FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2019482161> ?p ?o ?g. }

• W2019482161 endingPage "32809" @default.
• W2019482161 startingPage "32803" @default.
• W2019482161 abstract "Transgenic or tumoral pancreatic islet beta cells with enhanced expression of low K m hexokinases (HK) exhibit a leftward shift of the normal dose-response curve for glucose-induced insulin release. Furthermore, HK catalyzes roughly 50% of total glucose phosphorylation measured in extracts from freshly isolated rodent islets, suggesting that HK participates in the process of glucose sensing in beta cells. We previously observed that HK activity represents 20% of total glucose phosphorylation in purified rat beta cell preparations and that HK is not homogenously distributed over these cells. The present study provides several arguments for the idea that HK detected in freshly isolated rat islets or islet cell preparations originates mainly from contaminating exocrine cells. First, reverse transcriptase-polymerase chain reaction using isoform-specific primers allowed detection of hexokinase I and IV mRNA in rat beta cells, whereas the messenger levels encoding the hexokinase II and III isoforms were undetectably low. However, immunoblots indicated that hexokinase I protein was 10-fold more abundant in freshly isolated islets and flow-sorted exocrine cells than in purified rat beta cell preparations. Second, comparison of HK activity in the different pancreatic cell types resulted in 15–25-fold higher values in exocrine than in endocrine cells (acinar cells: 21 ± 3 pmol of glucose 6-phosphate formed/h/ng of DNA; duct cells: 30 ± 8 pmol/h/ng of DNA; islet beta cells: 1.2 ± 0.2 pmol/h/ng DNA; alpha cells: 0.9 ± 0.4 pmol/h/ng of DNA). Since freshly purified beta cell preparations contain 3 ± 1% exocrine cells, at least 50% of their HK activity can be accounted for by exocrine contamination. Third, after 5 days of culture of purified islet beta cells, both HK activity and the proportion of exocrine cells decreased by more than 1 order of magnitude, while the ratio of glucokinase over hexokinase activity increased more than 10-fold. Finally, preincubating the cells with 50 mmol/liter 2-deoxyglucose did not affect glucose stimulation of insulin biosynthesis and release. In conclusion, the observation that pancreatic exocrine cells are responsible for a major part of HK activity in islet cell preparations cautions against the use of HK measurements in islet extracts in the study of these enzymes in glucose sensing by pancreatic beta cells. Transgenic or tumoral pancreatic islet beta cells with enhanced expression of low K m hexokinases (HK) exhibit a leftward shift of the normal dose-response curve for glucose-induced insulin release. Furthermore, HK catalyzes roughly 50% of total glucose phosphorylation measured in extracts from freshly isolated rodent islets, suggesting that HK participates in the process of glucose sensing in beta cells. We previously observed that HK activity represents 20% of total glucose phosphorylation in purified rat beta cell preparations and that HK is not homogenously distributed over these cells. The present study provides several arguments for the idea that HK detected in freshly isolated rat islets or islet cell preparations originates mainly from contaminating exocrine cells. First, reverse transcriptase-polymerase chain reaction using isoform-specific primers allowed detection of hexokinase I and IV mRNA in rat beta cells, whereas the messenger levels encoding the hexokinase II and III isoforms were undetectably low. However, immunoblots indicated that hexokinase I protein was 10-fold more abundant in freshly isolated islets and flow-sorted exocrine cells than in purified rat beta cell preparations. Second, comparison of HK activity in the different pancreatic cell types resulted in 15–25-fold higher values in exocrine than in endocrine cells (acinar cells: 21 ± 3 pmol of glucose 6-phosphate formed/h/ng of DNA; duct cells: 30 ± 8 pmol/h/ng of DNA; islet beta cells: 1.2 ± 0.2 pmol/h/ng DNA; alpha cells: 0.9 ± 0.4 pmol/h/ng of DNA). Since freshly purified beta cell preparations contain 3 ± 1% exocrine cells, at least 50% of their HK activity can be accounted for by exocrine contamination. Third, after 5 days of culture of purified islet beta cells, both HK activity and the proportion of