increase in promoter occupancy by PGC-1α, suggesting that part of the ERRα function at this gene is to antagonize the action of PGC-1α. In agreement with the in vitro studies, animals that lack ERRα show increased expression of gluconeogenic genes, including PEPCK and glycerol kinase, but decreased expression of mitochondrial genes, such as ATP synthase subunit β and cytochrome c-1. Our findings suggest that ERRα has opposing effects on genes important for mitochondrial oxidative capacity and gluconeogenesis. The different functions of ERRα in the regulation of these pathways suggest that enhancing ERRα activity could have beneficial effects on glucose metabolism in diabetic subjects by two distinct mechanisms: increasing mitochondrial oxidative capacity in peripheral tissues and liver, and suppressing hepatic glucose production. Nuclear receptors mediate the effects of many hormonal and dietary signals. These receptors bind to specific genomic sequences, recruit coactivators or corepressors of transcription, and regulate accordingly the expression of genes important for a wide range of biological processes, including development, reproduction, and metabolism (for reviews, see Refs. 1McKenna N.J. O'Malley B.W. Cell. 2002; 108: 465-474Abstract Full Text Full Text PDF PubMed Scopus (1255) Google Scholar and 2Glass C.K. McDonnell D.P. Mol. Cell. 2004; 13: 459-467Abstract Full Text Full Text PDF PubMed Scopus (2) Google Scholar and references therein). The estrogen-related receptor (ERR) 2The abbreviations used are: ERRestrogen-related receptorPEPCKphosphoenolpyruvate carboxykinaseATP5BATP synthase subunit βCYCScytochrome c somaticPGC-1peroxisome-proliferator activator receptor γ coactivator-1siRNAsmall interfering RNAGFPgreen fluorescent proteingAF3glucocorticoid accessory factor 3ERREERR response elementCOUP-TFchicken ovalbumin upstream promoter transcription factorHNF-4hepatic nuclear factor 4. α is a nuclear receptor with high sequence similarity to the estrogen receptors, and the founding member of a small family of orphan receptors that also includes ERRβ and ERRγ (3Giguere V. Yang N. Segui P. Evans R.M. Nature. 1988; 331: 91-94Crossref PubMed Scopus (700) Google Scholar, 4Hong H. Yang L. Stallcup M.R. J. Biol. Chem. 1999; 274: 22618-22626Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar). Despite their similarity to estrogen receptors, ERRs are not activated by estrogens or other known natural agonists (reviewed in Refs. 5Giguere V. Trends Endocrinol. Metab. 2002; 13: 220-225Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar and 6Horard B. Vanacker J.M. J. Mol. Endocrinol. 2003; 31: 349-357Crossref PubMed Scopus (201) Google Scholar). Structural studies of ERRα and ERRγ indicate that these receptors can achieve a transcriptionally active conformation in the absence of a ligand, and suggest that ERR activity may not be subject to regulation by small lipophilic molecules (7Kallen J. Schlaeppi J.M. Bitsch F. Filipuzzi I. Schilb A. Riou V. Graham A. Strauss A. Geiser M. Fournier B. J. Biol. Chem. 2004; 279: 49330-49337Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar, 8Greschik H. Wurtz J.M. Sanglier S. Bourguet W. van Dorsselaer A. Moras D. Renaud J.P. Mol. Cell. 2002; 9: 303-313Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar). As an alternative mechanism of regulation, ERRα activity is controlled by the availability of specific coactivators that act as protein ligands (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 10Kamei Y. Ohizumi H. Fujitani Y. Nemoto T. Tanaka T. Takahashi N. Kawada T. Miyoshi M. Ezaki O. Kakizuka A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12378-12383Crossref PubMed Scopus (309) Google Scholar, 11Huss J.M. Kopp R.P. Kelly D.P. J. Biol. Chem. 2002; 277: 40265-40274Abstract Full Text Full Text PDF PubMed Scopus (401) Google Scholar). Notably, the