FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2020133311> ?p ?o ?g. }

• W2020133311 endingPage "22175" @default.
• W2020133311 startingPage "22167" @default.
• W2020133311 abstract "Human cDNA clones encoding the UUAG-binding heterogeneous nuclear ribonucleoprotein (hnRNP) D0 protein have been isolated and expressed. The protein has two RNA-binding domains (RBDs) in the middle part of the protein and an RGG box, a region rich in glycine and arginine residues, in the C-terminal part (“2xRBD-Gly” structure). The hnRNP A1, A2/B1, and D0 proteins, all possess common features of the 2xRBD-Gly structure and binding specificity toward RNA. Together, they form a subfamily of RBD class RNA binding proteins (the 2xRBD-Gly family). One of the structural characteristics shared by these proteins is the presence of several isoforms presumably resulting from alternative splicing. Filter binding assays, using the recombinant hnRNP D0 proteins that have one of the two RBDs, indicated that one RBD specifically binds to the UUAG sequence. However, two isoforms with or without a 19-amino acid insertion at the N-terminal RBD showed different preference toward mutant RNA substrates. The 19-amino acid insertion is located in the N-terminal end of the first RBD. This result establishes the participation of the N terminus of RBD in determining the sequence specificity of binding. A similar insertion was also reported with the hnRNP A2/B1 proteins. Thus, it might be possible that this type of insertion with the 2xRBD-Gly type RNA binding proteins plays a role in “fine tuning” the specificity of RNA binding. RBD is supposed to bind with RNA in general and sequence-specific manners. These two discernible binding modes are proposed to be performed by different regions of the RBD. A structural model of these two binding sites is presented. Human cDNA clones encoding the UUAG-binding heterogeneous nuclear ribonucleoprotein (hnRNP) D0 protein have been isolated and expressed. The protein has two RNA-binding domains (RBDs) in the middle part of the protein and an RGG box, a region rich in glycine and arginine residues, in the C-terminal part (“2xRBD-Gly” structure). The hnRNP A1, A2/B1, and D0 proteins, all possess common features of the 2xRBD-Gly structure and binding specificity toward RNA. Together, they form a subfamily of RBD class RNA binding proteins (the 2xRBD-Gly family). One of the structural characteristics shared by these proteins is the presence of several isoforms presumably resulting from alternative splicing. Filter binding assays, using the recombinant hnRNP D0 proteins that have one of the two RBDs, indicated that one RBD specifically binds to the UUAG sequence. However, two isoforms with or without a 19-amino acid insertion at the N-terminal RBD showed different preference toward mutant RNA substrates. The 19-amino acid insertion is located in the N-terminal end of the first RBD. This result establishes the participation of the N terminus of RBD in determining the sequence specificity of binding. A similar insertion was also reported with the hnRNP A2/B1 proteins. Thus, it might be possible that this type of insertion with the 2xRBD-Gly type RNA binding proteins plays a role in “fine tuning” the specificity of RNA binding. RBD is supposed to bind with RNA in general and sequence-specific manners. These two discernible binding modes are proposed to be performed by different regions of the RBD. A structural model of these two binding sites is presented. Ribonucleoproteins have been found in many macromolecular complexes that have vital biological roles, such as heterogeneous nuclear ribonucleoprotein (hnRNP) 1The abbreviations used are: hnRNPheterogeneous nuclear ribonucleoproteinsnRNPsmall nuclear ribonucleoproteinPCRpolymerase chain reactionbpbase pair(s)RBDRNA binding domainMES2-(N-morpholino)ethanesulfonic acid. (1Dreyfuss G. Matunis M.J. Piñol-Roma S. Burd C.G. Annu. Rev. Biochem. 