exocrine cells decreased by more than 1 order of magnitude, while the ratio of glucokinase over hexokinase activity increased more than 10-fold. Finally, preincubating the cells with 50 mmol/liter 2-deoxyglucose did not affect glucose stimulation of insulin biosynthesis and release. In conclusion, the observation that pancreatic exocrine cells are responsible for a major part of HK activity in islet cell preparations cautions against the use of HK measurements in islet extracts in the study of these enzymes in glucose sensing by pancreatic beta cells. hexokinases I, II, or III bovine serum albumin fluorescence-activated cell sorting glucose 6-phosphate hexokinase IV (glucokinase) polymerase chain reaction Differentiated pancreatic beta cells isolated from both rodents (1Pipeleers D. Diabetologia. 1987; 30: 277-291Crossref PubMed Scopus (149) Google Scholar) and man (2Ling Z. Pipeleers D.G. J. Clin. Invest. 1996; 98: 2805-2812Crossref PubMed Scopus (171) Google Scholar) possess the capacity to rapidly respond to changes in extracellular glucose concentration between 3 and 20 mmol/liter with adapted rates of proinsulin biosynthesis and insulin release. In addition to the rapid onset of these cellular processes, both the inactivity at basal glucose (below 3 mmol/liter) and the steep concentration-dependent activation at glucose levels between 5 and 10 mmol/liter are considered important aspects of the glucose-regulation of beta cells (3Matschinsky F.M. Diabetes. 1996; 45: 223-241Crossref PubMed Scopus (0) Google Scholar). It is well known that such regulatory properties of glucose proceed via metabolic steps in beta cells, comprising the uptake and phosphorylation of the sugar (4Newgard C.B. McGarry J.D. Annu. Rev. Biochem. 1995; 64: 689-719Crossref PubMed Scopus (494) Google Scholar). Phosphorylation in islets is mediated by two classes of isoenzymes (5Matschinsky F.M. Ellerman J.E. J. Biol. Chem. 1968; 243: 2730-2736Abstract Full Text PDF PubMed Google Scholar,6Ashcroft S.J.H. Randle P.J. Biochem. J. 1970; 119: 5-15Crossref PubMed Scopus (76) Google Scholar), hexokinases I-III (HK)1and glucokinase (GK), which can be distinguished biochemically by their molecular mass, enzyme kinetics, and allosteric properties (7Iynedjian P.B. Biochem. J. 1995; 293: 231-243Google Scholar). The concept that GK plays a crucial physiological role in glucose recognition by mammalian beta cells has been documented extensively (for review, see Ref. 3Matschinsky F.M. Diabetes. 1996; 45: 223-241Crossref PubMed Scopus (0) Google Scholar). Furthermore, genetically determined abnormalities in GK structure or protein expression levels are the cause of abnormal insulin secretion caused by abnormal threshold concentration for glucose-stimulated insulin release, both in transgenic animals (8Grupe A. Hultgren B. Ryan A. Ma Y.H. Bauer M. Stewart T.A. Cell. 1995; 83: 69-78Abstract Full Text PDF PubMed Scopus (229) Google Scholar) and man (9Froguel Ph. Zouali H. Vionnet N. Velho G. Vaxillaire M. Sun F. Lesage S. Stoffel M. Takeda J. Passa Ph. Permutt A. Beckmann J.S. Bell G.I. Cohen D. N. Engl. J. Med. 1993; 328: 697-702Crossref PubMed Scopus (716) Google Scholar, 10Glaser B. Kesavan P. Heyman M. Davis E. Cuesta A. Buchs A. Stanley C.A. Thornton P.S. Permutt M.A. Matschinsky F.M. Herold K.C. N. Engl. J. Med. 1998; 338: 226-230Crossref PubMed Scopus (519) Google Scholar). Depending on the shift of such threshold, these mutations can be the cause of diabetes (8Grupe A. Hultgren B. Ryan A. Ma Y.H. Bauer M. Stewart T.A. Cell. 1995; 83: 69-78Abstract Full Text PDF PubMed Scopus (229) Google Scholar, 9Froguel Ph. Zouali H. Vionnet N. Velho G. Vaxillaire M. Sun F. Lesage S. Stoffel M. Takeda J. Passa Ph. Permutt A. Beckmann J.S. Bell G.I. Cohen D. N. Engl. J. Med. 1993; 328: 697-702Crossref PubMed Scopus (716) Google Scholar) or familial hyperinsulinism (10Glaser B. Kesavan P. Heyman M. Davis E. Cuesta A. Buchs A. Stanley C.A. Thornton P.S. Permutt M.A. Matschinsky F.M. Herold K.C. N. Engl. J. Med. 1998; 338: 226-230Crossref PubMed Scopus (519) Google Scholar). Strikingly, in extracts of mouse (5Matschinsky F.M. Ellerman J.E. J. Biol. Chem. 1968; 243: 2730-2736Abstract Full Text PDF PubMed Google Scholar, 6Ashcroft S.J.H. Randle P.J. Biochem. J. 1970; 119: 5-15Crossref PubMed Scopus (76) Google Scholar) and rat (11Malaisse W.J. Sener