transactivation function of ERRα is weak in many cells where other nuclear receptors are active, and is greatly enhanced by expression of the transcriptional coactivators PGC-1α or PGC-1β (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 10Kamei Y. Ohizumi H. Fujitani Y. Nemoto T. Tanaka T. Takahashi N. Kawada T. Miyoshi M. Ezaki O. Kakizuka A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12378-12383Crossref PubMed Scopus (309) Google Scholar, 11Huss J.M. Kopp R.P. Kelly D.P. J. Biol. Chem. 2002; 277: 40265-40274Abstract Full Text Full Text PDF PubMed Scopus (401) Google Scholar). PGC-1α not only activates the transcriptional function of ERRα but also induces the expression of this receptor (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar). Consistent with the ability of PGC-1α to induce ERRα activity and expression, PGC-1α and ERRα show similar spatial and temporal expression patterns in vivo. They are co-expressed at high levels in tissues with high energy demands, and are co-induced in a tissue-specific manner in response to signals like fasting, exposure to cold, and physical exercise (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 12Ichida M. Nemoto S. Finkel T. J. Biol. Chem. 2002; 277: 50991-50995Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar, 13Cartoni R. Leger B. Hock M.B. Praz M. Crettenand A. Pich S. Ziltener J.L. Luthi F. Deriaz O. Zorzano A. Gobelet C. Kralli A. Russell A.P. J. Physiol. 2005; 567: 349-358Crossref PubMed Scopus (328) Google Scholar). estrogen-related receptor phosphoenolpyruvate carboxykinase ATP synthase subunit β cytochrome c somatic peroxisome-proliferator activator receptor γ coactivator-1 small interfering RNA green fluorescent protein glucocorticoid accessory factor 3 ERR response element chicken ovalbumin upstream promoter transcription factor hepatic nuclear factor 4. Several recent studies support a role for ERRα in the regulation of mitochondrial oxidative capacity. Binding sites for ERRα (ERRα response elements) are present in genes with roles in fatty acid oxidation (PPARA and ACADM), mitochondrial biogenesis (NRF2 and NRF1), the citric acid cycle (IDH3A), the respiratory chain (CYCS and ATP5B), and mitochondrial dynamics and function (MFN2) (13Cartoni R. Leger B. Hock M.B. Praz M. Crettenand A. Pich S. Ziltener J.L. Luthi F. Deriaz O. Zorzano A. Gobelet C. Kralli A. Russell A.P. J. Physiol. 2005; 567: 349-358Crossref PubMed Scopus (328) Google Scholar, 14Sladek R. Bader J.A. Giguere V. Mol. Cell. Biol. 1997; 17: 5400-5409Crossref PubMed Google Scholar, 15Vega R.B. Kelly D.P. J. Biol. Chem. 1997; 272: 31693-31699Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar, 16Schreiber S.N. Emter R. Hock M.B. Knutti D. Cardenas J. Podvinec M. Oakeley E.J. Kralli A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6472-6477Crossref PubMed Scopus (515) Google Scholar, 17Mootha V.K. Handschin C. Arlow D. Xie X. St. Pierre J. Sihag S. Yang W. Altshuler D. Puigserver P. Patterson N. Willy P.J. Schulman I.G. Heyman R.A. Lander E.S. Spiegelman B.M. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6570-6575Crossref PubMed Scopus (555) Google Scholar, 18Huss J.M. Torra I.P. Staels B. Giguere V. Kelly D.P. Mol. Cell. Biol. 2004; 24: 9079-9091Crossref PubMed Scopus (397) Google Scholar). At these targets, ERRα co-operates with PGC-1α to induce gene expression (16Schreiber S.N. Emter R. Hock M.B. Knutti D. Cardenas J. Podvinec M. Oakeley E.J. Kralli A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6472-6477Crossref PubMed Scopus (515) Google Scholar, 17Mootha V.K. Handschin C. Arlow D. Xie X. St. Pierre J. Sihag S. Yang W. Altshuler D. Puigserver P. Patterson N. Willy P.J. Schulman I.G. Heyman R.A. Lander E.S. Spiegelman B.M. