FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2019965461> ?p ?o ?g. }

• W2019965461 endingPage "303" @default.
• W2019965461 startingPage "296" @default.
• W2019965461 abstract "ActVB is the NADH:flavin oxidoreductase participating in the last step of actinorhodin synthesis inStreptomyces coelicolor. It is the prototype of a whole class of flavin reductases with both sequence and functional similarities. The mechanism of reduction of free flavins by ActVB has been studied. Although ActVB was isolated with FMN bound, we have demonstrated that it is not a flavoprotein. Instead, ActVB contains only one flavin binding site, suitable for the flavin reductase activity and with a high affinity for FMN. In addition, ActVB proceeds by an ordered sequential mechanism, where NADH is the first substrate. Whereas ActVB is highly specific for NADH, it is able to catalyze the reduction of a great variety of natural and synthetic flavins, but withK m values ranging from 1 μm (FMN) to 69 μm (lumiflavin). We show that both the ribitol-phosphate chain and the isoalloxazine ring contribute to the protein-flavin interaction. Such properties are unique and set the ActVB family apart from the well characterized Fre flavin reductase family. ActVB is the NADH:flavin oxidoreductase participating in the last step of actinorhodin synthesis inStreptomyces coelicolor. It is the prototype of a whole class of flavin reductases with both sequence and functional similarities. The mechanism of reduction of free flavins by ActVB has been studied. Although ActVB was isolated with FMN bound, we have demonstrated that it is not a flavoprotein. Instead, ActVB contains only one flavin binding site, suitable for the flavin reductase activity and with a high affinity for FMN. In addition, ActVB proceeds by an ordered sequential mechanism, where NADH is the first substrate. Whereas ActVB is highly specific for NADH, it is able to catalyze the reduction of a great variety of natural and synthetic flavins, but withK m values ranging from 1 μm (FMN) to 69 μm (lumiflavin). We show that both the ribitol-phosphate chain and the isoalloxazine ring contribute to the protein-flavin interaction. Such properties are unique and set the ActVB family apart from the well characterized Fre flavin reductase family. NAD(P)H:flavin oxidoreductases or flavin reductases are enzymes defined by their ability to catalyze the reduction of free flavins, riboflavin, FMN, or FAD, by reduced pyridine nucleotides, NADPH, or NADH (1Fontecave M. Covès J. Pierre J.L. BioMetals. 1994; 7: 3-8Crossref PubMed Scopus (98) Google Scholar). Since flavins do not bind tightly to them, flavin reductases should not be classified as flavoproteins. What the enzyme does is to provide an active site that transiently accommodates both the reduced pyridine nucleotide and the flavin, close to each other, in such a relative orientation that the direct hydride transfer can be enormously accelerated (2Nivière V. Vanoni M.A. Zanetti G. Fontecave M. Biochemistry. 1998; 37: 11879-11887Crossref PubMed Scopus (28) Google Scholar, 3Ingelman M. Ramaswamy S. Nivière V. Fontecave M. Eklund H. Biochemistry. 1999; 38: 7040-7049Crossref PubMed Scopus (80) Google Scholar). The real biological function of the reduced flavins, the released products of the catalyzed reaction, is still not well understood. Free reduced flavins have been suggested to play an important role as redox mediators in iron uptake and metabolism in prokaryotes (4Covès J. Fontecave M. Eur. J. Biochem. 1993; 211: 635-641Crossref PubMed Scopus (95) Google Scholar) or in light emission in bioluminescent bacteria (5Zenno S. Saigo K. Kanoh H. Inouye S. J. Bacteriol. 1994; 176: 3536-3543Crossref PubMed Google Scholar,6Jeffers C.E. Tu S.-C. Biochemistry. 2001; 40: 1749-1754Crossref PubMed Scopus (36) Google Scholar). More recently, a group of flavin reductases has been found to be essential in combination with flavin-dependent oxygenases (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 8Thibaut D. Ratet N. Bish D. Faucher D. Debussche L. Blanche F. J. Bacteriol. 1995; 177: 5199-5205Crossref PubMed Google Scholar, 9Parry R.J. Li W. J. Biol. Chem. 1997; 272: 23303-23311Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 10Galan E.D. Prieto M.A. Garcia J.L. J. Bacteriol. 