A. Levy J. J. Biol. Chem. 1976; 251: 1731-1737Abstract Full Text PDF PubMed Google Scholar) islets, at least 50% of total glucose phosphorylation seems to be catalyzed by HK. On basis of this high activity on the one hand and because of the observation that up-regulation of hexokinase expression in tumoral or transgenic beta cells causes a leftward shift of the normal concentration-dependent activation of glucose-induced insulin release on the other hand (12German M.S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1781-1785Crossref PubMed Scopus (182) Google Scholar, 13Ishihara H. Asano T. Tsukuda K. Katagiri H. Inukai K. Anai M. Kikuchi M. Yazaki Y. Miyazaki J.I. Oka Y. J. Biol. Chem. 1994; 269: 3081-3087Abstract Full Text PDF PubMed Google Scholar), the possibility has been considered that low K m hexokinases influence the process of glucose sensing, for instance, by decreasing the threshold for glucose-induced insulin release or increasing insulin secretion at basal plasma glucose levels. Four studies may be interpreted along this view. First, Heimberg et al. (14Heimberg H. De Vos A. Vandercammen A. Van Schaftingen E. Pipeleers D. Schuit F. EMBO J. 1993; 12: 2873-2879Crossref PubMed Scopus (145) Google Scholar) noted that hexokinase activity was associated with a rat beta cell subset with high sensitivity to glucose, prepared by fluorescence-activated cell sorting (FACS) on the basis of glucose-induced changes in NAD(P)H autofluorescence (15Kiekens R. in't Veld P. Mahler T. Schuit F. Van De Winkel M. Pipeleers D. J. Clin. Invest. 1992; 89: 117-125Crossref PubMed Scopus (126) Google Scholar), which could indicate that lowK m glucose phosphorylation sets the threshold point for glucose-induced beta cell activation. Second, Hosokawa et al. (16Hosakowa H. Hosakowa Y.A. Leahy J.L. Diabetes. 1995; 44: 1328-1333Crossref PubMed Scopus (42) Google Scholar) observed that islets isolated from 90% pancreatectomized rats exhibited more than 2-fold up-regulation of hexokinase expression which was associated with a moderate shift to the left of the dose-response curve of glucose-induced insulin release. Third, Rabuazzoet al. (17Rabuazzo A.M. Patanè G. Anello M. Piro S. Vigneri R. Purrello F. Diabetes. 1997; 46: 1148-1452Crossref PubMed Scopus (14) Google Scholar) showed that 3-h exposure of rat islets to 16.7 mmol/liter glucose caused both translocation of islet-associated hexokinase I protein from a cytosolic pool to the outer mitochondrial membrane and leftward shift of the concentration-dependent activation of glucose-induced insulin release. The correlation between the two events led to the suggestion that glucose-induced redistribution of hexokinase I in beta cells contributes to glucose regulation of insulin secretion (17Rabuazzo A.M. Patanè G. Anello M. Piro S. Vigneri R. Purrello F. Diabetes. 1997; 46: 1148-1452Crossref PubMed Scopus (14) Google Scholar). Fourth, in a model of conditional knockout of the rat islet glucokinase gene, Piston et al.(18Piston D.W. Knobel S.M. Postic C. Shelton K.D. Magnuson M.A. J. Biol. Chem. 1999; 274: 1000-1004Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar) recently observed some residual glucose-induced shift in NAD(P)H autofluorescence in the subset of islet beta cells that recombined both GK alleles, indirectly suggesting the participation of HK in glucose metabolism of these cells. A number of observations are more difficult to reconcile with the idea that HK is important in the process of glucose recognition by beta cells. First, low K m glucose phosphorylation in islet extracts occurs much more rapidly than low K m glucose utilization in whole islets, suggesting that intracellular mediators such as glucose 6-phosphate and glucose 1,6-bisphosphate repress most islet HK allosterically (19Giroix M.H. Sener A. Pipeleers D.G. Malaisse W.J. Biochem. J. 1984; 223: 447-453Crossref PubMed Scopus (105) Google Scholar). Second, HK activity on the one hand and insulin release on the other could be dissociated from each other by maintaining rat islets in tissue culture, the former disappearing almost completely after 5 days of culture, whereas the latter could be well preserved (20Liang Y. Najafi H. Matschinsky F.M. J. Biol. Chem. 1990; 265: 16863-16866Abstract Full Text PDF PubMed Google Scholar, 21Weinhaus A.J. Stout L.E. Sorenson R.L. Endocrinology. 