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6570-6575Crossref PubMed Scopus (555) Google Scholar, 18Huss J.M. Torra I.P. Staels B. Giguere V. Kelly D.P. Mol. Cell. Biol. 2004; 24: 9079-9091Crossref PubMed Scopus (397) Google Scholar). Consistent with the ERRα functions observed in cell culture systems, ERRα null mice show defects in lipid metabolism and decreased expression of genes coding for fatty acid oxidation enzymes and oxidative phosphorylation components (18Huss J.M. Torra I.P. Staels B. Giguere V. Kelly D.P. Mol. Cell. Biol. 2004; 24: 9079-9091Crossref PubMed Scopus (397) Google Scholar, 19Luo J. Sladek R. Carrier J. Bader J.A. Richard D. Giguere V. Mol. Cell. Biol. 2003; 23: 7947-7956Crossref PubMed Scopus (315) Google Scholar). The transcriptional coactivator PGC-1α coordinates, in a signal- and tissue-specific manner, the induction of genes important for multiple adaptive metabolic responses (reviewed in Ref. 20Lin J. Handschin C. Spiegelman B.M. Cell Metab. 2005; 1: 361-370Abstract Full Text Full Text PDF PubMed Scopus (1692) Google Scholar). PGC-1α functions in adaptive thermogenesis in brown adipose tissue (21Puigserver P. Wu Z. Park C.W. Graves R. Wright M. Spiegelman B.M. Cell. 1998; 92: 829-839Abstract Full Text Full Text PDF PubMed Scopus (3101) Google Scholar, 22Lin J. Wu P.H. Tarr P.T. Lindenberg K.S. St. Pierre J. Zhang C.Y. Mootha V.K. Jager S. Vianna C.R. Reznick R.M. Cui L. Manieri M. Donovan M.X. Wu Z. Cooper M.P. Fan M.C. Rohas L.M. Zavacki A.M. Cinti S. Shulman G.I. Lowell B.B. Krainc D. Spiegelman B.M. Cell. 2004; 119: 121-135Abstract Full Text Full Text PDF PubMed Scopus (1008) Google Scholar, 23Leone T.C. Lehman J.J. Finck B.N. Schaeffer P.J. Wende A.R. Boudina S. Courtois M. Wozniak D.F. Sambandam N. Bernal-Mizrachi C. Chen Z. Holloszy J.O. Medeiros D.M. Schmidt R.E. Saffitz J.E. Abel E.D. Semenkovich C.F. Kelly D.P. PLoS Biol. 2005; 3: e101Crossref PubMed Scopus (781) Google Scholar), and fiber-type specification in skeletal muscle (24Lin J. Wu H. Tarr P.T. Zhang C.Y. Wu Z. Boss O. Michael L.F. Puigserver P. Isotani E. Olson E.N. Lowell B.B. Bassel-Duby R. Spiegelman B.M. Nature. 2002; 418: 797-801Crossref PubMed Scopus (2072) Google Scholar), two processes that involve the regulation of mitochondrial biogenesis and function. PGC-1α also regulates gluconeogenesis in liver (25Herzig S. Long F. Jhala U.S. Hedrick S. Quinn R. Bauer A. Rudolph D. Schutz G. Yoon C. Puigserver P. Spiegelman B. Montminy M. Nature. 2001; 413: 179-183Crossref PubMed Scopus (1145) Google Scholar, 26Yoon J.C. Puigserver P. Chen G. Donovan J. Wu Z. Rhee J. Adelmant G. Stafford J. Kahn C.R. Granner D.K. Newgard C.B. Spiegelman B.M. Nature. 2001; 413: 131-138Crossref PubMed Scopus (1528) Google Scholar, 27Koo S.H. Satoh H. Herzig S. Lee C.H. Hedrick S. Kulkarni R. Evans R.M. Olefsky J. Montminy M. Nat. Med. 2004; 10: 530-534Crossref PubMed Scopus (479) Google Scholar). The induction of hepatic gluconeogenesis during periods of fasting is an essential adaptive response that requires the enhanced transcription of genes encoding rate-determining gluconeogenic enzymes, such as phosphoenolpyruvate carboxykinase (PEPCK) and glucose-6-phosphatase (28Sasaki K. Cripe T.P. Koch S.R. Andreone T.L. Petersen D.D. Beale E.G. Granner D.K. J. Biol. Chem. 1984; 259: 15242-15251Abstract Full Text PDF PubMed Google Scholar, 29Pilkis S.J. Granner D.K. Annu. Rev. Physiol. 1992; 54: 885-909Crossref PubMed Scopus (711) Google Scholar, 30Hanson R.W. Reshef L. Annu. Rev. Biochem. 1997; 66: 581-611Crossref PubMed Scopus (634) Google Scholar, 31She P. Shiota M. Shelton K.D. Chalkley R. Postic C. Magnuson M.A. Mol. Cell. Biol. 2000; 20: 6508-6517Crossref PubMed Scopus (196) Google Scholar). Transcription of the PEPCK gene is tightly regulated by hormones, including glucagon, insulin, and glucocorticoids, via complex mechanisms that involve several transcription factors, such as HNF-4α, COUP-TFI, forkhead factors, the glucocorticoid receptor, C/EBPs, cAMP-response element-binding protein, and AP-1 (32Hall R.K. Sladek F.M. Granner D.K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 412-416Crossref PubMed Scopus (199) Google Scholar, 33Wang J.C. Stromstedt P.E. O'Brien R.M. Granner D.K. Mol. Endocrinol. 