1993; 62: 289-321Crossref PubMed Scopus (1340) Google Scholar), small nuclear ribonucleoprotein (snRNP), ribosomes, and signal recognition particles. These complexes are composed of RNAs and proteins, many of which show RNA binding activities. One of the most common groups of RNA binding proteins is the RBD class proteins(2Kenan D.J. Query C.C. Keene J.D. Trends Biochem. Sci. 1991; 16: 214-220Abstract Full Text PDF PubMed Scopus (621) Google Scholar). They possess a CS-RBD (consensus sequence-RNA binding domain) motif, which is typically 80-90 amino acids. Two short sequences, RNP 2 octamer and RNP 1 hexamer, have been found to be conserved among different RBDs. Several RBDs are commonly found in tandem within one molecule. It is also common to find an auxiliary RNA-binding motif present in addition to RBDs within the same molecule. Thus, RBD class RNA binding proteins typically possess several RNA-binding domains as modules. It has not been well studied, however, how these modular domains participate together in binding with RNA. heterogeneous nuclear ribonucleoprotein small nuclear ribonucleoprotein polymerase chain reaction base pair(s) RNA binding domain 2-(N-morpholino)ethanesulfonic acid. hnRNP proteins are a subset of proteinaceous components found in hnRNP, which is a large complex formed by the nascent pre-mRNA and proteins(1Dreyfuss G. Matunis M.J. Piñol-Roma S. Burd C.G. Annu. Rev. Biochem. 1993; 62: 289-321Crossref PubMed Scopus (1340) Google Scholar, 2Kenan D.J. Query C.C. Keene J.D. Trends Biochem. Sci. 1991; 16: 214-220Abstract Full Text PDF PubMed Scopus (621) Google Scholar, 3Kiledjian M. Burd C.G. Görlach M. Portman D.S. Dreyfuss G. Nagai K. Mattaj I.W. RNA-protein interactions. Oxford University Press, Oxford1994: 127-149Google Scholar). More than 20 proteins have been identified as hnRNP proteins on two-dimensional protein gel electrophoresis. Although structures of all of these proteins are not known, many contain RBDs, which are the regions responsible for interaction with RNA. Some hnRNP proteins have been implicated in the processing of pre-mRNA. Anti-hnRNP C protein antibody inhibited pre-mRNA splicing in vitro(4Choi Y.D. Grabowski P.J. Sharp P.A. Dreyfuss G. Science. 1986; 231: 1534-1539Crossref PubMed Scopus (252) Google Scholar, 5Sierakowska H. Szer W. Furdon P.J. Kole R. Nucleic Acids Res. 1986; 14: 5241-5254Crossref PubMed Scopus (72) Google Scholar). Several hnRNP proteins were reported to be associated in spliceosomal complexes(6Bennett M. Piñol-Roma S. Staknis D. Dreyfuss G. Reed R. Mol. Cell. Biol. 1992; 12: 3165-3175Crossref PubMed Scopus (117) Google Scholar, 7Bennett M. Michaud S. Kingston J. Reed R. Genes & Dev. 1992; 6: 1986-2000Crossref PubMed Scopus (176) Google Scholar). Finally, the hnRNP A1 and A2/B1 have been shown to influence the splice site selection(8Mayeda A. Krainer A.R. Cell. 1992; 68: 365-375Abstract Full Text PDF PubMed Scopus (588) Google Scholar, 9Mayeda A. Helfman D.M. Krainer A.R. Mol. Cell. Biol. 1993; 13: 2993-3001Crossref PubMed Scopus (202) Google Scholar, 10Mayeda A. Munroe S.H. Cáceres J.F. Krainer A.R. EMBO J. 1994; 13: 5483-5495Crossref PubMed Scopus (280) Google Scholar). These observations suggest that hnRNP proteins may have a role in specific RNA processing reactions by virtue of sequence-specific RNA binding in addition to nonspecific general RNA binding. In spite of this expectation, only a small number of hnRNP proteins have been shown to bind to RNA in a sequence-specific manner. In a previous study, we showed that several different proteins from the HeLa cell nuclear extract specifically bind to single-stranded d(TTAGGG)4 and r(UUAGGG)4 oligonucleotides (11Ishikawa F. Matunis M.J. Dreyfuss G. Cech T.R. Mol. Cell. Biol. 1993; 13: 