1996; 137: 1640-1649Crossref PubMed Scopus (99) Google Scholar). Third, HK is undetectably low (14Heimberg H. De Vos A. Vandercammen A. Van Schaftingen E. Pipeleers D. Schuit F. EMBO J. 1993; 12: 2873-2879Crossref PubMed Scopus (145) Google Scholar) in the subset of the beta cells that was flow-sorted on the basis of a low glucose-induced shift in NAD(P)H autofluorescence at 7.5 mm glucose (approximately 50% of the cells, Ref. 15Kiekens R. in't Veld P. Mahler T. Schuit F. Van De Winkel M. Pipeleers D. J. Clin. Invest. 1992; 89: 117-125Crossref PubMed Scopus (126) Google Scholar). Altogether, the concept that HK is required together with GK for normal glucose regulation is controversial and still insufficiently documented. We have therefore assessed in the present study mRNA expression of different hexokinase isoforms as well as hexokinase I protein abundance and HK enzymatic activity in FACS-purified rat pancreatic cell populations. Our results show that both acinar cells and ducts of the exocrine pancreas which are co-isolated with the islets of Langerhans and contaminate to a minor extent the FACS-purified beta cells, express hexokinase-I at very high levels. As a consequence, when this factor is not taken into account, major artifacts are introduced in the study of HK and its role in glucose regulation of beta cells. Pancreata were isolated from adult male Wistar rats (proefdiercentrum Heverlee, Belgium) which were bred according to Belgian regulations of animal welfare. Islets of Langerhans were prepared in isolation medium (123 mmol/liter NaCl, 5.4 mmol/liter KCl, 1.8 mmol/liter CaCl2, 4.2 mmol/liter NaHCO3, 0.8 mmol/liter MgSO4, 10 mmol/liter HEPES, 5.6 mmol/liter glucose, 0.01% kanamycin, and 0.25% bovine serum albumin (BSA), pH 7.4) using a modified collagenase technique which has been described (22Pipeleers D.G. in't Veld P. Van De Winkel M. Maes E. Schuit F.C. Gepts W. Endocrinology. 1985; 117: 806-816Crossref PubMed Scopus (324) Google Scholar). The freshly isolated islets were dissociated into dispersed islet cells (23Pipeleers D.G. Pipeleers-Marichal M.A. Diabetologia. 1981; 20: 654-663Crossref PubMed Scopus (88) Google Scholar) using dissociation medium (123 mmol/liter NaCl, 5.4 mmol/liter KCl, 4.2 mmol/liter NaHCO3, 0.8 mmol/liter MgSO4, 10 mmol/liter HEPES, 1 mmol/liter EGTA, 5.6 mmol/liter glucose, and 0.5% BSA, pH 7.4) containing trypsin (final concentration 25 μg/ml) and DNase (2 μg/ml). Islet beta cells were FACS purified from endocrine non-beta cells via autofluorescence-activated cell sorting at 2.8 mmol/liter glucose (22Pipeleers D.G. in't Veld P. Van De Winkel M. Maes E. Schuit F.C. Gepts W. Endocrinology. 1985; 117: 806-816Crossref PubMed Scopus (324) Google Scholar) on the basis of FAD/scatter using an argon laser (Spectra Physics, Mountain View, Ca) at 488 nm (excitation) and 510–550 nm (emission). In some experiments, the flow-sorted total beta cell population was further subdivided into beta cell subsets on basis of low and high NAD(P)H autofluorescence at 2.8 mmol/liter glucose (15Kiekens R. in't Veld P. Mahler T. Schuit F. Van De Winkel M. Pipeleers D. J. Clin. Invest. 1992; 89: 117-125Crossref PubMed Scopus (126) Google Scholar), using a UV-laser (351–363 nm excitation/400–470 nm emission; Spectra Physics). Analysis of the cellular composition of the sorted or non-sorted islet cell preparations was performed by electron microscopy and immunocytochemistry for pancreatic hormones as described previously (22Pipeleers D.G. in't Veld P. Van De Winkel M. Maes E. Schuit F.C. Gepts W. Endocrinology. 1985; 117: 806-816Crossref PubMed Scopus (324) Google Scholar). For the determination of the percentage of exocrine cells in the purified beta cell preparations, approximately 500 cells/sample were counted in the electron microscopical analysis. To assess the effect of tissue culture on HK associated with flow-sorted rat beta cells, the cells were cultured for 5 days in serum-free Ham's F-10 medium (Life Technologies, Inc., Strathclyde, United Kingdom) containing 0.075 mg/ml penicillin, 0.1 mg/ml streptomycin, 50 μmol/liter 3-isobutyl-1-methylxanthine, 1% (w/v) charcoal-extracted BSA (fraction V, RIA grade, Sigma), 2 mmol/liter glutamine, and 10 mmol/liter glucose (24Ling Z. Kiekens R. Mahler T. Schuit F.C. Pipeleers-Marichal M. Sener A. Klöppel G. Malaisse W.J. Pipeleers D.G. Diabetes. 