FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2019848334> ?p ?o ?g. }

• W2019848334 endingPage "38375" @default.
• W2019848334 startingPage "38365" @default.
• W2019848334 abstract "Transforming growth factor-β (TGF-β) controls a diverse set of cellular processes, and its canonical signaling is mediated via TGF-β-induced phosphorylation of receptor-activated Smads (2 and 3) at the C-terminal SXS motif. We recently discovered that PPM1A can dephosphorylate Smad2/3 at the C-terminal SXS motif, implicating a critical role for phosphatases in regulating TGF-β signaling. Smad2/3 activity is also regulated by phosphorylation in the linker region (and N terminus) by a variety of intracellular kinases, making it a critical platform for cross-talk between TGF-β and other signaling pathways. Using a functional genomic approach, we identified the small C-terminal domain phosphatase 1 (SCP1) as a specific phosphatase for Smad2/3 dephosphorylation in the linker and N terminus. A catalytically inactive SCP1 mutant (dnSCP1) had no effect on Smad2/3 phosphorylation in vitro or in vivo. Of the other FCP/SCP family members SCP2 and SCP3, but not FCP1, could also dephosphorylate Smad2/3 in the linker/N terminus. Depletion of SCP1/2/3 enhanced Smad2/3 linker phosphorylation. SCP1 increased TGF-β-induced transcriptional activity in agreement with the idea that phosphorylation in the Smad2/3 linker must be removed for a full transcriptional response. SCP1 overexpression also counteracts the inhibitory effect of epidermal growth factor on TGF-β-induced p15 expression. Taken together, this work identifies the first example of a Smad2/3 linker phosphatase(s) and reveals an important new substrate for SCPs. Transforming growth factor-β (TGF-β) controls a diverse set of cellular processes, and its canonical signaling is mediated via TGF-β-induced phosphorylation of receptor-activated Smads (2 and 3) at the C-terminal SXS motif. We recently discovered that PPM1A can dephosphorylate Smad2/3 at the C-terminal SXS motif, implicating a critical role for phosphatases in regulating TGF-β signaling. Smad2/3 activity is also regulated by phosphorylation in the linker region (and N terminus) by a variety of intracellular kinases, making it a critical platform for cross-talk between TGF-β and other signaling pathways. Using a functional genomic approach, we identified the small C-terminal domain phosphatase 1 (SCP1) as a specific phosphatase for Smad2/3 dephosphorylation in the linker and N terminus. A catalytically inactive SCP1 mutant (dnSCP1) had no effect on Smad2/3 phosphorylation in vitro or in vivo. Of the other FCP/SCP family members SCP2 and SCP3, but not FCP1, could also dephosphorylate Smad2/3 in the linker/N terminus. Depletion of SCP1/2/3 enhanced Smad2/3 linker phosphorylation. SCP1 increased TGF-β-induced transcriptional activity in agreement with the idea that phosphorylation in the Smad2/3 linker must be removed for a full transcriptional response. SCP1 overexpression also counteracts the inhibitory effect of epidermal growth factor on TGF-β-induced p15 expression. Taken together, this work identifies the first example of a Smad2/3 linker phosphatase(s) and reveals an important new substrate for SCPs. TGF-β 4The abbreviations used are: TGF-β, transforming growth factor-β; SCP, small C-terminal domain phosphatase; EGF, epidermal growth factor; CTD, C-terminal domain; HA, hemagglutinin; WCL, whole cell lysate; GST, glutathione S-transferase; SBE, Smad-binding element; siRNA, small interfering RNA; RT, reverse transcription; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; MOPS, 4-morpholinepropanesulfonic acid; GFP, green fluorescent protein; CDK, cyclin-dependent kinase; RNAPII, RNA polymerase II; BMP, bone morphogenetic protein. 