2000; 182: 627-636Crossref PubMed Scopus (156) Google Scholar, 11Gray K.A. Pogrebinsky O.S. Mrachko G.T., Xi, L. Monticello D.J. Squires C.H. Nat. Biotechnol. 1996; 14: 1705-1709Crossref PubMed Scopus (307) Google Scholar, 12Uetz T. Schneider R. Snozzi M. Egli T. J. Bacteriol. 1992; 174: 1179-1188Crossref PubMed Google Scholar, 13Witschel M. Nagel S. Egli T. J. Bacteriol. 1997; 179: 6937-6943Crossref PubMed Google Scholar), such as those involved in antibiotic biosynthesis, as discussed below (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 8Thibaut D. Ratet N. Bish D. Faucher D. Debussche L. Blanche F. J. Bacteriol. 1995; 177: 5199-5205Crossref PubMed Google Scholar, 9Parry R.J. Li W. J. Biol. Chem. 1997; 272: 23303-23311Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Organisms have evolved a great variety of such enzymes, which can thus be classified within several families or subfamilies according to their sequence similarities and biochemical properties. Because of their simplicity and their variety, flavin reductases provide a unique tool to understand how a polypeptide chain deals with both the isoalloxazine ring and the ribityl chain of a flavin molecule to modulate its binding constant, to accelerate its reduction by reduced pyridine nucleotide, and to use it for a diversity of functions. Surprisingly, our knowledge of this class of enzymes is very limited so far, and this is the reason why flavin reductases have been the subject of intensive investigations in our laboratory in recent years (3Ingelman M. Ramaswamy S. Nivière V. Fontecave M. Eklund H. Biochemistry. 1999; 38: 7040-7049Crossref PubMed Scopus (80) Google Scholar, 14Fieschi F. Nivière V. Frier C. Décout J.L. Fontecave M. J. Biol. Chem. 1995; 270: 30392-30400Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 15Eschenbrenner M. Covès J. Fontecave M. J. Biol. Chem. 1995; 270: 20550-20555Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 16Nivière V. Fieschi F. Décout J.L. Fontecave M. J. Biol. Chem. 1996; 271: 16656-16661Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 17Nivière V. Fieschi F. Décout J.L. Fontecave M. J. Biol. Chem. 1999; 274: 18252-18260Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). The prototype of one group of flavin reductases is the Fre enzyme found in Escherichia coli (18Fontecave M. Eliasson R. Reichard P. J. Biol. Chem. 1987; 262: 12325-12331Abstract Full Text PDF PubMed Google Scholar) and also in luminescent bacteria (19Zenno S. Saigo K. J. Bacteriol. 1994; 176: 3544-3551Crossref PubMed Google Scholar). The enzyme from E. coli consists of a single polypeptide chain with a molecular mass of 26 kDa. It uses both NADPH and NADH as the electron donor and a great variety of flavin analogues as electron acceptors (14Fieschi F. Nivière V. Frier C. Décout J.L. Fontecave M. J. Biol. Chem. 1995; 270: 30392-30400Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar, 17Nivière V. Fieschi F. Décout J.L. Fontecave M. J. Biol. Chem. 1999; 274: 18252-18260Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). This clearly demonstrates that the recognition of the flavin by the polypeptide chain occurs exclusively through the isoalloxazine ring, with very limited contribution of the ribityl side chain (3Ingelman M. Ramaswamy S. Nivière V. Fontecave M. Eklund H. Biochemistry. 1999; 38: 7040-7049Crossref PubMed Scopus (80) Google Scholar, 14Fieschi F. Nivière V. Frier C. Décout J.L. Fontecave M. J. Biol. Chem. 1995; 270: 30392-30400Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). The crystal structure of Fre (3Ingelman M. Ramaswamy S. Nivière V. Fontecave M. Eklund H. Biochemistry. 1999; 38: 7040-7049Crossref PubMed Scopus (80) Google Scholar) reveals that the general enzyme structure is, despite very low sequence similarities, similar to the structures of a large family of flavoenzymes, with spinach ferredoxin-NADP+reductase as the prototype (20Bruns C.M. Karplus P.A. J. Mol. Biol. 1995; 247: 125-145Crossref PubMed Scopus (172) Google Scholar). It provides insights to the understanding of the structural basis for the difference in flavin recognition between a flavoprotein and a flavin reductase. A second group of flavin reductases, different from the Fre family and the flavin reductases purified from bioluminescent bacteria, has recently emerged (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar, 8Thibaut D. Ratet N. Bish D. Faucher D. Debussche L. Blanche F. J. Bacteriol. 