1996; 10: 794-800PubMed Google Scholar, 34Imai E. Miner J.N. Mitchell J.A. Yamamoto K.R. Granner D.K. J. Biol. Chem. 1993; 268: 5353-5356Abstract Full Text PDF PubMed Google Scholar, 35Park E.A. Roesler W.J. Liu J. Klemm D.J. Gurney A.L. Thatcher J.D. Shuman J. Friedman A. Hanson R.W. Mol. Cell. Biol. 1990; 10: 6264-6272Crossref PubMed Scopus (174) Google Scholar). PGC-1α, whose hepatic expression is increased upon fasting, contributes to the induction of the gluconeogenic genes PEPCK and glucose-6-phosphatase, via its interactions with HNF-4α, glucocorticoid receptor, and the forkhead factor FOXO1 (26Yoon J.C. Puigserver P. Chen G. Donovan J. Wu Z. Rhee J. Adelmant G. Stafford J. Kahn C.R. Granner D.K. Newgard C.B. Spiegelman B.M. Nature. 2001; 413: 131-138Crossref PubMed Scopus (1528) Google Scholar, 36Boustead J.N. Stadelmaier B.T. Eeds A.M. Wiebe P.O. Svitek C.A. Oeser J.K. O'Brien R.M. Biochem. J. 2003; 369: 17-22Crossref PubMed Scopus (57) Google Scholar, 37Puigserver P. Rhee J. Donovan J. Walkey C.J. Yoon J.C. Oriente F. Kitamura Y. Altomonte J. Dong H. Accili D. Spiegelman B.M. Nature. 2003; 423: 550-555Crossref PubMed Scopus (1196) Google Scholar, 38Rhee J. Inoue Y. Yoon J.C. Puigserver P. Fan M. Gonzalez F.J. Spiegelman B.M. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4012-4017Crossref PubMed Scopus (476) Google Scholar). Importantly, increased expression of PGC-1α in the liver of fed animals is sufficient to inappropriately induce gluconeogenic enzymes and elevate blood glucose levels, a finding that underscores the possible involvement of this coactivator in the elevation of hepatic glucose production in the diabetic state (26Yoon J.C. Puigserver P. Chen G. Donovan J. Wu Z. Rhee J. Adelmant G. Stafford J. Kahn C.R. Granner D.K. Newgard C.B. Spiegelman B.M. Nature. 2001; 413: 131-138Crossref PubMed Scopus (1528) Google Scholar). Whereas a positive role of ERRα in PGC-1α-induced expression of mitochondrial genes has been established, the role of ERRα in the regulation of genes involved in hepatic glucose metabolism, including PGC-1α-stimulated gluconeogenesis, is not clear. ERRα is induced in the liver in response to fasting, but has been proposed to either be a repressor of general PGC-1α transcriptional activity (12Ichida M. Nemoto S. Finkel T. J. Biol. Chem. 2002; 277: 50991-50995Abstract Full Text Full Text PDF PubMed Scopus (125) Google Scholar) or to have no effect on gluconeogenic enzymes (17Mootha V.K. Handschin C. Arlow D. Xie X. St. Pierre J. Sihag S. Yang W. Altshuler D. Puigserver P. Patterson N. Willy P.J. Schulman I.G. Heyman R.A. Lander E.S. Spiegelman B.M. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6570-6575Crossref PubMed Scopus (555) Google Scholar). Notably, the PEPCK gene promoter contains a sequence that resembles an ERRE and that overlaps with a site (glucocorticoid accessory factor 3 (gAF3)) critical for the activation of PEPCK transcription by PGC-1α (45Herzog B. Hall R.K. Wang X.L. Waltner-Law M. Granner D.K. Mol. Endocrinol. 