4The abbreviations used are: TGF-β, transforming growth factor-β; SCP, small C-terminal domain phosphatase; EGF, epidermal growth factor; CTD, C-terminal domain; HA, hemagglutinin; WCL, whole cell lysate; GST, glutathione S-transferase; SBE, Smad-binding element; siRNA, small interfering RNA; RT, reverse transcription; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; JNK, c-Jun N-terminal kinase; MOPS, 4-morpholinepropanesulfonic acid; GFP, green fluorescent protein; CDK, cyclin-dependent kinase; RNAPII, RNA polymerase II; BMP, bone morphogenetic protein. signaling, largely mediated via the transcriptional functions of Smad proteins, controls diverse developmental processes and the pathogenesis of many diseases, including cancer, autoimmune, and fibrotic diseases. A key step in TGF-β signaling is ligand-induced phosphorylation of R-Smads (Smads 2 and 3 in TGF-β signaling; Smads 1, 5, and 8 in BMP signaling) in the distal C-terminal SXS motif, which is mediated by the type I receptor kinase (TβRI) (1Abdollah S. Macias-Silva M. Tsukazaki T. Hayashi H. Attisano L. Wrana J.L. J. Biol. Chem. 1997; 272: 27678-27685Abstract Full Text Full Text PDF PubMed Scopus (407) Google Scholar, 4Massague J. Gomis R.R. FEBS Lett. 2006; 580: 2811-2820Crossref PubMed Scopus (629) Google Scholar). Smad SXS phosphorylation controls a cascade of downstream events, which include hetero-oligomeric complex formation with Smad4, and the nuclear import of this complex which regulates gene transcription in conjunction with a variety of transcriptional cofactors (3Feng X.H. Derynck R. Annu. Rev. Cell Dev. Biol. 2005; 21: 659-693Crossref PubMed Scopus (1507) Google Scholar, 5Massague J. Seoane J. Wotton D. Genes Dev. 2005; 19: 2783-2810Crossref PubMed Scopus (1881) Google Scholar). Although C-terminal SXS phosphorylation by TβRI is key in Smad activation, Smad signaling is fine-tuned for diverse biological responses by further post-translational modifications, including ubiquitination and SUMOylation (6Izzi L. Attisano L. Oncogene. 2004; 23: 2071-2078Crossref PubMed Scopus (210) Google Scholar, 7Feng X.H. Lin X. Dijke P.T. Heldin C.H. Smad Signal Transduction. Springer-Verlag New York Inc., New York2006: 253-276Google Scholar), as well as phosphorylation by other intracellular protein kinases (8Derynck R. Zhang Y.E. Nature. 2003; 425: 577-584Crossref PubMed Scopus (4155) Google Scholar, 9Moustakas A. Heldin C.H. J. Cell Sci. 2005; 118: 3573-3584Crossref PubMed Scopus (884) Google Scholar). R-Smads contain two conserved polypeptide segments, the MH1 (N) and MH2 (C) domains, joined by a less conserved linker region. R-Smad linker regions are serine/threonine-rich and contain multiple phosphorylation sites for proline-directed kinases. They are phosphorylated by mitogen-activated protein kinases (MAPKs) and cyclin-dependent kinases (CDKs), which exhibit some preference for specific serine residues in the linker (3Feng X.H. Derynck R. Annu. Rev. Cell Dev. Biol. 2005; 21: 659-693Crossref PubMed Scopus (1507) Google Scholar, 8Derynck R. Zhang Y.E. Nature. 2003; 425: 577-584Crossref PubMed Scopus (4155) Google Scholar, 9Moustakas A. Heldin C.H. J. Cell Sci. 2005; 118: 3573-3584Crossref PubMed Scopus (884) Google Scholar). CDK2/4-mediated phosphorylation occurs mostly at Thr-8, Thr-179, and Ser-213 (10Matsuura I. Denissova N.G. Wang G. He D. Long J. Liu F. Nature. 2004; 430: 226-231Crossref PubMed Scopus (404) Google Scholar). CDK-dependent phosphorylation of Smad3 inhibits its transcriptional activity, negating the anti-proliferative action of TGF-β and serving as a novel means by which CDKs promote aberrant cell cycle progression and confer cancer cell resistance to growth-inhibitory effects of TGF-β. MAPK-mediated linker phosphorylation appears to have a dual role in Smad2/3 regulation. Mitogens and hyperactive Ras result in extracellular signal-regulated kinase (ERK)-mediated phosphorylation of Smad3 at Ser-204, Ser-208, and Thr-179 and of Smad2 at Ser-245/250/255 and Thr-220. Mutation of these sites increases the ability of Smad3 to activate target genes, suggesting that MAPK phosphorylation of Smad3 is inhibitory (11Kretzschmar M. Doody J. Timokhina I. Massague J. Genes Dev. 1999; 13: 804-816Crossref PubMed Scopus (842) Google Scholar, 12Matsuura I. Wang G. He D. Liu F. Biochemistry. 