4301-4310Crossref PubMed Scopus (225) Google Scholar). These proteins have apparent molecular masses of 26, 28, 37, 39, 41, 50, and 55 kDa. Amino acid sequencing of the purified proteins indicated that the 26-, 28-, and 50-kDa proteins are the hnRNP A1 protein, A2/B1 protein, and nucleolin, respectively. The 39- and 41-kDa proteins were immunoreactive to anti-hnRNP D monoclonal antibodies. On two-dimensional gel electrophoresis, they migrated as spots near, but separate from, the hnRNP D protein. We suggested that the 39- and 41-kDa proteins are identical or closely related to the hnRNP D protein. Similarly, the 37-kDa protein was suggested to be identical or closely related to the hnRNP E protein and was referred to as hnRNP E0. In this study, we will refer to the 39- and 41-kDa hnRNP D-like proteins having UUAGGG-binding activity as hnRNP D0 proteins. The hnRNP A1, A2/B1, D0, and E0 proteins bound to UUAGGG repeats but not to single base-substituted oligoribonucleotides, such as CUAGGG-, UCAGGG-, UUGGGG-, or UUAAGG repeats. Thus, their binding to these substrates is exceptionally sequence-specific compared with other hnRNP proteins. This feature offers an opportunity to study the molecular interaction between RBD and RNA. In this study, we first examined the cDNA structure of the hnRNP D0 proteins. Results revealed that the hnRNP D0 protein has a modular structure in common with the hnRNP A1 and A2/B1 proteins. We next examined the RNA binding properties of each modular domain of the hnRNP D0 proteins. A model for molecular interaction between the protein and RNA is proposed based upon these structural and functional analyses. Oligonucleotides were synthesized either by an Applied Biosystems 380B synthesizer or by a Perceptive Expedite System 8900. All oligonucleotides were purified by denaturing acrylamide gel electrophoresis and Sep-pak C18 cartridges (Waters). The sequences are as follows: S1, 5′-d(CTGAATTCCATGGGAACGACACTCTGAAGCA)-3′; S2, 5′-d(CAGTCGACGAATTCAACCGGCTCTTTTGTT)-3′; S3, 5′-d(CTGAATTCCATGGCCATGAAAACAAAAGAGCC)-3′; S4, 5′-d(CAGTCGACGAATTCTTGCTGTTGCTGATATT)-3′; P1, 5′-d(CGGATCCAAATGTCGGAGGAGCAGTT)-3′; P3, 5′-d(AGGATCCAAGCCAGTAAGAACGAGGA)-3′; P4, 5′-d(CGAATTCTCAGGCTTTGGCCCTTTTAG)-3′; P5, 5′-d(CGGATCCAAGCCATGAAAACAAAAGA)-3′; P6, 5′-d(CGAATTCTCACGACATGGCTACTTTTA)-3′; rH4, 5′-r(UUAGGG)4-3′; rH4X1, 5′-r(UUGGGG)4-3′ and rECGF, 5′-r(GCAGCCUUGAUGACCUCGUGAACC)-3′. Two DNA fragments of human E2BP cDNA were prepared by PCR using two primer sets of S1, S2 and S3, S4. A 292-bp fragment generated by S1 and S2 (corresponding to positions 210-501 of GenBank™ M94630) and a 281-bp fragment generated by S3 and S4 (corresponding to positions 477-759 of GenBank™ M94630) were obtained. They were 32P-labeled and were used to screen the cDNA library. A HeLa cDNA library was constructed using 4 μg of HeLa poly(A)+ RNA using λEXlox vector (Novagen). A total of 2 × 106 plaques were screened by the two E2BP cDNA-specific probes. Nine clones, cDx1-9, were identified as being positive by both probes. The clones were sequenced by an Autocycle Sequencing kit and an ALF. DNA Sequencer (Pharmacia Biotech Inc.). To obtain cDNA fragments encoding truncated mutant hnRNP D0 proteins, parts of cDNA were generated by reverse transcription-PCR amplification from HeLa poly(A)+ RNA using different sets of PCR primers. Fragments encoding RBD-1 were generated by P3 and P4 primers. Two DNA fragments of different sizes were obtained. One RBD-1 with and one without the 19-amino acid insertion (see “Results”). A fragment encoding RBD-2 was generated by P5 and P6 primers. Fragments encoding RBD-1 and −2 were generated by P3 and P6 primers. Again, two DNA fragments of different sizes were obtained, corresponding to RBD-1 and −2 with and without the 19-amino acid insertion in RBD-1. To construct cDNAs encoding +/− and -/+ type isoform