2004; 18: 807-819Crossref PubMed Scopus (39) Google Scholar). In this study, we address in vitro and in vivo the role of ERRα in the regulation of PEPCK gene expression. Our findings demonstrate that ERRα inhibits PEPCK gene expression, at least in part by restricting the interaction of PGC-1α with the PEPCK promoter. Furthermore, the repressive effect of ERRα is specific for gluconeogenic genes, whereas genes involved in mitochondrial respiratory function are activated by hepatic ERRα. The potential benefits of an ERRα role in reducing hepatic glucose production while increasing oxidative capacity are discussed. Animals—Generation of ERRα null mice in the C57BL/6 background has been described elsewhere (19Luo J. Sladek R. Carrier J. Bader J.A. Richard D. Giguere V. Mol. Cell. Biol. 2003; 23: 7947-7956Crossref PubMed Scopus (315) Google Scholar). Mice were housed at 21 °C on a 12-h light-dark cycle and fed ad libitum with a standard diet containing 5% fat (Harland Tekland LM-485, Indianapolis, IN). For gene expression analysis, adult (8–10 weeks) ERRα null females and wild type littermates were fasted for 24 h and then fed for 5 h with standard diet. After the refeeding period, mice were euthanized, and tissues were removed and stored for subsequent analysis. All procedures were performed in accordance with the guidelines for animal care and use of The Scripps Research Institute. Plasmids and Adenoviral Constructs—Luciferase reporter constructs for wild type and mutant (AF3mβ and AF3mγ) PEPCK promoter, and expression plasmids for ERRα-VP16 and PGC-1α have been described previously (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 39Scott D.K. Mitchell J.A. Granner D.K. J. Biol. Chem. 1996; 271: 31909-31914Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). pSG5/mERRα for the expression of full-length mouse ERRα was a gift of J.-M. Vanacker (40Bonnelye E. Vanacker J.M. Dittmar T. Begue A. Desbiens X. Denhardt D.T. Aubin J.E. Laudet V. Fournier B. Mol. Endocrinol. 1997; 11: 905-916Crossref PubMed Scopus (132) Google Scholar). Adenoviral vectors expressing GFP, ERRα, PGC-1α, ERRα-VP16, and small interfering RNA (siRNA) for human ERRα have been described (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar, 16Schreiber S.N. Emter R. Hock M.B. Knutti D. Cardenas J. Podvinec M. Oakeley E.J. Kralli A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6472-6477Crossref PubMed Scopus (515) Google Scholar). The adenoviral vector expressing siRNA for rat ERRα was generated by CRE-lox-mediated recombination in CRE8 cells (41Hardy S. Kitamura M. Harris-Stansil T. Dai Y. Phipps M.L. J. Virol. 1997; 71: 1842-1849Crossref PubMed Google Scholar), and targets the sequence 5′-GAGCATCCCAGGCTTCTCC-3′ of mouse and rat ERRα. Cell Culture, Transfections, Luciferase Assays, and Adenovirus Infections—H4IIE rat hepatoma cells were maintained as described (42Waltner-Law M. Duong D.T. Daniels M.C. Herzog B. Wang X.L. Prasad R. Granner D.K. J. Biol. Chem. 2003; 278: 10427-10435Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). HepG2 and COS-7 cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. H4IIE cells were transfected with calcium phosphate-precipitated DNA (42Waltner-Law M. Duong D.T. Daniels M.C. Herzog B. Wang X.L. Prasad R. Granner D.K. J. Biol. Chem. 2003; 278: 10427-10435Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). COS-7 and HepG2 cells were transfected using the FuGENE 6 reagent (Roche) according to the manufacturer's instructions. Luciferase reporter activities were determined ∼18 h after transfections using the Dual Luciferase Reporter Assay System (Promega). For adenovirus infection, cells were infected first with the siERRα adenovirus or a control virus in 10-cm dishes and at a multiplicity of infection of 100, and then (3 days later) with GFP or PGC-1α expressing viruses and a second dose of the siERRα or control viruses (multiplicity of infection 50 each). Cells were harvested 24 or 48 h after the second infection. Protein Extractions and Western Blot—Protein lysates were prepared using either the NE-PER reagent (Pierce) (Fig. 1) or by lysis in Nonidet P-40 buffer (Figs. 2 and 4) as previously described (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar), and subjected to Western analysis using antibodies against PGC-1α (9Schreiber S.N. Knutti D. Brogli K. Uhlmann T. Kralli A. J. Biol. Chem. 2003; 278: 9013-9018Abstract Full Text Full Text PDF PubMed Scopus (379) Google Scholar) and ERRα (43Johnston S.D. Liu X. Zuo F. Eisenbraun T.L. Wiley S.R. Kraus R.J. Mertz J.E. Mol. Endocrinol. 