2005; 44: 12546-12553Crossref PubMed Scopus (106) Google Scholar). However, in contrast, ERK-dependent phosphorylation of Smad2 at Thr-8 enhances its transcriptional activity (13Funaba M. Zimmerman C.M. Mathews L.S. J. Biol. Chem. 2002; 277: 41361-41368Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). Phosphorylation of Smad3 by p38 MAPK and ROCK (Ser-204, Ser-208, and Ser-213) and c-Jun N-terminal kinase (JNK) (Ser-208 and Ser-213; analogous Ser-250 and Ser-255 in Smad2) may enhance Smad2/3 transcriptional activity, suggesting that Smads and the p38/ROCK/JNK signaling pathways might cooperate in generating a more robust TGF-β response (14Engel M.E. McDonnell M.A. Law B.K. Moses H.L. J. Biol. Chem. 1999; 274: 37413-37420Abstract Full Text Full Text PDF PubMed Scopus (429) Google Scholar, 16Kamaraju A.K. Roberts A.B. J. Biol. Chem. 2005; 280: 1024-1036Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). A significant increase in Ser-208/Ser-213 phosphorylation of Smad3 is associated with late stage colorectal tumors, suggesting that the linker-phosphorylated Smad3 may mediate the tumor-promoting role of TGF-β in late tumorigenesis (17Yamagata H. Matsuzaki K. Mori S. Yoshida K. Tahashi Y. Furukawa F. Sekimoto G. Watanabe T. Uemura Y. Sakaida N. Yoshioka K. Kamiyama Y. Seki T. Okazaki K. Cancer Res. 2005; 65: 157-165PubMed Google Scholar). Additional kinases, e.g. MEKK-1, CaMKII, protein kinase C, and CKϵ, target R-Smads and regulate Smad-dependent transcriptional responses (18Brown J.D. DiChiara M.R. Anderson K.R. Gimbrone Jr., M.A. Topper J.N. J. Biol. Chem. 1999; 274: 8797-8805Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar, 21Waddell D.S. Liberati N.T. Guo X. Frederick J.P. Wang X.F. J. Biol. Chem. 2004; 279: 29236-29246Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar), and TGF-β may also induce Smad phosphorylation in the linker region as well as at the SXS motif (15Mori S. Matsuzaki K. Yoshida K. Furukawa F. Tahashi Y. Yamagata H. Sekimoto G. Seki T. Matsui H. Nishizawa M. Fujisawa J. Okazaki K. Oncogene. 2004; 23: 7416-7429Crossref PubMed Scopus (167) Google Scholar, 16Kamaraju A.K. Roberts A.B. J. Biol. Chem. 2005; 280: 1024-1036Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Thus, the Smad linker region is emerging as an important and critical regulatory platform in TGF-β signaling. Phosphorylation state and the subsequent activity of many proteins are controlled by dynamic interplay between kinases and phosphatases. Protein-serine/threonine phosphatases (PS/TPs) cleave phosphate molecules from serine and threonine residues in target proteins and can largely be grouped into the PPM, PPP, or FCP/SCP families (22Gallego M. Virshup D.M. Curr. Opin. Cell Biol. 2005; 17: 197-202Crossref PubMed Scopus (134) Google Scholar). TFIIF-associating C-terminal domain (CTD) phosphatase (FCP1) and small CTD phosphatases (SCP1, SCP2, and SCP3) are characterized by a conserved DXDX(T/V) motif that is essential for their activity and that they share with a superfamily of phosphotransferases and phosphohydrolases (23Collet J.F. Stroobant V. Pirard M. Delpierre G. Van Schaftingen E. J. Biol. Chem. 1998; 273: 14107-14112Abstract Full Text Full Text PDF PubMed Scopus (222) Google Scholar, 26Kamenski T. Heilmeier S. Meinhart A. Cramer P. Mol. Cell. 2004; 15: 399-407Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar). FCP/SCPs are well known for their ability to negatively regulate RNA polymerase II (RNAPII) by dephosphorylating its CTD at Ser-2 and Ser-5 (25Yeo M. Lin P.S. Dahmus M.E. Gill G.N. J. Biol. Chem. 2003; 278: 26078-26085Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar, 27Meinhart A. Kamenski T. Hoeppner S. Baumli S. Cramer P. Genes Dev. 2005; 19: 1401-1415Crossref PubMed Scopus (257) Google Scholar). SCPs have also been shown to silence neuronal genes in non-neuronal tissues (28Yeo M. Lee S.K. Lee B. Ruiz E.C. Pfaff S.L. Gill G.N. Science. 2005; 307: 596-600Crossref PubMed Scopus (179) Google Scholar) and to attenuate androgen-dependent transcription (29Thompson J. Lepikhova T. Teixido-Travesa N. Whitehead M.A. Palvimo J.J. Janne O.A. EMBO J. 2006; 25: 2757-2767Crossref PubMed Scopus (30) Google Scholar). Recently, SCPs were reported to dephosphorylate Smad1 in the BMP pathway (30Knockaert M. Sapkota G. Alarcon C. Massague J. Brivanlou A.H. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 11940-11945Crossref PubMed Scopus (108) Google Scholar). It is likely that other as yet unidentified proteins involved in gene regulation are also targeted by SCPs. We recently discovered that Smad2/3 can be dephosphorylated by the PPM family phosphatase PPM1A at the C-terminal SXS motif, to terminate Smad signaling, implicating a critical role for Smad2/3 dephosphorylation in the regulation of TGF-β signaling (31Lin X. Duan X. Liang Y.Y. Su Y. Wrighton K.H. Long J. Hu M. Davis C.M. Wang J. Brunicardi F.C. Shi Y. Chen Y.G. Meng A. Feng X.H. Cell. 2006; 125: 915-928Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar). Using a similar functional genomic approach and taking advantage of phospho-Smad2/3-specific antibodies, we undertook a screen for PS/TPs whose expression reduced Smad2/3 linker/N-terminal phosphorylation. Here we present data identifying SCPs as specific Smad2/3 linker/N-terminal phosphatases, and we show that SCP1 functions to enhance TGF-β signaling and counteract the inhibitory effect of EGF on TGF-β-induced p15 expression. In addition to providing the first example of a Smad2/3 linker phosphatase(s), we reveal an important new SCP substrate and identify the first scenario in which an SCP positively regulates gene transcription. Construction of Human PS/TP cDNA Expression Library—Full-length cDNAs were synthesized from HaCaT cell total RNA, by high fidelity PCR, as described previously (31Lin X. Duan X. Liang Y.Y. Su Y. Wrighton K.H. Long J. Hu M. Davis C.M. Wang J. Brunicardi F.C. Shi Y. Chen Y.G. Meng A. Feng X.H. Cell. 2006; 125: 915-928Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar). Expression Plasmids—pCDNA3-FLAG-SCP1, pCDNA3-FLAG-dnSCP1, and pCDNA3-FLAG-SCP2 were a generous gift from Dr. Soo-Kyung Lee (Baylor College of Medicine). HA-Smad2/3 and FLAG-Smad2/3 plasmids were described previously (32Lin X. Liang M. Liang Y.Y. Brunicardi F.C. Melchior F. Feng X.H. J. Biol. Chem. 2003; 278: 18714-18719Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 33Liang M. Melchior F. Feng X.H. Lin X. J. Biol. Chem. 2004; 279: 22857-22865Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar). pXF2F and pXF3H are derived from the cytomegalovirus-driven vector pRK5 (Genentech). Cell Transfection, Immunoprecipitation, and Western Blotting—Cell transfection, immunoprecipitation, and Western blotting were performed essentially as described previously (34Feng X.H. Liang Y.Y. Liang M. Zhai W. Lin X. Mol. Cell. 2002; 9: 133-143Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 35Lin X. Liang Y.Y. Sun B. Liang M. Shi Y. Brunicardi F.C. Feng X.H. Mol. Cell. Biol. 2003; 23: 9081-9093Crossref PubMed Scopus (82) Google Scholar). In brief, for phosphatase screening HEK293T cells were co-transfected with tagged Smad2/3 and the relevant phosphatase using Lipofectin (Invitrogen). After 48 h cells were lysed in FLAG lysis buffer (25 mm Tris-HCl (pH 7.5), 300 mm NaCl, 1% Triton X-100, with the addition of protease (aprotinin, leupeptin, and phenylmethylsulfonyl fluoride) and phosphatase inhibitors (NaF, Na3VO4)), and subjected to anti-FLAG or anti-HA immunoprecipitation. Products were analyzed by Western blotting using phospho-Smad2/3-specific antibodies. Phospho-Smad3 sera (anti-pS204, anti-pS208, and anti-pS213) and sera recognizing both pSmad2 and pSmad3 (anti-pT8 and anti-pT179/T220) were described previously (10Matsuura I. Denissova N.G. Wang G. He D. Long J. Liu F. Nature. 2004; 430: 226-231Crossref PubMed Scopus (404) Google Scholar). The anti-pSmad2 pS245/250/255 antibody was purchased from Cell Signaling Technology®. Smad SXS motif phosphorylation was assessed using anti-P-Smad2 (Cell Signaling) or anti-P-Smad3 sera, which was a kind gift from Ed Leof (Mayo Clinic). Total Smad2/3 levels were assessed by using anti-HA (Mouse 1.1; Babco), anti-FLAG (M2; Sigma), or anti-Smad2/3 antibody (E20; Santa Cruz Biotechnology) as per the manufacturer's instructions. Equal protein loading was assessed using an anti-β-actin antibody (Sigma). Immunoprecipitation of endogenous proteins was performed as described (35Lin X. Liang Y.Y. Sun B. Liang M. Shi Y. Brunicardi F.C. Feng X.H. Mol. Cell. Biol. 2003; 23: 9081-9093Crossref PubMed Scopus (82) Google Scholar) using anti-SCP1 sera (a generous gift from Dr. Soo-Kyung Lee, Baylor College of Medicine). Precipitated proteins were subjected to Western blotting using an anti-Smad2 monoclonal antibody (Cell Signaling). For growth factor treatment, cells were treated with 2 ng/ml TGF-β and/or 50 ng/ml EGF (in Dulbecco's modified Eagle's medium with 0.2% fetal bovine serum), for the indicated times, prior to harvest for immunoprecipitation, Western