1995; 177: 5199-5205Crossref PubMed Google Scholar, 9Parry R.J. Li W. J. Biol. Chem. 1997; 272: 23303-23311Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar, 10Galan E.D. Prieto M.A. Garcia J.L. J. Bacteriol. 2000; 182: 627-636Crossref PubMed Scopus (156) Google Scholar, 11Gray K.A. Pogrebinsky O.S. Mrachko G.T., Xi, L. Monticello D.J. Squires C.H. Nat. Biotechnol. 1996; 14: 1705-1709Crossref PubMed Scopus (307) Google Scholar, 12Uetz T. Schneider R. Snozzi M. Egli T. J. Bacteriol. 1992; 174: 1179-1188Crossref PubMed Google Scholar, 13Witschel M. Nagel S. Egli T. J. Bacteriol. 1997; 179: 6937-6943Crossref PubMed Google Scholar). However, very few members of this group were purified to homogeneity and carefully characterized. These enzymes are defined on the basis of their amino acid sequence similarities and their role during biological oxidation reactions. Indeed, some monooxygenase systems depend on the presence of a reduced flavin, mainly FMNH2, as a co-substrate rather than a prosthetic group. The flavin is supposed to react with molecular oxygen in the active site of the monooxygenase component in order to generate a flavin hydroperoxide intermediate that serves as the active oxidant for substrate oxidation. A separate flavin reductase is thus absolutely required to supply the reduced flavins (with NADPH or NADH as the reductant) that diffuse to the oxygenase component. In recent years, the following flavin reductases have been shown to belong to this family: ActVB (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), SnaC (8Thibaut D. Ratet N. Bish D. Faucher D. Debussche L. Blanche F. J. Bacteriol. 1995; 177: 5199-5205Crossref PubMed Google Scholar), and VlmR (9Parry R.J. Li W. J. Biol. Chem. 1997; 272: 23303-23311Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar) for the biosynthesis of the antibiotics actinorhodin in Streptomyces coelicolor, pristinamycin in Streptomyces pristinaespiralis, and valanimycin in Streptomyces viridifaciens; HpaC (10Galan E.D. Prieto M.A. Garcia J.L. J. Bacteriol. 2000; 182: 627-636Crossref PubMed Scopus (156) Google Scholar) for the oxidation of 4-hydroxyphenylacetate in E. coli; DszD (11Gray K.A. Pogrebinsky O.S. Mrachko G.T., Xi, L. Monticello D.J. Squires C.H. Nat. Biotechnol. 1996; 14: 1705-1709Crossref PubMed Scopus (307) Google Scholar) for the conversion of sulfides to sulfoxides and sulfones inRhodococcus sp., allowing the utilization of these microorganisms in fossil fuel desulfurization biotechnological processes; and cB (12Uetz T. Schneider R. Snozzi M. Egli T. J. Bacteriol. 1992; 174: 1179-1188Crossref PubMed Google Scholar) for the degradation of nitrilotriacetate inChelatobacter heintzii. It should be noted that a flavin reductase called FeR (21Vadas A. Monbouquette H.G. Johnson E. Schröder I. J. Biol. Chem. 1999; 274: 36715-36721Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 22Chiu H.J. Johnson E. Schröder I. Rees D.C. Structure. 2001; 9: 311-319Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar), with some homology to ActVB and SnaC, found as a ferric reductase in the hyperthermophilic archaeaArchaeoglobus fulgidus, has been structurally characterized in complex with FMN (22Chiu H.J. Johnson E. Schröder I. Rees D.C. Structure. 2001; 9: 311-319Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). Considering the biological importance of this group of flavin reductases and the very limited amount of available information regarding their substrate specificity, reaction mechanisms, and three-dimensional structure, we found it worth characterizing these enzymes in more detail in order to compare them with the Fre enzyme and get new insights into the protein-flavin interaction. We have chosen ActVB as a representative of this group of flavin reductase and report original data showing that ActVB has a unique mode of flavin binding and operates by a sequential mechanism. In the standard aerobic assay, flavin reductases activities were carried out