proteins (for explanations see “Results”), first, 5′-parts of cDNA coding for the N-terminal portion and RBD-1 with and without the 19-amino acid insertion, were prepared by reverse transcription-PCR using primers P1 and P4. P1 starts at the initiating codon of cDNA. 3′-parts of cDNA were derived from cloned cDNA, cDx4, and 7. As both PCR-derived 5′-parts and cDNA-derived 3′-parts have a common unique BglII site, they were digested at this restriction site and were ligated to give rise to all of the entire coding regions. All of these truncated cDNAs were subcloned into pGEX-5X-1 (Pharmacia). All hnRNP D0 protein fragments were expressed as fused proteins with glutathione S-transferase for easier purification. Each of the pGEX-5X-1 plasmids containing truncated cDNA fragments was transformed into Escherichia coli strain JM105 or BL21 (DE3) pLysS. Bacterial cultures grown in L-rich medium (2.5% tryptone, 0.75% yeast extract, 0.5% NaCl, 0.2% glucose) were treated by 0.2 mM isopropyl-1-thio-β-D-galactopyranoside for 4 h to induce protein expression when their A600 reached 0.4-0.6. Cells were pelleted, frozen at −70°C, thawed in NTEN150 (20 mM Tris-HCl pH 8.0, 1 mM, 150 mM NaCl, 0.5% (v/v) Nonidet P-40), and sonicated. Extracts were centrifuged twice at 10,000 × g for 15 min. All of the glutathione S-transferase fusion proteins were soluble. The supernatant was treated with glutathione-Sepharose 4B (Pharmacia) on ice for 30 min. Then the glutathione-Sepharose 4B was washed with NTEN100 (20 mM Tris-HCl pH 8.0, 1 mM EDTA, 100 mM NaCl, 0.5% (v/v) Nonidet P-40) by centrifuging at 5000 × g, for 20 s at 4°C three times. Proteins were eluted from glutathione-Sepharose 4B by an elution buffer (50 mM Tris-HCl, pH 8.0, 20 mM glutathione). Some fusion proteins were digested by Factor Xa to remove glutathione S-transferase before further purification. To cleave at the Factor Xa recognition site that is present between the glutathione S-transferase and the hnRNP D0 sequences, CaCl2 was added to protein samples to a final concentration of 5 mM. Factor Xa was added to the solution, which was incubated at room temperature overnight. Then, to remove bacterial RNA in samples, 50 units of micrococcal nuclease was added. Samples were incubated at 37°C for 10 min. The reaction was terminated by adding EGTA to 50 mM. To purify the proteins by ion exchange chromatography, an equal volume of 0.5 M MES, pH 5.0 was added to samples, which were loaded on a HiTrap SP column (Pharmacia). Recombinant proteins were eluted by 0.1 M NaCl, 20 mM Tris-HCl pH 7.5. Eluted samples were concentrated and suspended in 0.1 M NaCl, 10% glycerol, and 20 mM Tris-HCl, pH 7.5, by Centricon 10 (Amicon). Concentrated samples were loaded on a Sephadex 75 HR gel filtration chromatography (Pharmacia) equilibrated by 0.5 M NaCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, and 20 mM Tris-HCl, pH 7.4. Purified proteins were concentrated and suspended in a binding buffer, BB (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 50 mM NaCl 10% (v/v) glycerol) by Centricon 10. Protein concentrations were measured by a protein assay kit (Bio-Rad) with bovine serum albumin as a standard. Recombinant hnRNP D0 proteins were diluted with BB immediately before use. They were incubated with 1-0.1 nM of 32P-labeled RNA probes in 100 μl of BB. After incubation at room temperature for 20 min, reactions were filtrated through a nitrocellulose membrane (Schleicher & Schuell), and membranes were dried at 100°C. The radioactivities were measured by liquid scintillation counting. About 5% of the input radioactivity was measured as background in the absence of any protein in the reaction mixture. This background count was subtracted from the measured counts to give rise to specific binding counts. Previously, we described amino acid sequences of five peptides