1996; 45: 1774-1782Crossref PubMed Scopus (102) Google Scholar). Pancreatic acinar cells were prepared from the total collagenase digest of the pancreas and enriched by countercurrent elutriation (23Pipeleers D.G. Pipeleers-Marichal M.A. Diabetologia. 1981; 20: 654-663Crossref PubMed Scopus (88) Google Scholar) using the cellular fraction with particle size below 100 μm. The elutriated cell clumps were washed by two sedimentations, resuspended in isolation medium and then cleared from debris and dead cells via sedimentation through a Percoll layer of density 1.040. After one wash in isolation medium and two washes in dissociation medium (250 g for 3 min), the cells were preincubated for 10 min at 30 °C in dissociation medium under continuous shaking. Enzymatic dissociation (23Pipeleers D.G. Pipeleers-Marichal M.A. Diabetologia. 1981; 20: 654-663Crossref PubMed Scopus (88) Google Scholar) was started by addition of trypsin (final concentration 25 μg/ml) and DNase (2 μg/ml) and followed under a phase-contrast microscope. Dissociation was stopped (median required time of 30 min) when 50–60% of the cells occurred as single units. After three washes in isolation medium (250 g for 3 min) the cells were filtered through a 5-μm nylon filter to remove undigested material and finally submitted to autofluorescence-activated cell sorting at 2.8 mmol/liter glucose in order to remove dead cells and cell debris. This isolation procedure yielded a FACS-purified cell preparation with >90% acinar cells and viability exceeding 95%. Preparation of ducts from the countercurrent elutriation fraction with particle size below 100 μm was performed according to a previously published method (25Bouwens L. Braet F. Heimberg H. J. Histochem. Cytochem. 1995; 43: 245-253Crossref PubMed Scopus (56) Google Scholar). Isolated ducts were cultured for 7 days in Ham's F-10 basal medium (Life Technologies, Inc., Gaithersburg, MD) supplemented with 6 mmol/liter glucose, 2 mmol/literl-glutamine, 1% BSA (fraction V, RIA grade, Sigma), 0.075 mg/ml penicillin (Sigma), 0.1 mg/ml streptomycin (Sigma), and 5% heat-inactivated fetal calf serum. The cell density was 15 ducts per 3 ml in a bacteriological Petri dish. Total RNA (0.5 μg) was extracted from beta cells and control tissues (brain, liver, and muscle) reverse transcribed and amplified as described before (26Heimberg H. De Vos A. Pipeleers D. Thorens B. Schuit F. J. Biol. Chem. 1995; 270: 8971-8975Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar) with appropriate blanks in each assay. Specific primer sequences used for PCR were as follows: hexokinase-I (5′-codon 17–23): GACCAAGTCAAAAAGATTGA, hexokinase-I (3′-codon 95–102): TCTTCTCGTGGTTCACCTGC, yielding an amplified fragment of 256 base pairs; hexokinase-II (5′-codon 18–24): 5′-CAAGTGCAGAAGGTTGACCA, hexokinase-II (3′-codon 18–24): 5′-CTCTGGAGGCCATTGTCCGT (259-base pair fragment); hexokinase-III (5′-codon 12–18): 5′GACAAAGAGACTCAAGCTGC, hexokinase-III (3′-codon 106–112): 5′-CCCGTCAGTGTTACCCACAA (300-base pair fragment); glucokinase beta cell-specific variant (see Ref. 27Magnuson M.A. Shelton K.D. J. Biol. Chem. 1989; 289: 15936-15942Abstract Full Text PDF Google Scholar: 5′-codon 9–15): 5′-AGGCCACCAAGAAGGAAAAG, glucokinase beta cell variant (3′-codon 97–104): 5′-TTGTCTTCACGCTCCACTGC (288-base pair fragment). As a control for the quality and quantity of the RNA, a primer mixture (equimolar concentrations) recognizing the glucose transporters GLUT1, GLUT2, and GLUT4 was used; the sequences of these primers were as described before (26Heimberg H. De Vos A. Pipeleers D. Thorens B. Schuit F. J. Biol. Chem. 1995; 270: 8971-8975Abstract Full Text Full Text PDF PubMed Scopus (136) Google Scholar) yielding an amplified fragment of 540 base pairs. The cycling profile for each of the PCR experiments was as follows: 2.5 min at 95 °C followed by 1 min at 94 °C, 1.5 min at 65 °C, and 1.5 min at 72 °C for 10 cycles and 0.5 min at 94 °C, 1 min at 60 °C, and 1.5 min at 72 °C for 20 cycles, bringing the total number of cycles on 30. PCR products were controlled for their nucleotide sequence by fluorescent cycle sequencing on an ABI PrismTM 310 Genetic Analyzer (Perkin-Elmer Cetus, Emeryville, CA). Cell and tissue samples were washed twice in phosphate-buffered saline and homogenized by sonication in lysis buffer containing 80 mmol/liter Tris-Cl (pH 6.8), 5 mmol/liter EDTA, 5% SDS, 5% β-mercaptoethanol, and 10% glycerol in the presence of 1 mmol/liter phenylmethylsulfonyl fluoride. Aliquots were taken for protein determination using the BCA protein assay kit (Pierce, Rockford, IL) using BSA as standard. Homogenates (20–40 μg of total cellular protein per lane) were separated on a 10% SDS-polyacrylamide gel (Mini-Protean, Bio-Rad) and electroblotted overnight onto nitrocellulose membranes (Schleicher & Schuell, Dassel, Germany). Blotting efficiency as well as the position of the protein standards was assessed by Ponceau staining. The blots were blocked for 1 h at room temperature in 5% non-fat dry milk (pH 7.6). Hexokinase-I was detected using a monoclonal anti-hexokinase I antibody (Chemicon, Temakula, CA) at 1/1.000 dilution (16Hosakowa H. Hosakowa Y.A. Leahy J.L. Diabetes. 1995; 44: 1328-1333Crossref PubMed Scopus (42) Google Scholar). The second antibody (sheep anti-mouse peroxidase, 1/2000, Amersham Pharmacia Biotech) was incubated at room temperature for 50 min. Peroxidase activity was detected via chemiluminiscence (ECL, Amersham Pharmacia Biotech). The intensity of the signals was quantified via laser densitometry. Stripped blots were re-exposed subsequently to sheep polyclonal anti-GK antibody at 1/4000 dilution (kindly donated by Dr. H. Seitz, University of Hamburg, Germany) and goat polyclonal antibody against β-actin at 1/1000 dilution (Santa Cruz, San Diego, CA), the latter to validate quality and quantity of the loaded protein. Exposure times were 20 min for hexokinase-I, 1 min for GK, and 1 min for β-actin. Glucose phosphorylation was measured by a radiochemical assay (28Van Schaftingen E. Eur. J. Biochem. 1989; 179: 179-184Crossref PubMed Scopus (161) Google Scholar). Cells or ducts (2 × 103 cells/μl (beta cells) or 5 ng of DNA/μl (acinar cells and ducts)) were homogenized via sonification in 20 mmol/liter HEPES buffer (pH 7.1) containing 50 mmol/liter KCl, 1 mmol/liter dithiothreitol, 0.5 mmol/liter EDTA, 20 μg/ml antipaine, and 20 μg/ml leupeptin. The phosphorylation assay was started by addition of 12.5 μl of cell homogenate to 12.5 μl of HEPES (40 mmol/liter) buffer (pH 7.1), containing 125 mmol/liter KCl, 1.5 mmol/liter dithiothreitol, 40 mmol/liter potassium fluoride, 0.75 mmol/liter EDTA, 10 mmol/liter Mg-ATP, 30 μg/ml antipaine, 30 μg/ml leupeptin, 0.2 mg/ml BSA, and 0.125 μCi of [U-14C]glucose in the presence of 0.5 or 20 mmol/liter glucose. Glucose 6-phosphate (Glu-6-P, final concentration = 2.5 mmol/liter) was absent or present in order to distinguish between lowK m hexokinase (Glu-6-P-sensitive) and GK which is Glu-6-P-insensitive and which exhibits a highs 0.5 value for glucose (3Matschinsky F.M. Diabetes. 1996; 45: 223-241Crossref PubMed Scopus (0) Google Scholar). After 90 min incubation at 37 °C, the amount of reaction product was measured by spotting duplicates of 10 μl of the incubation medium on DE-81 paper. Non-phosphorylated glucose was removed by three washes in water followed by one wash in ethanol and a final wash in ether. Radioactivity bound to the paper was counted after mixing the dried papers with liquid scintillation mixture (OptiPhase “Hisafe” II, Wallac, Turku, Finland). FACS-purified beta cells were reaggregated for 1 h at 37 °C in Ham's F-10 medium supplemented with 2 mmol/liter l-glutamine, 1% BSA (fraction V, RIA grade), 0.075 mg/ml penicillin (Continental Pharma, Brussels, Belgium), 0.1 mg/ml streptomycin (Laboratories Diamant, Puteau, France), and 2 mmol/liter Ca2+ (basal medium) supplemented with 10 mmol/liter glucose. Insulin release and proinsulin biosynthesis were measured after 30 min preincubation in basal medium plus 1 mmol/liter glucose (control condition) or basal medium supplemented with 1 mmol/liter glucose and 50 mmol/liter 2-deoxyglucose which is converted in the cells to 2-deoxyglucose 6-phosphate to inhibit HK (29Ferber S. BeltrandelRio H. Johnson J. Noel R.J. Cassidy L.E. Clark S. Becker T.C. Hughes S. Newgard C.B. J. Biol. Chem. 1994; 269: 11523-11529Abstract Full Text PDF PubMed Google Scholar). After washing the cells three times in basal medium, batches corresponding to 5 × 104 cells per condition were incubated for 1 h at 37 °C in 200 μl of basal medium with 0, 1, or 20 mmol/liter glucose either with or without 20 mmol/liter mannoheptulose and 50 μCi ofl-[3,5-3H]tyrosine (Amersham Pharmacia Biotech), resulting in a final specific activity of 16.7 Ci/mmol and a tyrosine concentration of 15 μmol/liter, in order to measure release and biosynthesis from the same cells (24Ling Z. Kiekens R. Mahler T. Schuit F.C. Pipeleers-Marichal M. Sener A. Klöppel G. Malaisse W.J. Pipeleers D.G. Diabetes. 