1997; 11: 342-352Crossref PubMed Scopus (163) Google Scholar).FIGURE 2ERRα represses PEPCK gene transcription. A, ERRα and/or PGC-1α were overexpressed by means of adenovirus infection in HepG2 cells, as indicated. RNA was isolated 40 h after infection and PEPCK mRNA levels were determined by quantitative RT-PCR. Data are expressed as -fold induction over control samples (cells infected with GFP-expressing virus) and represent the mean ± S.D. of two experiments performed in duplicate or triplicate. B, the levels of ERRα and PGC-1α protein in HepG2 cells of panel A were determined by Western blot analysis (*, nonspecific bands). C, H4IIE cells were transfected with 5 μg of wild type PEPCK luciferase reporter gene construct, 1 μg of PGC-1α expression plasmid, and increasing amounts (62 ng to 2 μg) of ERRα expression plasmid, as indicated. Reporter gene activity was measured and normalized to Renilla luciferase activity. Data are expressed relative to the control sample (reporter without PGC-1α and ERRα) and represent the average of two independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 4Inhibition of endogenous ERRα enhances the induction of PEPCK expression by PGC-1α. HepG2 cells were infected with an adenovirus expressing siRNA for ERRα (siERRα) or the control virus Super, and a PGC-1α expressing virus or the control virus expressing GFP, as described under “Materials and Methods.” A, endogenous ERRα mRNA levels were determined by quantitative RT-PCR. B, the protein levels of PGC-1α and ERRα in HepG2 cells were determined by Western blot analysis of cell lysates, using antibodies specific to PGC-1α and ERRα. Samples for PGC-1α expressing cells (with and without siRNA for ERRα) are shown in duplicate. C, endogenous PEPCK mRNA levels were determined by quantitative RT-PCR. Data in A and C are expressed as the -fold change, relative to control samples (Super, GFP), and represent the mean ± S.D. of two experiments performed in duplicates or triplicates.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Electromobility Shift Assay—Electromobility shift assays were performed as described previously (32Hall R.K. Sladek F.M. Granner D.K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 412-416Crossref PubMed Scopus (199) Google Scholar). Nuclear extracts from COS-7 cells (about 1.5 μg/sample) transfected with an ERRα expression vector or H4IIE cells (about 8 μg/sample) were incubated with labeled probe and separated on an 8% polyacrylamide gel, in 0.5× TBE buffer at 25 mA (∼180 V). Labeled probe and unlabeled oligonucleotides used for competition studies were as follows (5′ to 3′, the ERRα recognition site is shown bold, mutations are underlined): TCCCGGCCAGCCCTGTCCTTGACCCCCACCTGACAATTAAGG (PEPCK AF3 probe); GCGATTTGTCAAGGTCACACAGCGC (TRα); GCGATTTGTCAAGTGCACACAGCGC (TRαM4); GATCGGCCAGCCCACGAGTTGACCCCCACCTGACAATTAAGG (AF3mβ); GATCGGCCAGCCCTGTCCTTAACACCCACCTGACAATTAAGG (AF3mγ). Antibodies against ERRα (14Sladek R. Bader J.A. Giguere V. Mol. Cell. Biol. 1997; 17: 5400-5409Crossref PubMed Google Scholar) or COUP-TFI (44Wang L.H. Tsai S.Y. Cook R.G. Beattie W.G. Tsai M.J. O'Malley B.W. Nature. 1989; 340: 163-166Crossref PubMed Scopus (388) Google Scholar) were included in the incubation, as indicated in the figure legend. Chromatin Immunoprecipitation Assay—Chromatin immunoprecipitations were performed with antibodies against the glucocorticoid receptor (Santa Cruz, sc-1004), PGC-1α (Santa Cruz, sc-13067), or ERRα (14Sladek R. Bader J.A. Giguere V. Mol. Cell. Biol. 1997; 17: 5400-5409Crossref PubMed Google Scholar) as described (45Herzog B. Hall R.K. Wang X.L. Waltner-Law M. Granner D.K. Mol. Endocrinol. 