blotting, and/or in vitro phosphatase assay. EGF activity was confirmed by Western blot analysis of lysates with anti-ERK (M12320; Transduction Laboratories) and anti-P-ERK (9106; Cell Signaling) antibodies. TGF-β activity was confirmed by assessing Smad2/3 SXS phosphorylation as described above. Nucleofection was used to examine the effect of SCP1 expression on endogenous TGF-β target gene expression. HaCaT cells were nucleofected with GFP or FLAG-SCP1 DNA using the Amaxa Biosystems Nucleofector™ with solution V and program U-020 (Amaxa Inc.). After 24 h, cells were treated with TGF-β and/or EGF for 20 h prior to harvest. Samples were subject to Western blotting using anti-p15 (C-20; Santa Cruz Biotechnology) and antibodies as described above. In Vitro Protein Binding—Recombinant GST-SCP1 and GST-dnSCP1 were generated by purification of bacterially expressed GST fusion proteins. HEK293T cells were lysed in Myc-lysis buffer (20 mm Tris (pH 8.0), 138 mm NaCl, 1% Nonidet P-40) and lysates pre-cleared with 5 μg of glutathione-Sepharose-bound GST. Lysates were subsequently rotated with 2 μg of glutathione-Sepharose-bound GST, GST-SCP1, or GST-dnSCP1 for 1 h at 4°C. After washing (10 mm Tris (pH 8.0), 150 mm NaCl, 1% Nonidet P-40), samples were subject to Western blot analysis using anti-Smad2/3 and anti-GST (Babco) antibodies. In Vitro Phosphatase Assays—FLAG-Smad2/3 and FLAG-SCPs (or negative control FLAG-SnoN) were immunoprecipitated from separately transfected HEK293T cells. FLAG-SCPs (or SnoN) were eluted from protein A-Sepharose using FLAG peptide (Sigma) and incubated with protein A-Sepharose-bound FLAG-Smad2/3 in phosphatase buffer (50 mm Tris (pH 7.5), 60 mm MgCl2, 2.5 mm dithiothreitol) for 1.5 h at 37 °C. Alternatively, protein A-Sepharose-bound FLAG-Smad2/3 was incubated with recombinant GST-SCP1 or GST-dnSCP1, in phosphatase buffer, for 1.5 h at 37 °C. Assay products were analyzed for Smad2/3 phosphorylation by Western blotting. In Vitro Kinase Assay/SCP1 Phosphatase Assay—Recombinant GST-Smad3 and GST-SCP1/dnSCP1 were generated by purification of bacterially expressed GST fusion proteins. Glutathione-Sepharose-bound GST-Smad3 (1 μg per reaction) was incubated in kinase buffer (20 mm MOPS (pH 7.4), 10 mm MgCl2, 1 mm EGTA, 0.5 μm ATP) in the presence or absence of recombinant activated ERK2 (Upstate; 15 ng per 1 μg of GST-Smad3) for 30 min at 30 °C. Glutathione-Sepharose-bound GST-Smad3 was subsequently washed twice in phosphate-buffered saline, and once in phosphatase buffer, prior to incubation with recombinant GST, SCP1, or SCP1dn for 1.5 h at 37 °C. Assay products were analyzed by Western blotting using phospho-Smad2/3-specific antibodies. RNA Interference and RT-PCR—siRNA duplexes were commercially synthesized (Sigma-Proligo). Sense strands (5′ to 3′) for the indicated targets are as follows: SCP1 (siSCP1, GCCGGUUGGGUCGAGACCUTT; published previously (30Knockaert M. Sapkota G. Alarcon C. Massague J. Brivanlou A.H. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 11940-11945Crossref PubMed Scopus (108) Google Scholar)), SCP2 (siSCP2, GGAUCUGUGUGGUCAUUGAUU), and SCP3 (siSCP3, CUGCCAGCUUGGCCAAGUAUU). HaCaT cells were nucleofected with 3 μg each of siSCP1, siSCP2, and siSCP3 siRNA oligonucleotides or 9 μg of control siRNA, using the Amaxa Biosystems Nucleofector™ as described above for DNA. Cells were harvested for Western blot analysis or for RNA extraction (Trizol®, Invitrogen) and RT-PCR using MultiScribe™ reverse transcriptase (Applied Biosystems) as per the manufacturer's instructions. The SCP primers (5′ to 3′) are as follows: SCP1 (forward, ATCCCTAAGCAGACCCCAGT; reverse, GTGGAAGACGCAGGACTCTC), SCP2 (forward, CGCTGCGTATAAGGAGGAAG; reverse, GTCACAGGGTCGGCATACTT), and SCP3 (forward, CTGCTGCTTCCGTGATTACA; reverse, TTCCCACGATGAAAAACACA). Transcription Reporter Assays—Plasmid SBE-luc (containing the luciferase gene under the control of Smad-binding elements (SBE)), p15-luc, and p21-luc were used to assess TGF-β-induced transcription in HaCaT cells. Transfections were carried out using DEAE-dextran, and TGF-β treatment and reporter assays were performed as described (32Lin X. Liang M. Liang Y.Y. Brunicardi F.C. Melchior F. Feng X.H. J. Biol. Chem. 2003; 278: 18714-18719Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 