obtained from the purified human hnRNP D0 proteins(11Ishikawa F. Matunis M.J. Dreyfuss G. Cech T.R. Mol. Cell. Biol. 1993; 13: 4301-4310Crossref PubMed Scopus (225) Google Scholar). They were identical, or nearly identical, to sequences that had been reported under several different protein names. These included the human hnRNP C protein, the rat hnRNP C-type protein, and the E2BP hepatitis B enhancer binding protein (12Lahili D.K. Thomas J.O. Nucleic Acids Res. 1986; 14: 4077-4094Crossref PubMed Scopus (23) Google Scholar, 13Sharp Z.D. Smith K.P. Cao Z. Helsel S. Biochim. Biophys. Acta. 1990; 1048: 306-309Crossref PubMed Scopus (8) Google Scholar, 14Tay N. Chan S.-H. Ren E.-C. J. Virol. 1992; 66: 6841-6848Crossref PubMed Google Scholar). It was highly possible that these proteins were derived from the same gene as the hnRNP D0 proteins. Although the reported cDNA sequences were closely related to each other, several base insertions, deletions, and substitutions that changed the open reading frames were noted. Therefore, we first isolated the cDNA clones and examined the primary structure. The predicted amino acid sequences deduced from the E2BP cDNA revealed that this protein has two RBDs(14Tay N. Chan S.-H. Ren E.-C. J. Virol. 1992; 66: 6841-6848Crossref PubMed Google Scholar). Two sets of PCR primers, S1:S2 and S3:S4 were prepared according to the reported sequences of each RBD. Accordingly, two DNA fragments derived from E2BP cDNA were obtained by reverse transcription-PCR from the two primer sets using the total RNA of HeLa cells. A total of 200,000 clones of the HeLa cell cDNA library were prepared by oligo(dT)-priming and were screened by these E2BP-specific probes. Nine different clones were determined to be double-positive by the probes. The longest clone, cDx7, was sequenced completely, identifying a 1589-bp cDNA insert (Fig. 1). A long open reading frame, bound by TAG at 226-228 and TAA at 1204-1206, was identified. A polyadenylation signal sequence, AATAAA, was noted at 1541-1546. ATG at 286-288 was tentatively assigned as an initiating codon. It was predicted that the open reading frame encodes a 306-amino acid protein with a calculated molecular weight of 32,800. All five amino acid sequences identified in peptides, obtained from the purified hnRNP D0 proteins, were found in the predicted amino acid sequence, except that one amino acid substitution was noted (Fig. 1). As will be described later, the recombinant protein of this cDNA is immunoreactive to an anti-hnRNP D monoclonal antibody and binds to the d(TTAGGG)4 and r(UUAGGG)4 oligonucleotides specifically. Therefore, we concluded that the cDNA clones we have isolated are for the hnRNP D0 proteins. The nucleotide sequence of cDx7 is different from that of E2BP in several ways. cDx7 has a longer 5′ upstream sequence than E2BP, allowing us to locate the most probable initiating codon. Several nucleotides were missing or replaced by other nucleotides in E2BP, resulting in changes to the open reading frame and the predicted amino acids. The detail of discordance is presented in Fig. 1. These discordant sequences were repeatedly examined with cDx7 and with our other cDNA clones, giving the same results. The predicted amino acid sequence of cDx7 can be divided into three parts. The N-terminal 69 amino acids forms an acidic region that is unique to this protein. Alanine and glycine are abundant in this region (27 and 29%, respectively). Two short motifs of GGSA and EGA are found repeatedly in tandem (amino acids 20-29 and 58-66). The Chow and Fasman algorithm predicts that this region contains four α-helices. The second portion, occupying the central and major part of the protein, consists of two typical RBDs. Two RBDs are arranged in tandem (amino acids 70-173 and 174-256) without any apparent spacer sequence between them. Further