under aerobic conditions allowing continuous reoxidation of reduced flavin by oxygen. Flavin reductase activity was determined at 25 °C from the decrease of the absorbance at 340 nm (ε340 nm = 6.22 mm−1 cm−1) due to the oxidation of NADH, using a Varian Cary 1 Bio spectrophotometer. Under standard conditions, the spectroscopic cuvette contained, in a final volume of 500 μl, 50 mm Tris/HCl, pH 7.6, 100 μmNADH, and 50 μm FMN. The reaction was initiated by adding 0.5–1 μg of enzyme. Enzyme activities were determined from the linear part of the progress curve, with less than 10% of reduced pyridine nucleotide utilized over the time course of the reaction. One unit of activity is defined as the amount of protein catalyzing the oxidation of 1 μmol of NADH per min. When high concentrations of NAD(P)H were investigated, a 0.1-cm path length cuvette was used (final volume 0.3 ml). The hydrophobic flavin analogues lumichrome, alloxazine, and lumiflavin were dissolved in 100% Me2SO, and the enzymatic assays thus contained 90 mmMe2SO, final concentration. Me2SO concentrations up to 500 mm had no measurable effect onK m and V m values. NAD(P) analogs and flavin concentrations were determined spectroscopically using the following extinction coefficients: AMP and ADP-ribose, ε259 nm = 15.4 mm−1cm−1; β-NAD(P)+, ε259 nm = 17.8 mm−1 cm−1; NMNH, ε338 nm = 5.72 mm−1 cm−1; riboflavin and FMN, ε450 nm = 12.5 mm−1 cm−1; FAD, ε450 nm = 11.3 mm−1 cm−1; lumichrome, ε356 nm = 6.0 mm−1cm−1. For the production of wild-type ActVB, pACTVB plasmid was used (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar), where the actVBstructural gene was placed under the control of the T7 polymerase promotor, in the pT7-7 plasmid. For the production of ActVB-His as C-terminal histidine-tagged fusion protein, the actVB gene was amplified by PCR from the plasmid pACTVB (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) with the oligonucleotide primers GGGAATTCCATATGGCTGCTGACCAGG and CGCGGATCCTCAATGGTGATGGTGATGGTGACCGGCATGCGCGGGCAC, in order to introduce EcoRI, NdeI, andBamHI restriction sites (underlined) and the six histidine codons (in italic type). The 549-base pair PCR product was digested with EcoRI-BamHI, and the resulting fragment was ligated in pUC18 (pUC18-ActVB). This plasmid was sequenced to confirm that no changes had been introduced during PCR amplification. TheNdeI-BamHI fragment from pUC18-ActVB was subsequently cloned in pT7-7, resulting in the plasmid pACTVB His tag. E. coliB834(DE3) pLysS transformed with the appropriate plasmid (pACTVB or pACTVB His tag) was grown at 37 °C and 220 rpm in a 3-liter Erlenmeyer flask containing 1 liter of Luria-Bertani medium in the presence of 200 μg/ml ampicillin and 34 μg/ml chloramphenicol. Growth was monitored by following the absorbance at 600 nm. Expression of ActVB and ActVB-His recombinant proteins was induced by adding isopropyl-1-thio-β-d-galactopyranoside to a final concentration of 250 μm when the optical density of the culture was about 0.3. To minimize the formation of insoluble protein aggregates, cultures were cooled to 25 °C after the addition of isopropyl-1-thio-β-d-galactopyranoside and then further grown for 5 h. Cells were collected by centrifugation for 10 min at 6500 × g at 4 °C. Extraction of soluble proteins was performed by lysozyme digestion and freeze-thawing cycles, in the presence of antiprotease Complete™ buffer. All of the following operations were performed at 4 °C. After ultracentrifugation at 45,000 rpm during 90 min in a Beckman 60 Ti rotor, the supernatant was used as soluble extracts for purification. The soluble extracts (130 mg) were loaded onto an ACA54 column (360 ml) previously equilibrated with 10 mm Tris/HCl, pH 7.6, 10% glycerol, 10 mm EDTA. Proteins were eluted with a flow rate of 0.3 ml/min. Fractions containing flavin reductase activity were pooled and concentrated to 2 ml using a Diaflo cell equipped with a YM 10 membrane. The concentrated enzyme solution was loaded onto a Superdex 75 column (120 ml fromAmersham Biosciences) equilibrated with 25 mmTris/HCl, pH 7.6, 10% glycerol, 10 mm EDTA (buffer A). Proteins were eluted with the same buffer at a flow rate of 0.8 ml/min. Fractions containing flavin reductase activity