2004; 18: 807-819Crossref PubMed Scopus (39) Google Scholar). RNA Isolation, Reverse Transcription, and Quantitative PCR—Total RNA was isolated using the TRIzol reagent (Invitrogen). RNA (400 ng) was reverse transcribed to cDNA using the SuperScript II RNase H-Reverse Transcriptase system (Invitrogen) and specific transcripts were quantitated by real-time PCR using the Chromo4 (MJ Research), gene-specific primers, and the SYBR GREEN system (Applied Biosystems). Sequences of the primers for human CYCS, ATP5B, isocitrate dehydrogenase subunit α, and glyceraldehyde-3-phosphate dehydrogenase have been published (16Schreiber S.N. Emter R. Hock M.B. Knutti D. Cardenas J. Podvinec M. Oakeley E.J. Kralli A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6472-6477Crossref PubMed Scopus (515) Google Scholar). Other primers used in this study are as follows (gene, forward primer/reverse primer, 5′ to 3′): human ERRα, TTCTCATCGCTGTCGCTGTCT/CAGCCGCCGCACTAGTTG; mouse and rat Errα, ATCTGCTGGTGGTTGAACCTG/AGAAGCCTGGGATGCTCTTG; human PEPCK, GAAAAAACCTGGGGCACAT/TTGCTTCAAGGCAAGGATCTCT; mouse Pepck, ATCTTTGGTGGCCGTAGACCT/GCCAGTGGGCCAGGTATTT; rat Pepck, GAGTGCCCATCGAAGGCAT/CCAGTGCGCCAGGTACTTG; mouse and rat glucose-6-phosphatase, TCCTCTTTCCCATCTGGTTC/TATACACCTGCTGCGCCCAT; mouse and rat PGC-1α, GGTACCCAAGGCAGCCACT/GTGTCCTCGGCTGAGCACT, mouse glycerol kinase, TGAAGTCAATTGGTTGGGTTACA/ATGCAGCCAGTGGCTTATGAA; mouse Atp5b, GCAAGGCAGGGACAGCAGA/CCCAAGGTCTCAGGACCAACA; mouse cytochrome c-1, ATTTCAACCCTTACTTTCCCG/CCACTTATGCCGCTTCATGGC; mouse cyclophilin, CAAGACTGAATGGCTGGATG/ATGGGGTAGGGACGCTCTCC. Relative mRNA levels for the specific genes were determined using the comparative threshold cycle method (Applied Biosystems, User Bulletin 2, 1997) and have been normalized to either glyceraldehyde-3-phosphate dehydrogenase mRNA levels (for HepG2 cells) or cyclophilin mRNA levels (for mouse liver RNA). The two reference genes (glyceraldehyde-3-phosphate dehydrogenase and cyclophilin) were not affected by PGC-1α and/or ERRα expression. ERRα Binds to the Regulatory Sequences of the PEPCK Gene—The sequence of the gAF3 binding site in the PEPCK gene promoter shows a high degree of identity with known response elements for ERRα (14Sladek R. Bader J.A. Giguere V. Mol. Cell. Biol. 1997; 17: 5400-5409Crossref PubMed Google Scholar, 16Schreiber S.N. Emter R. Hock M.B. Knutti D. Cardenas J. Podvinec M. Oakeley E.J. Kralli A. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6472-6477Crossref PubMed Scopus (515) Google Scholar, 46Vanacker J.M. Bonnelye E. Delmarre C. Laudet V. Oncogene. 1998; 17: 2429-2435Crossref PubMed Scopus (64) Google Scholar). This putative ERRE is conserved in the mouse, rat, and human PEPCK regulatory sequences (Fig. 1A). To test whether ERRα binds to this site, we used gel mobility shift assays. Incubation of nuclear extracts from COS-7 cells expressing ERRα with a labeled oligonucleotide containing the gAF3 sequence gave rise to a complex that could be supershifted with an anti-ERRα antibody but not with a nonspecific antibody (Fig. 1B). A 50-fold molar excess of an oligonucleotide containing a known ERRE from the TRα promoter (TRα) or the gAF3 sequence (AF3) effectiv" @default.
• W2019002699 created "2016-06-24" @default.
• W2019002699 creator A5007824761 @default.
• W2019002699 creator A5022613720 @default.
• W2019002699 creator A5024555196 @default.
• W2019002699 creator A5026987725 @default.
• W2019002699 creator A5029986683 @default.
• W2019002699 creator A5035160083 @default.
• W2019002699 creator A5067986579 @default.
• W2019002699 creator A5085344688 @default.
• W2019002699 date "2006-01-01" @default.
• W2019002699 modified "2023-10-09" @default.
• W2019002699 title "Estrogen-related Receptor α Is a Repressor of Phosphoenolpyruvate Carboxykinase Gene Transcription" @default.
• W2019002699 cites W1502038901 @default.