analysis of the structure of this portion will be presented later. The third portion, the C-terminal third of the protein, starts after a short repeat of glutamine (amino acids 262-268) and is characterized by high contents of glycine (32% of amino acids 269-306). In this region, three repeats of RGG are noted (amino acids 272-274, 282-284, and 334-336). RGG has been found in several RBD class RNA binding proteins(15Cobianchi F. Karpel R.L. Williams K.R. Notario V. Wilson S.H. J. Biol. Chem. 1988; 263: 1063-1071Abstract Full Text PDF PubMed Google Scholar). It has been suggested that it is an auxiliary motif responsible for protein-protein interaction or nonspecific nucleic acid binding(16Nadler S.G. Merrill B.M. Roberts W.J. Keating K.M. Lisbin M.J. Barnett S.F. Wilson S.H. Williams K.R. Biochemistry. 1991; 30: 2968-2976Crossref PubMed Scopus (74) Google Scholar). Restriction mapping of other cDNA clones revealed the presence of several isoforms of cDNAs (Fig. 2). In summary, they can be classified into three types. One class is represented by the clone cDx4. Nucleotide sequencing of this cDNA reveals a 57-bp deletion (nucleotides 518-574 of cDx7, Fig. 1) in the 5′-coding region, and a 147-bp insertion in the 3′-coding region (between nucleotides 1138 and 1139 of cDx7). These variations result in a 19-amino acid deletion in the N-terminal portion of RBD-1 and a 49-amino acid insertion in the C-terminal Gly-rich region. The primary open reading frame is not affected by these deletions and insertions. The inserted 49-amino acid sequence revealed a unique feature. The sequence consists primarily of Gly, Tyr, and Asn (69% of 49-amino acid sequence). A motif of GY(G/N) repeatedly appears in this sequence. A stretch of eight amino acids, WNQGY(S/G)NY, appears in tandem twice. The second class is represented by cDx9. This clone has both 57- and 147-bp insertions in the 5′- and 3′-region. The third class is represented by cDx7 with the 57-bp insertion but without the 147-bp insertion. When insertion or deletion is shown as + or - in the order of the 57- and 147-bp sequences, +/+ is cDx2, −5, and −9; +/− is cDx1, 6, 7, and 8; and -/+ is cDx4. Thus, it is suggested that +/+ and +/− classes are equally abundant and that clones having the 57-bp deletion in the 5′-portion are relatively minor. cDx8 is characterized by another insertion of 108 bp in the 3′-untranslated region. Several hnRNP genes have been shown to produce variant mRNAs resulting from alternative splicing. This mechanism expands the complexity of hnRNP proteins. The differences found in our cDNA clones most likely comes from alternative splicing as well, although at present we do not have any direct evidence for it. We have not isolated cDNA of the −/− type. Thus, we could expect at least three different isoforms of mRNAs with or without the 57- and 147-bp insertions. The shortest +/− type encodes 306 amino acids with a molecular mass of 32.8 kDa. The intermediate -/+ type encodes 336 amino acids with a molecular mass of 36.2 kDa. Finally the longest +/+ mRNA predicts 355 amino acids with a molecular mass of 38.4 kDa. A previous SDS-polyacrylamide gel electrophoresis analysis identified proteins of apparent molecular masses of 41 kDa (possibly doublet) and 39 kDa as anti-hnRNP D monoclonal antibody-immunoreactive proteins in a TTAGGG-binding protein preparation(11Ishikawa F. Matunis M.J. Dreyfuss G. Cech T.R. Mol. Cell. Biol. 1993; 13: 4301-4310Crossref PubMed Scopus (225) Google Scholar). The presence of isoform mRNAs described above may explain the presence of native proteins with different apparent molecular masses. The proteins' mobility on SDS-polyacrylamide gel electrophoresis was slower than expected from the calculated molecular mass values. This may be in part due to the basic nature of these proteins (the calculated pI is about 8.8). A homology search of GenBank™ (release 87) indicated that many RNA-binding proteins have significant homology with the hnRNP D0 proteins: the DNA binding protein E2BP(14Tay N. Chan S.