were pooled and loaded onto a UNO Q column (6 ml; Bio-Rad), equilibrated with buffer A. A linear 0–500 mm NaCl gradient in buffer A was applied for 60 ml. ActVB was eluted with 100 mm NaCl. The soluble extracts (180 mg) were loaded at 0.5 ml/min onto a 25-ml Ni2+-nitrilotriacetic acid column (Qiagen) equilibrated with 50 mm Tris/HCl, pH 7.6 (buffer B). Then the column was washed with 100 ml of buffer B, and elution was achieved with 100 mm imidazole in the same buffer at 1 ml/min. The proteins were then immediately loaded onto a UNO Q column (6 ml; Bio-Rad), and further eluted with a linear 0–500 mm NaCl gradient in buffer B for 60 ml at 1 ml/min. SDS-PAGE polyacrylamide gels (15% polyacrylamide) were done according to Laemmli (23Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207856) Google Scholar). The gels were calibrated with the Amersham Biosciences low molecular weight markers. The native molecular mass of the protein was determined with a Superdex 75 gel filtration column (120 ml; Amersham Biosciences) equilibrated with 25 mm Tris/HCl, pH 7.6, and 150 mm NaCl using a flow rate of 0.4 ml·min−1. Bovine serum albumin (66 kDa), ovalbumin (45 kDa), trypsin inhibitor (20.1 kDa), and cytochrome c (12.4 kDa) were used as the markers for molecular mass. The void volume was determined with ferritin (450 kDa). Protein concentration was determined using the Bio-Rad protein assay reagent (24Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (218585) Google Scholar) with bovine serum albumin as a standard. Anaerobic experiments were carried out in a Jacomex glove box equipped with an HP 8453 diode array spectrophotometer coupled to the measurement cell by optical fibers (Photonetics system). A sample of pure ActVB or ActVB-His protein was boiled for 10 min in the dark, chilled on ice, and then centrifuged for 10 min at 10,000 × g in order to pellet the denatured protein. An aliquot of the supernatant was analyzed both by UV-visible spectroscopy and by thin layer chromatography on silica gel 60 F254 (Merck) with butanol-1/acetic acid/water (10/5/5) as the eluant. As a control, pure FMN, FAD, and riboflavin were run separately or as a mixture under the same conditions. The molar concentration of ActVB was calculated assuming a molecular mass value of the polypeptide chain of 18,260 Da (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Reciprocal initial velocities (1/v i) were plotted against reciprocal substrate concentrations (1/[S]) and fitted with a straight line determined by a linear regression program. In some cases, kinetic parameters (V m, K m,K m(app)) were determined from saturation curves, fitted with the following equation: v i = (V m[S])/(K m + [S]), using a Levenberg-Marquardt algorithm. Inhibition constants (K i) for competitive inhibitors were determined using a secondary plot of the slopes from the double reciprocal plots against the concentration of the inhibitor [I], corresponding to the following equation: y = (K m/V m) (1 + ([I]/K i)) (25Segel I.H. Enzyme Kinetics. John Wiley & Sons, Inc., New York1975Google Scholar). In the cases of noncompetitive and uncompetitive inhibitors, the inhibition constant (K i) was determined using a secondary plot of the intercepts from the double reciprocal plot against the concentration of the inhibitor [I], corresponding to the following equation:y = (([I]/(K i V m)) + 1/V m (25Segel I.H. Enzyme Kinetics. John Wiley & Sons, Inc., New York1975Google Scholar). When applicable, values are shown ± S.D. In a first set of experiments, ActVB was overexpressed in E. coli using the pACTVB plasmid (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Using the purification procedure described under “Experimental Procedures,” a low yield (6–7%) of purified ActVB could be obtained (Table I, top). This was then explained by the great instability of the flavin reductase activity in the soluble extracts. The activity, routinely assayed from the oxidation of NADH by an excess of FMN monitored spectrophotometrically, was found to decrease by 50% when the protein was left in buffer for 3 h at 4 °C. The addition of 10% glycerol, 10 mm EDTA, and CompleteTM buffer solution to the soluble extracts provided a significant stabilization of the activity (data not shown). However, even under these conditions, more than 90% of the flavin reductase activity was lost during the first two chromatographic steps (Table I, top). After the UNO Q column, activity remained stable, suggesting that instability of ActVB activity in soluble extracts arose from reactions with some cellular components. SDS-PAGE analysis after the UNO Q purification step revealed the presence of two polypeptide bands at 18,000 and 17,000 Da (data not shown), with the same AADQGMLRDA N-terminal sequence corresponding to the ActVB protein (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). This suggested a partial C-terminal proteolysis of ActVB when expressed inE. coli, as described previously (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). In contrast, overexpression of ActVB as a C-terminal His-tagged fusion protein (ActVB-His) allowed a more efficient purification of the enzyme (TableI, bottom). SDS-PAGE analysis after the UNO Q column revealed the presence of only one polypeptide chain at 18,000, without evidence for partial proteolysis (data not shown).Table IPurification stepProteinActivity1-aEnzyme activity was determined at 25 °C using the standard aerobic assay in the presence of 100 μm NADH and 50 μm FMN.Specific activityRecoverymgμmol min −1μmol min −1 mg −1%Purification of ActVB Soluble fraction1309107100 ACA 5440360940 Superdex 753.661176.7 UNO Q1.857326.2Purification of ActVB-His Soluble fraction1809005100 Ni2+-nitrilotriacetic acid113082834 UNO Q828035311-a Enzyme activity was determined at 25 °C using the standard aerobic assay in the presence of 100 μm NADH and 50 μm FMN. Open table in a new tab Gel filtration experiments on a Superdex 75 column with ActVB and ActVB-His gave an apparent molecular mass of 36,000 Da for both proteins, confirming the homodimeric structure for ActVB (7Kendrew S.G. Harding S.E. Hopwood D.A. Marsh E.N.G. J. Biol. Chem. 1995; 270: 17339-17343Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). Flavin reductase specific activities of both ActVB and ActVB-His proteins were found to be comparable (Table I), indicating that the C-terminal part of the protein lost during proteolysis was not important for activity and that the presence of the His tag was neutral with regard to the enzyme activity. However, it should be noted that from one preparation to another, we obtained purified proteins with slightly different specific flavin reductase activities. In the following experiments presented here, we report data obtained with ActVB. In the case of the kinetic experiments, the same enzyme preparation was used, allowing a direct comparison of the parameters obtained under different kinetic conditions. Purified ActVB was yellow, with absorption spectra typical for a flavin-containing protein, with maxima at 378 and 455 nm (Fig. 1). After denaturation of the protein by boiling for 10 min and centrifugation, the chromophore contained in the supernatant was analyzed by thin layer chromatography with FMN, riboflavin, and FAD as standards. The chromophore was identified as FMN (data not shown). Quantification of the free FMN released in the supernatant by UV-visible spectroscopy demonstrated that the amount of FMN in purified ActVB varied from one preparation to another from 0.1 to 0.6 mol of FMN/mol of polypeptide chain. An extinction coefficient of 13,640 m−1cm−1 at 455 nm for the bound FMN was calculated. Reconstitution experiments of ActVB with FMN or riboflavin gave the following results. A preparation of ActVB (50 μm) containing little FMN (0.1 mol of FMN/mol of protein) was incubated with 1 mm FMN or 400 μm riboflavin for 1 h in 50 mm Tris/HCl buffer, pH 7.6, and then chromatographed on an NAP10™ column (Amersham Biosciences) in order to remove unbound flavin. The protein was then analyzed both by UV-visible spectroscopy and thin layer chromatography, as previously described, in order to identify and quantify the bound flavin in the reconstituted ActVB. Reconstitution with FMN resulted in a 6–7-fold increase of the amount of protein-bound FMN and a protein containing 0.6–0.7 mol of FMN/mol of protein (data not shown). In contrast, reconstitution with riboflavin failed to increase the amount of protein-bound flavin