1996; 45: 1774-1782Crossref PubMed Scopus (102) Google Scholar, 30Schuit F.C. Kiekens R. Pipeleers D.G. Biochem. Biophys. Res. Commun. 1991; 178: 1182-1187Crossref PubMed Scopus (52) Google Scholar). DNA was measured using Hoechst 33258 (22Pipeleers D.G. in't Veld P. Van De Winkel M. Maes E. Schuit F.C. Gepts W. Endocrinology. 1985; 117: 806-816Crossref PubMed Scopus (324) Google Scholar). Duct cells and acinar cells were washed in calcium-free buffer containing 150 mmol/liter NaCl, 15 mmol/liter citrate, and 3 mmol/liter EDTA (pH 7.0) and extracted for 15 min at 37 °C in 100 mmol/liter NaCl, 10 mmol/liter Tris, and 10 mmol/liter EDTA (pH 7.0). The fluorimetric assay at 355 nm (excitation)/455 nm (emission) was carried out after addition of Hoechst 33258 solution (100 ng/ml) to the samples. Data are expressed as mean ± S.E. of n independent experiments. Unless stated otherwise, the significance of differences between conditions was tested by unpaired two-tailed Student's t test. We first assessed the abundance of various hexokinase transcripts in FACS-purified beta cells, using isoform-specific primer sets and taking total RNA extracted from rat brain, liver, and muscle as positive and negative controls. The amplification reaction utilizing the GK-primer set from which the 5′-primer is directed against beta cell-specific codons 9–15 of GK-mRNA, resulted in the expected (27Magnuson M.A. Shelton K.D. J. Biol. Chem. 1989; 289: 15936-15942Abstract Full Text PDF Google Scholar, 31Heimberg H. De Vos A. Moens K. Quartier E. Bouwens L. Pipeleers D. Van Schaftingen E. Madsen O. Schuit F. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7036-7041Crossref PubMed Scopus (119) Google Scholar) 288-base pair fragment when RNA was used from flow-sorted rat beta cells (Fig.1). Moreover, the same primers gave negative results starting from rat liver RNA (Fig. 1). RNA extracted from FACS-purified rat beta cell preparations appeared also positive for hexokinase-I messenger, since with hexokinase-I-specific primers a PCR product of the same length and nucleotide sequence could be amplified as when the reaction was performed with rat brain RNA. On the contrary, amplification of hexokinase-II or -III cDNA fragments was negative when starting from rat beta cell RNA, while rat muscle and liver, respectively, gave positive results. To determine whether the hexokinase-I mRNA that was detected in flow-sorted rat beta cells is translated, we performed immunoblots starting from total protein from collagenase-isolated rat islets as well as from purified beta cells and exocrine acinar cells (Fig. 2). In freshly purified beta cells, the hexokinase-I abundance appeared low, at least 10-fold less abundant than in freshly isolated islets of Langerhans: the OD ratios normalized for β-actin were 0.4 (islets) and 0.02 (beta cells). The cellular origin of the detected hexokinase-I protein in whole islets is suggested by high hexokinase-I expression in exocrine pancreatic cells (virtually as abundant as in rat brain). In contrast to the large difference in hexokinase-I expression in whole islets and purified beta cells, GK abundance in isolated islets and FACS-purified beta cells were comparable, the observed OD ratio of GK over β-actin being 0.45 and 0.65 in islets and in beta cells, respectively. To assess the functional integrity of HK and GK protein, we measured glucose phosphorylation in FACS-purified beta and alpha cells as well as in purified pancreatic acinar and ductal cells (TableI). In agreement with the protein blots, HK activity, when expressed per microgra" @default.
• W2019482161 created "2016-06-24" @default.
• W2019482161 creator A5023245811 @default.
• W2019482161 creator A5052381309 @default.
• W2019482161 creator A5080456562 @default.
• W2019482161 creator A5083603818 @default.
• W2019482161 date "1999-11-01" @default.
• W2019482161 modified "2023-10-18" @default.
• W2019482161 title "Cellular Origin of Hexokinase in Pancreatic Islets" @default.
• W2019482161 cites W1479842759 @default.