-H. Ren E.-C. J. Virol. 1992; 66: 6841-6848Crossref PubMed Google Scholar), the hnRNP C type protein(12Lahili D.K. Thomas J.O. Nucleic Acids Res. 1986; 14: 4077-4094Crossref PubMed Scopus (23) Google Scholar), the A+U-rich RNA binding protein AUF1(17Zhang W. Wagner B.J. Ehrenman K. Schaefe A.W. DeMaria C.T. Crater D. DeHaven K. Long L. Brewer G. Mol. Cell. Biol. 1993; 13: 7652-7665Crossref PubMed Scopus (497) Google Scholar, 18Ehrenman K. Long L. Wagner B.J. Brewer G. Gene (Amst.). 1994; 149: 315-319Crossref PubMed Scopus (33) Google Scholar), the hnRNP type A/B protein(19Khan F.A. Jaiswal A.K. Szer W. FEBS Lett. 1991; 290: 159-161Crossref PubMed Scopus (37) Google Scholar), the CArG box binding protein (20Kamada S. Miwa T. Gene (Amst.). 1992; 119: 229-236Crossref PubMed Scopus (86) Google Scholar), the D-box binding protein(21Smidt M.P. Wijnholds J. Snippe L. van Keulen G. Greet A.B. Biochim. Biophys. Acta. 1994; 1219: 115-120Crossref PubMed Scopus (5) Google Scholar), the hrp40 proteins produced by Drosophila squid gene(22Matunis M.J. Matunis E.L. Dreyfuss G. J. Cell Biol. 1992; 116: 245-255Crossref PubMed Scopus (75) Google Scholar, 23Kelly R.L. Genes & Dev. 1993; 7: 948-960Crossref PubMed Scopus (116) Google Scholar), the hnRNP A1 protein, the hnRNP A2/B1 proteins, and the Xenopus hnRNP A2 family proteins. Among them, E2BP, the hnRNP C type protein, and AUF1 show an almost identical amino acid sequence with the hnRNP D0 proteins and thus are most likely derived from the same gene. Other genes like the hnRNP A1, hnRNP A2/B1, and hnRNP type A/B proteins are obviously distinct from, but homologous with, hnRNP D0. Finally, the mouse CArG box binding protein, the chicken D-box binding protein, and the Drosophila squid gene are derived from different species, and it is not known at present whether they are the counterparts of the hnRNP D0 gene of these species or not. All of these proteins are characterized as having two RBDs in tandem in the N terminus (hereafter referred to as RBD-1 and RBD-2 from the N terminus) and a Gly-rich region, which typically contains the RGG motif, in the C terminus. The term “2xRBD-Gly group RNA binding protein” was coined to designate these proteins on the basis of their common structural organization(1Dreyfuss G. Matunis M.J. Piñol-Roma S. Burd C.G. Annu. Rev. Biochem. 1993; 62: 289-321Crossref PubMed Scopus (1340) Google Scholar). A compilation of an additional number of proteins, including hnRNP D0, is shown in Fig. 3 and these new members support the idea of the presence of this group of proteins. The RBD generally consists of about 90 amino acids. Two short stretches of sequence, RNP 1 and RNP 2 (eight and six amino acids, respectively) are highly conserved among the different RBD class RNA-binding proteins. Regions other than RNP 1 and 2 are less conserved. Significantly, proteins listed in Fig. 3 have conserved amino acid sequences, not only in RNP 1 and 2 but throughout the RBD. This long range conservation of amino acid sequences, along with a common structural organization, reinforces the presence of the 2xRBD-Gly group RNA binding proteins. Recently, an NMR study of the N-terminal RBD of the human hnRNP A1 was reported(24Garrett D.S. Lodi P.J. Shamoo Y. Williams K.R. Clore G.M. Gronenborn A.M. Biochemistry. 1994; 33: 2852-2858Crossref PubMed Scopus (46) Google Scholar). The study indicated that the hnRNP A1 RBD also forms four-stranded anti-parallel β-sheets as reported repeatedly with other RBDs(25Nagai K. Oubridge C. Jessen T.H. Li J. Evans P.R. Nature (Lond.). 