and did not result in the removal of FMN initially bound to ActVB (data not shown). In order to verify that the FMN bound to the isolated ActVB protein was correctly located at the flavin reductase active site, reductive titration of FMN was carried out with NADH, under anaerobic conditions. A preparation of ActVB containing 0.5 mol of FMN/mol of ActVB polypeptide chain (18,260 Da) was used for that experiment. As shown in Fig. 2, the addition of NADH caused a decrease in the absorbance at 455 nm, reflecting a reduction of FMN. An isosbestic point at 510 nm was observed for substoichiometric concentrations of NADH. In the inset of Fig. 2, a plot of the fractional absorbance changes at 445 nm as a function of the [NADH]/[FMN] ratio showed that 1 mol of NADH was sufficient to reduce 1 mol of bound FMN. In addition, during the NADH titration, a broad absorption band above 550 nm developed (Fig. 2). Such a band is tentatively assigned to a charge transfer complex of reduced FMN with NAD+ within the active site of ActVB rather than to a flavin-neutral semiquinone species (26Massey V. Matthews R.G. Foust G.P. Howell L.G. Williams C.H. Zanetti G. Ronchi S. Sund H. Pyridine Nucleotide-Dependent Dehydrogenases. Springer-Verlag, Berlin1970: 393-409Crossref Google Scholar, 27Zanetti G. Aliverti A. Muller F. Chemistry and Biochemistry of Flavoproteins. CRC Press, Inc., Boca Raton, FL1991: 306-312Google Scholar), as confirmed by the following experiment (Fig. 3). An anaerobic solution of ActVB, containing 0.5 mol of bound FMN/mol of polypeptide chain, EDTA, and a catalytic amount of deazaflavin was photoreduced and then titrated with increasing amounts of NAD+. As shown in Fig. 3, irradiation resulted in the decrease of the absorbance at 455 nm, consistent with reduction of FMN by photoreduced deazaflavin. When NAD+ was added, a broad band developed at wavelengths greater than 520 nm, which was similar to that observed during reaction of ActVB-bound FMN with NADH. In addition, no significant increase in absorbance at 340 nm was observed, indicating that no NADH was formed during incubation of reduced FMN with NAD+. This shows that the reduction of FMN by NADH at the active site of ActVB is irreversible.Figure 3Anaerobic titration of reduced ActVB-bound FMN with NAD+. Spectra of ActVB (130 μm) containing oxidized FMN-bound (65 μm) in 50 mm Tris/HCl buffer, pH 7.6, 5 mm EDTA, and 1.4 μm 5-deazaflavin (○). Spectra are shown after irradiation for 30 min (●) and after irradiation and the anaerobic addition of 5 μm (▵), 20 μm (■), and 70 μm (▴) NAD+.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The previous experiments have shown that the purified protein contains various amounts of FMN bound at its active site, depending on the enzyme preparation. In order to investigate the dependence of the flavin reductase activity of ActVB on the amount of protein-bound FMN, different preparations containing various amounts of FMN were assayed either with FMN or riboflavin as a substrate and with NADH as the electron donor (Table" @default.
• W2019965461 created "2016-06-24" @default.
• W2019965461 creator A5005455397 @default.
• W2019965461 creator A5062221634 @default.
• W2019965461 creator A5062388702 @default.
• W2019965461 date "2003-01-01" @default.
• W2019965461 modified "2023-09-27" @default.
• W2019965461 title "Mechanism and Substrate Specificity of the Flavin Reductase ActVB from Streptomyces coelicolor" @default.
• W2019965461 cites W1514998706 @default.
• W2019965461 cites W1588756347 @default.
• W2019965461 cites W1595604283 @default.
• W2019965461 cites W1885317482 @default.
• W2019965461 cites W1927794787 @default.
• W2019965461 cites W1972140317 @default.
• W2019965461 cites W1982139124 @default.
• W2019965461 cites W1984803944 @default.
• W2019965461 cites W1988919519 @default.
• W2019965461 cites W1999200457 @default.
• W2019965461 cites W2008264826 @default.
• W2019965461 cites W2016276202 @default.
• W2019965461 cites W2030695566 @default.
• W2019965461 cites W2030946819 @default.
• W2019965461 cites W2034571889 @default.
• W2019965461 cites W2043604835 @default.
• W2019965461 cites W2049543473 @default.
• W2019965461 cites W2094377192 @default.
• W2019965461 cites W2100837269 @default.