• W2019482161 cites W1511578599 @default.
• W2019482161 cites W1540067804 @default.
• W2019482161 cites W1545562191 @default.
• W2019482161 cites W1573318520 @default.
• W2019482161 cites W1622568915 @default.
• W2019482161 cites W1676880150 @default.
• W2019482161 cites W174714445 @default.
• W2019482161 cites W1759385300 @default.
• W2019482161 cites W1964563218 @default.
• W2019482161 cites W1967766455 @default.
• W2019482161 cites W1971578810 @default.
• W2019482161 cites W1975236725 @default.
• W2019482161 cites W1975535652 @default.
• W2019482161 cites W1979946833 @default.
• W2019482161 cites W1999199961 @default.
• W2019482161 cites W2006090557 @default.
• W2019482161 cites W2014390235 @default.
• W2019482161 cites W2015001567 @default.
• W2019482161 cites W2020537279 @default.
• W2019482161 cites W2022424814 @default.
• W2019482161 cites W2023149007 @default.
• W2019482161 cites W2030386197 @default.
• W2019482161 cites W2036370893 @default.
• W2019482161 cites W2044980718 @default.
• W2019482161 cites W2047316432 @default.
• W2019482161 cites W205094244 @default.
• W2019482161 cites W2054714044 @default.
• W2019482161 cites W2073327039 @default.
• W2019482161 cites W2078471248 @default.
• W2019482161 cites W2083525730 @default.
• W2019482161 cites W2085565962 @default.
• W2019482161 cites W2087061260 @default.
• W2019482161 cites W2096514865 @default.
• W2019482161 cites W2104560553 @default.
• W2019482161 cites W2140192657 @default.
• W2019482161 cites W2140439271 @default.
• W2019482161 cites W2154407802 @default.
• W2019482161 cites W2158554737 @default.
• W2019482161 cites W2161641259 @default.
• W2019482161 cites W2164522008 @default.
• W2019482161 cites W2178375292 @default.
• W2019482161 cites W2330339020 @default.
• W2019482161 cites W42136775 @default.
• W2019482161 doi "https://doi.org/10.1074/jbc.274.46.32803" @default.
• W2019482161 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10551841" @default.
• W2019482161 hasPublicationYear "1999" @default.
• W2019482161 type Work @default.
• W2019482161 sameAs 2019482161 @default.
• W2019482161 citedByCount "54" @default.
• W2019482161 countsByYear W20194821612012 @default.
• W2019482161 countsByYear W20194821612013 @default.
• W2019482161 countsByYear W20194821612014 @default.
• W2019482161 countsByYear W20194821612015 @default.
• W2019482161 countsByYear W20194821612016 @default.
• W2019482161 countsByYear W20194821612017 @default.
• W2019482161 countsByYear W20194821612018 @default.
• W2019482161 countsByYear W20194821612019 @default.
• W2019482161 countsByYear W20194821612021 @default.
• W2019482161 countsByYear W20194821612022 @default.
• W2019482161 countsByYear W20194821612023 @default.
• W2019482161 crossrefType "journal-article" @default.
• W2019482161 hasAuthorship W2019482161A5023245811 @default.
• W2019482161 hasAuthorship W2019482161A5052381309 @default.
• W2019482161 hasAuthorship W2019482161A5080456562 @default.
• W2019482161 hasAuthorship W2019482161A5083603818 @default.
• W2019482161 hasBestOaLocation W20194821611 @default.
• W2019482161 hasConcept C126322002 @default.
• W2019482161 hasConcept C134018914 @default.
• W2019482161 hasConcept C165220095 @default.
• W2019482161 hasConcept C181199279 @default.
• W2019482161 hasConcept C185592680 @default.
• W2019482161 hasConcept C20251656 @default.
• W2019482161 hasConcept C2779306644 @default.
• W2019482161 hasConcept C2779826832 @default.
• W2019482161 hasConcept C2779855799 @default.
• W2019482161 hasConcept C55493867 @default.
• W2019482161 hasConcept C71924100 @default.
• W2019482161 hasConcept C86803240 @default.
• W2019482161 hasConcept C95444343 @default.
• W2019482161 hasConcept C98335778 @default.
• W2019482161 hasConceptScore W2019482161C126322002 @default.
• W2019482161 hasConceptScore W2019482161C134018914 @default.
• W2019482161 hasConceptScore W2019482161C165220095 @default.
• W2019482161 hasConceptScore W2019482161C181199279 @default.
• W2019482161 hasConceptScore W2019482161C185592680 @default.
• W2019482161 hasConceptScore W2019482161C20251656 @default.
• W2019482161 hasConceptScore W2019482161C2779306644 @default.
• W2019482161 hasConceptScore W2019482161C2779826832 @default.

• next