34Feng X.H. Liang Y.Y. Liang M. Zhai W. Lin X. Mol. Cell. 2002; 9: 133-143Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar). SCP1 Dephosphorylates Smad2/3 in the Linkers—Our laboratory recently discovered that PPM1A can dephosphorylate Smad2/3 at the C-terminal SXS motif (31Lin X. Duan X. Liang Y.Y. Su Y. Wrighton K.H. Long J. Hu M. Davis C.M. Wang J. Brunicardi F.C. Shi Y. Chen Y.G. Meng A. Feng X.H. Cell. 2006; 125: 915-928Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar). Smad2/3 activity is also regulated by phosphorylation in the linker/N terminus at Thr-220 and Ser-245/250/255 in Smad2, the comparable sites Thr-179 and Ser-204/Ser-S208/Ser-213 in Smad3, and at Thr-8 in both Smad2/3 (Fig. 1A). Several kinases responsible for Smad linker phosphorylation have been identified (Fig. 1B), whereas the identity of a phosphatase responsible for dephosphorylating these sites remains elusive. In this study, we sought to determine which phosphatase(s) might dephosphorylate Smad2/3 in the linker region and what effect this would have on TGF-β signaling. As Smad2/3 linker phosphorylation occurs on serine/threonine residues, we screened 40 PS/TPs, including 5 SCPs, 13 PPPs, 18 PPMs, and 4 DUSPs (Table 1), all of which were assessed for Smad SXS motif phosphatase activity in our previous screen (31Lin X. Duan X. Liang Y.Y. Su Y. Wrighton K.H. Long J. Hu M. Davis C.M. Wang J. Brunicardi F.C. Shi Y. Chen Y.G. Meng A. Feng X.H. Cell. 2006; 125: 915-928Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar). HEK293T cells were co-transfected with FLAG-tagged Smad2/3 and the specified phosphatase for 48 h, and cells were lysed for anti-FLAG immunoprecipitation. Samples were subject to Western blotting with antibodies specific for the linker/N-terminal Smad phosphorylation sites. As shown in Fig. 1C (lane 7), Smad2/3 were phosphorylated in the linker/N terminus in HEK293T cells cultured in regular growth medium alone. SCP1 was clearly able to dephosphorylate Smad2 at Ser-245/250/255 and Thr-8, and Smad3 at Ser-204/208/213 and Thr-8 (Fig. 1C, lane 6). Interestingly, SCP1 was unable to dephosphorylate Smad2 or Smad3 at Thr-220 or Thr-179 respectively. GFP as a negative control (lane 7) and other phosphatases such as PPP1CC (lane 2) and PPP2CB (lane 4) were unable to dephosphorylate Smad2/3 at the linker/N terminus (Fig. 1C; Table 1). All of the phosphatases screened were untagged to ensure no interference with their phosphatase activity, although a tagged set was also made to examine and normalize their expression level in cells (31Lin X. Duan X. Liang Y.Y. Su Y. Wrighton K.H. Long J. Hu M. Davis C.M. Wang J. Brunicardi F.C. Shi Y. Chen Y.G. Meng A. Feng X.H. Cell. 2006; 125: 915-928Abstract Full Text Full Text PDF PubMed Scopus (372) Google Scholar).TABLE 1PS/TPs tested for Smad2/3 linker-specific dephosphorylationPS/TPs (phosphatase)Smad2/3 linker dephosphorylationaYes indicates detectable dephosphorylation; no indicates undetectable dephosphorylation.SCP1, NM_182642YesSCP2, NM_005730YesSCP3, NM_001008392YesSCP4, NM_016396NoFCP1a, NM_004715NoPPP1CA, NM_002708NoPPP1CB, NM_002709NoPPP1CC, NM_002710NoPPP2CA, NM_002715NoPPP2CB, NM_004156NoPPP3CA, NM_000944NoPPP3CB, NM_021132NoPPP3CC, NM_005605NoPPP4C, NM_002720NoPPP5C, NM_006247NoPPP6C, NM_002721NoPPP7C, NM_006240NoPPP7C2, NM_152225NoPPM1A1, NM_021003NoPPM1A2, NM_177951NoPPM1B, NM_002706NoPPM1D, NM_003620NoPPM1E, NM_014906NoPPM1F, NM_014634NoPPM1G, NM_177983NoPPM1H, XM_350880NoPPM1L, NM_139245NoPDP1/PPM2C, NM_018444NoPDP2, NM_020415NoTA-PP2C, NM_139283NoILKAP1, NM_030768NoILKAP2, NM_176799NoPSPH, NM_004577NoPP2Czeta, NM_005167NoPDXP, NM_020415NoPHLPP, NM_194449NoDUSP1/MKP1, NM_004417NoDUSP6/MKP3, NM_001946NoDUSP9/MKP4, NM_001395NoDUSP10/MKP5, NM_007208Noa Yes indicates detectable dephosphorylation; no indicates undetectable dephosphorylation. Open table in a new tab SCP1 Specifically Targets the Linker Regions and Not the SXS Motif of Smad2/3—We next examined the specificity of SCP1 for the Smad2/3 linker by testing its ability to dephosphorylate Smad2/3 at the C-terminal SXS motif. HEK293T cells were co-transfected with FLAG-Smad2/3 and FLAG-SCP1 or FLAG-PPM1A phosphatase. Transfected cells were cultured in the presence or absence of TGF-β for 1 h