• W2019965461 cites W2134882556 @default.
• W2019965461 cites W2169670218 @default.
• W2019965461 cites W2170186817 @default.
• W2019965461 cites W2963225269 @default.
• W2019965461 cites W4292544429 @default.
• W2019965461 cites W4293247451 @default.
• W2019965461 doi "https://doi.org/10.1074/jbc.m209689200" @default.
• W2019965461 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12417584" @default.
• W2019965461 hasPublicationYear "2003" @default.
• W2019965461 type Work @default.
• W2019965461 sameAs 2019965461 @default.
• W2019965461 citedByCount "45" @default.
• W2019965461 countsByYear W20199654612012 @default.
• W2019965461 countsByYear W20199654612014 @default.
• W2019965461 countsByYear W20199654612016 @default.
• W2019965461 countsByYear W20199654612017 @default.
• W2019965461 countsByYear W20199654612018 @default.
• W2019965461 countsByYear W20199654612019 @default.
• W2019965461 countsByYear W20199654612020 @default.
• W2019965461 countsByYear W20199654612021 @default.
• W2019965461 crossrefType "journal-article" @default.
• W2019965461 hasAuthorship W2019965461A5005455397 @default.
• W2019965461 hasAuthorship W2019965461A5062221634 @default.
• W2019965461 hasAuthorship W2019965461A5062388702 @default.
• W2019965461 hasBestOaLocation W20199654611 @default.
• W2019965461 hasConcept C121332964 @default.
• W2019965461 hasConcept C134651460 @default.
• W2019965461 hasConcept C181199279 @default.
• W2019965461 hasConcept C185592680 @default.
• W2019965461 hasConcept C18903297 @default.
• W2019965461 hasConcept C2777289219 @default.
• W2019965461 hasConcept C2779920670 @default.
• W2019965461 hasConcept C2780681812 @default.
• W2019965461 hasConcept C2994592520 @default.
• W2019965461 hasConcept C33093398 @default.
• W2019965461 hasConcept C523546767 @default.
• W2019965461 hasConcept C54355233 @default.
• W2019965461 hasConcept C55493867 @default.
• W2019965461 hasConcept C62520636 @default.
• W2019965461 hasConcept C71240020 @default.
• W2019965461 hasConcept C86803240 @default.
• W2019965461 hasConcept C89423630 @default.
• W2019965461 hasConcept C89611455 @default.
• W2019965461 hasConceptScore W2019965461C121332964 @default.
• W2019965461 hasConceptScore W2019965461C134651460 @default.
• W2019965461 hasConceptScore W2019965461C181199279 @default.
• W2019965461 hasConceptScore W2019965461C185592680 @default.
• W2019965461 hasConceptScore W2019965461C18903297 @default.
• W2019965461 hasConceptScore W2019965461C2777289219 @default.
• W2019965461 hasConceptScore W2019965461C2779920670 @default.
• W2019965461 hasConceptScore W2019965461C2780681812 @default.
• W2019965461 hasConceptScore W2019965461C2994592520 @default.
• W2019965461 hasConceptScore W2019965461C33093398 @default.
• W2019965461 hasConceptScore W2019965461C523546767 @default.
• W2019965461 hasConceptScore W2019965461C54355233 @default.
• W2019965461 hasConceptScore W2019965461C55493867 @default.
• W2019965461 hasConceptScore W2019965461C62520636 @default.
• W2019965461 hasConceptScore W2019965461C71240020 @default.
• W2019965461 hasConceptScore W2019965461C86803240 @default.
• W2019965461 hasConceptScore W2019965461C89423630 @default.
• W2019965461 hasConceptScore W2019965461C89611455 @default.
• W2019965461 hasIssue "1" @default.
• W2019965461 hasLocation W20199654611 @default.
• W2019965461 hasLocation W20199654612 @default.
• W2019965461 hasLocation W20199654613 @default.
• W2019965461 hasOpenAccess W2019965461 @default.
• W2019965461 hasPrimaryLocation W20199654611 @default.
• W2019965461 hasRelatedWork W1660328121 @default.
• W2019965461 hasRelatedWork W1969609483 @default.
• W2019965461 hasRelatedWork W1973769186 @default.
• W2019965461 hasRelatedWork W2019965461 @default.

• next