• W2019002699 cites W1510569968 @default.
• W2019002699 cites W1523158326 @default.
• W2019002699 cites W1531613637 @default.
• W2019002699 cites W1575011694 @default.
• W2019002699 cites W1583767403 @default.
• W2019002699 cites W1603786143 @default.
• W2019002699 cites W1605945811 @default.
• W2019002699 cites W1665938856 @default.
• W2019002699 cites W1964876127 @default.
• W2019002699 cites W1965989272 @default.
• W2019002699 cites W1966985989 @default.
• W2019002699 cites W1967170700 @default.
• W2019002699 cites W1968769525 @default.
• W2019002699 cites W1972767512 @default.
• W2019002699 cites W1975478809 @default.
• W2019002699 cites W1990529844 @default.
• W2019002699 cites W1990579890 @default.
• W2019002699 cites W1991108075 @default.
• W2019002699 cites W2000065704 @default.
• W2019002699 cites W2008632158 @default.
• W2019002699 cites W2015985353 @default.
• W2019002699 cites W2016137310 @default.
• W2019002699 cites W2031994974 @default.
• W2019002699 cites W2035416275 @default.
• W2019002699 cites W2036134589 @default.
• W2019002699 cites W2039290425 @default.
• W2019002699 cites W2044782567 @default.
• W2019002699 cites W2049652810 @default.
• W2019002699 cites W2053765200 @default.
• W2019002699 cites W2055570003 @default.
• W2019002699 cites W2061617907 @default.
• W2019002699 cites W2093718545 @default.
• W2019002699 cites W2103673771 @default.
• W2019002699 cites W2109330965 @default.
• W2019002699 cites W2112980664 @default.
• W2019002699 cites W2119554992 @default.
• W2019002699 cites W2120293566 @default.
• W2019002699 cites W2123667207 @default.
• W2019002699 cites W2124697228 @default.
• W2019002699 cites W2128284013 @default.
• W2019002699 cites W2131492087 @default.
• W2019002699 cites W2133208346 @default.
• W2019002699 cites W2135645000 @default.
• W2019002699 cites W2141771347 @default.
• W2019002699 cites W2144714494 @default.
• W2019002699 cites W2148992247 @default.
• W2019002699 cites W2150413922 @default.
• W2019002699 cites W2150479378 @default.
• W2019002699 cites W2152101492 @default.
• W2019002699 cites W2153969356 @default.
• W2019002699 cites W2168681882 @default.
• W2019002699 cites W2172200901 @default.
• W2019002699 cites W2175518322 @default.
• W2019002699 doi "https://doi.org/10.1074/jbc.m509276200" @default.
• W2019002699 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16267049" @default.
• W2019002699 hasPublicationYear "2006" @default.
• W2019002699 type Work @default.
• W2019002699 sameAs 2019002699 @default.
• W2019002699 citedByCount "78" @default.
• W2019002699 countsByYear W20190026992012 @default.
• W2019002699 countsByYear W20190026992013 @default.
• W2019002699 countsByYear W20190026992014 @default.
• W2019002699 countsByYear W20190026992015 @default.
• W2019002699 countsByYear W20190026992016 @default.
• W2019002699 countsByYear W20190026992017 @default.
• W2019002699 countsByYear W20190026992018 @default.
• W2019002699 countsByYear W20190026992019 @default.
• W2019002699 countsByYear W20190026992020 @default.
• W2019002699 countsByYear W20190026992021 @default.
• W2019002699 countsByYear W20190026992022 @default.
• W2019002699 countsByYear W20190026992023 @default.
• W2019002699 crossrefType "journal-article" @default.
• W2019002699 hasAuthorship W2019002699A5007824761 @default.
• W2019002699 hasAuthorship W2019002699A5022613720 @default.
• W2019002699 hasAuthorship W2019002699A5024555196 @default.
• W2019002699 hasAuthorship W2019002699A5026987725 @default.
• W2019002699 hasAuthorship W2019002699A5029986683 @default.
• W2019002699 hasAuthorship W2019002699A5035160083 @default.
• W2019002699 hasAuthorship W2019002699A5067986579 @default.
• W2019002699 hasAuthorship W2019002699A5085344688 @default.
• W2019002699 hasBestOaLocation W20190026991 @default.
• W2019002699 hasConcept C104317684 @default.
• W2019002699 hasConcept C121608353 @default.
• W2019002699 hasConcept C134018914 @default.

• next