prior to harvest, to stimulate SXS phosphorylation, and lysed for immunoprecipitation and Western blotting as described above. PPM1A failed to dephosphorylate Smad2/3 in the linker/N terminus, in the presence or absence of TGF-β, as determined by immunoblotting with phospho-specific Smad2/3 antibodies (Fig. 2A, lanes 4 and 5). The FLAG-PPM1A protein was active as judged by its ability to dephosphorylate Smad2/3 at the SXS motif (Fig. 2A, lanes 4 and 5). Conversely, SCP1 was unable to dephosphorylate the Smad2/3 SXS motif but was efficient at dephosphorylating the other Smad2/3 Ser(P)/Thr(P) residues, with the exception of Thr(P)-220 (Smad2) and Thr(P)-179 (Smad3) (Fig. 2A, lanes 6 and 7). The ability of SCP1 to dephosphorylate Smad2/3 at linker/N-terminal Ser/Thr residues was independent of SXS motif phosphorylation (Fig. 2A, lanes 6 and 7). Equal levels of FLAG-Smad2/3 immunoprecipitated product, and expression levels of FLAG-PPM1A and FLAG-SCP1, were confirmed by immunoblotting with an anti-FLAG antibody. Smad Linker Dephosphorylation Requires the Catalytic Activity of SCP1 and Is Independent of the Proteasome—SCP1 is a class 2 phosphatase whose activity is dependent on acidic residues in the conserved DXD motif (25Yeo M. Lin P.S. Dahmus M.E. Gill G.N. J. Biol. Chem. 2003; 278: 26078-26085Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). To confirm that SCP1 phosphatase activity is essential for Smad2/3 linker/N-terminal dephosphorylation, we took advantage of a catalytically inactive SCP1 mutant, dnSCP1, which has an Asp-Glu substitution at residue 96 (D96E) and an Asp-Asn at residue 98 (D98N) (25Yeo M. Lin P.S. Dahmus M.E. Gill G.N. J. Biol. Chem. 2003; 278: 26078-26085Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). We found that unlike its wild type counterpart, FLAG-dnSCP1 had no ability to dephosphorylate Smad2 at Ser(P)-245/250/255 and Thr(P)-8, and Smad3 at Ser(P)-204/208/213 and Thr(P)-8 (Fig. 2B, compare lanes 3 and 4). The wild type and phosphatase-inactive SCP1 proteins were similarly expressed, as determined by anti-FLAG immunoblotting of whole cell lysates. We next determined whether the ability of SCP1 to dephosphorylate Smad2/3 is dose-dependent. Almost no linker Smad2/3 phosphorylation was detected on co-transfection with 0.5 μg of SCP1, as represented by immunoblots for pS245/250/255 (Smad2) and pS213 (Smad3) in Fig. 2C (lane 3). However, phosphorylation levels increased with decreasing concentrations of SCP1 (Fig. 2C, lanes 4–6), providing more evidence that SCP1 is a Smad2/3-specific phosphatase. Finally, to confirm that the SCP1-induced decrease in pSmad2/3 is because of phosphatase activity and not because of pSmad2/3 degradation, we examined the effect of SCP1 on Smad2 linker/N-terminal phosphorylation in the presence or absence of the proteasome inhibitor MG132. MG132 treatment did not block the SCP1-induced decrease in linker/N-terminal phosphorylated Smad2 (Fig. 2D, lane 4), suggesting that SCP1 reduces pSmad2/3 levels independently of degradation via the 26 S proteasome. SCP1 Physically Interacts with Smad2/3—The above data suggest that SCP1 is a specific phosphatase for the Smad2/3 linker/N-terminal region. To determine whether Smad2/3 interacts with SCP1, we first generated recombinant GST-SCP1 and GST-dnSCP1 fusion proteins and assessed them for their ability to bind to endogenous Smad2/3 in HEK293T cell lysates. Western blot analysis revealed that GST-SCP1, but not GST alone, could specifically bind to Smad2/3 in HEK293T lysates (Fig. 3A). Use of an even amount of GST, as compared with GST-SCP1 and GST-dnSCP1, was confirmed by using an anti-GST antibody. Equal amounts of total protein and Smad2/3 in each cell lysate were confirmed by immunoblotting with anti-actin and anti-Smad2/3 antibodies, respectively (Fig. 3A). The catalytically inactive mutant dnSCP1 was still able to interact with Smad2/3 (Fig. 3A, lane 3), suggesting that SCP1 phosphatase activity is not essential for Smad2/3 binding. We next wish" @default.
• W2019848334 created "2016-06-24" @default.
• W2019848334 creator A5018181452 @default.
• W2019848334 creator A5055740291 @default.
• W2019848334 creator A5058936244 @default.
• W2019848334 creator A5071644380 @default.
• W2019848334 creator A5085025467 @default.
• W2019848334 creator A5085783488 @default.
• W2019848334 date "2006-12-01" @default.
• W2019848334 modified "2023-10-15" @default.
• W2019848334 title "Small C-terminal Domain Phosphatases Dephosphorylate the Regulatory Linker Regions of Smad2 and Smad3 to Enhance Transforming Growth Factor-β Signaling" @default.
• W2019848334 cites W1606267994 @default.
• W2019848334 cites W1966615054 @default.
• W2019848334 cites W1970438229 @default.
• W2019848334 cites W1971611931 @default.
• W2019848334 cites W1985901212 @default.
• W2019848334 cites W1988298690 @default.
• W2019848334 cites W2007044718 @default.
• W2019848334 cites W2017761226 @default.
• W2019848334 cites W2021484300 @default.
• W2019848334 cites W2026726511 @default.
• W2019848334 cites W2028348480 @default.
• W2019848334 cites W2028820703 @default.
• W2019848334 cites W2034779933 @default.
• W2019848334 cites W2035653659 @default.
• W2019848334 cites W2040190285 @default.
• W2019848334 cites W2040194330 @default.
• W2019848334 cites W2042663178 @default.
• W2019848334 cites W2042720195 @default.
• W2019848334 cites W2050590451 @default.
• W2019848334 cites W2051310004 @default.
• W2019848334 cites W2054714683 @default.
• W2019848334 cites W2058733924 @default.
• W2019848334 cites W2061735598 @default.
• W2019848334 cites W2067618181 @default.
• W2019848334 cites W2069414088 @default.
• W2019848334 cites W2069911905 @default.
• W2019848334 cites W2071835467 @default.
• W2019848334 cites W2074629755 @default.
• W2019848334 cites W2080032926 @default.
• W2019848334 cites W2086692663 @default.
• W2019848334 cites W2088559146 @default.
• W2019848334 cites W2095605427 @default.
• W2019848334 cites W2104577103 @default.
• W2019848334 cites W2110039717 @default.
• W2019848334 cites W2112964135 @default.
• W2019848334 cites W2117200840 @default.
• W2019848334 cites W2122146830 @default.
• W2019848334 cites W2130631280 @default.
• W2019848334 cites W2138197117 @default.
• W2019848334 cites W2140448223 @default.
• W2019848334 cites W2168221636 @default.
• W2019848334 cites W2171078009 @default.
• W2019848334 cites W3141873631 @default.
• W2019848334 cites W4367011167 @default.
• W2019848334 doi "https://doi.org/10.1074/jbc.m607246200" @default.
• W2019848334 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17035229" @default.
• W2019848334 hasPublicationYear "2006" @default.
• W2019848334 type Work @default.
• W2019848334 sameAs 2019848334 @default.
• W2019848334 citedByCount "88" @default.
• W2019848334 countsByYear W20198483342012 @default.
• W2019848334 countsByYear W20198483342013 @default.
• W2019848334 countsByYear W20198483342014 @default.
• W2019848334 countsByYear W20198483342015 @default.
• W2019848334 countsByYear W20198483342016 @default.
• W2019848334 countsByYear W20198483342017 @default.
• W2019848334 countsByYear W20198483342018 @default.
• W2019848334 countsByYear W20198483342019 @default.
• W2019848334 countsByYear W20198483342020 @default.
• W2019848334 countsByYear W20198483342021 @default.
• W2019848334 countsByYear W20198483342023 @default.
• W2019848334 crossrefType "journal-article" @default.
• W2019848334 hasAuthorship W2019848334A5018181452 @default.
• W2019848334 hasAuthorship W2019848334A5055740291 @default.
• W2019848334 hasAuthorship W2019848334A5058936244 @default.
• W2019848334 hasAuthorship W2019848334A5071644380 @default.
• W2019848334 hasAuthorship W2019848334A5085025467 @default.
• W2019848334 hasAuthorship W2019848334A5085783488 @default.
• W2019848334 hasBestOaLocation W20198483341 @default.
• W2019848334 hasConcept C111919701 @default.
• W2019848334 hasConcept C118131993 @default.
• W2019848334 hasConcept C11960822 @default.
• W2019848334 hasConcept C134306372 @default.
• W2019848334 hasConcept C170493617 @default.
• W2019848334 hasConcept C178666793 @default.
• W2019848334 hasConcept C185592680 @default.
• W2019848334 hasConcept C2775960820 @default.
• W2019848334 hasConcept C2778229498 @default.
• W2019848334 hasConcept C2779664074 @default.
• W2019848334 hasConcept C2780557392 @default.
• W2019848334 hasConcept C2909521502 @default.
• W2019848334 hasConcept C31258907 @default.
• W2019848334 hasConcept C33923547 @default.
• W2019848334 hasConcept C36503486 @default.
• W2019848334 hasConcept C41008148 @default.
• W2019848334 hasConcept C515207424 @default.
• W2019848334 hasConcept C55493867 @default.

• next