1990; 348: 515-520Crossref PubMed Scopus (551) Google Scholar, 26Görlach M. Wittekind M. Beckman R.A. Mueller L. Dreyfuss G. EMBO J. 1992; 11: 3289-3295Crossref PubMed Scopus (162) Google Scholar). Because 2xRBD-Gly type proteins are so closely related to each other, we are able to tentatively assign the secondary structures determined with the hnRNP A1 to other members of this group of proteins (Fig. 3). According to it, the 19-amino acid insertion of the hnRNP D0 found in RBD-1 is located at the N terminus of β1 of RBD-1. One of the most notable features of the hnRNP D0 proteins is their very stringent binding specificity with single-stranded nucleic acids. A previous study showed that protein binding to d(TTAGGG)4 or r(UUAGGG)4 was abolished by a single base substitution at each of the first four bases of repeat units. Thus, the proteins bind to r(UUAGGG)4 but do not bind to r(CUAGGG)4, r(UCAGGG)4, r(UUGGGG)4, or r(UUAAGG)4, for example. Because the hnRNP D0 proteins exhibit the modular structure of 2xRBD-Gly, it is important to know the contribution of each domain to specific or nonspecific single-stranded DNA binding. To investigate, we constructed a series of truncated cDNAs having one or several domains. Fig. 4A schematically depicts the structure of mutant recombinant proteins. GD1H and GD1L are RBD-1 fused to glutathione S-transferase, with (H) or without (L) insertion of the 19-amino acid sequence, respectively. GD2 is RBD-2 with glutathione S-transferase. These clones, having only one domain of RBD, were used as glutathione S-transferase fusion proteins because a single RBD is too small to be analyzed by filter binding assay. D12H and D12L are RBD-1 and RBD-2 with (H) or without (L) insertion of the 19-amino acid sequence. C4 and C7 are full-length recombinant proteins expressed from cDx4 (-/+ type) and cDx7 (+/− type), respectively. Immunoblotting analysis of the recombinant proteins with an anti-hnRNP D monoclonal antibody 5B9 showed that GD2 is immunoreactive but that GD1H and GD1L are not (data not shown). This result supports the conclusion that the clones we isolated are for the hnRNP D0 and suggests that the epitope for the monoclonal antibody 5B9 is present in RBD-2. Recombinant proteins were subjected to a filter binding assay to analyze their binding activities. Binding experiments were carried out by incubating variable amounts of recombinant proteins with constant amounts of oligonucleotides. Under these conditions, oligonucleotide concentrations (typically 1-10 nM) were always much lower than protein concentrations. The apparent Kd of binding reactions was estimated by the concentration of proteins at which half maximum binding was obtained. The oligoribonucleotide probes used in these assays were rH4 (r(UUAGGG)4), rH4X1 (r(UUGGGG)4), and rECGF (r(GCAGCCUUGAUGACCUCGUGAACC)). rECGF was used as an unrelated sequence having the same length as rH4. Our previous study indicated that the purified HeLa cell proteins bind to rH4 but not to rH4X1 or rECGF. The following results were also obtained with DNA versions of these oligonucleotides, although the binding affinity was lower than that of RNA oligonucleotides (data not shown). First, mutant recombinant proteins, having only one of the two" @default.
• W2020133311 created "2016-06-24" @default.
• W2020133311 creator A5009441392 @default.
• W2020133311 creator A5061154995 @default.
• W2020133311 creator A5062929264 @default.
• W2020133311 creator A5070221937 @default.
• W2020133311 date "1995-09-01" @default.
• W2020133311 modified "2023-10-18" @default.
• W2020133311 title "The UUAG-specific RNA Binding Protein, Heterogeneous Nuclear Ribonucleoprotein D0" @default.
• W2020133311 cites W1491993630 @default.
• W2020133311 cites W1500915551 @default.
• W2020133311 cites W1529739927 @default.
• W2020133311 cites W1530733681 @default.
• W2020133311 cites W1555039620 @default.
• W2020133311 cites W1555057470 @default.
• W2020133311 cites W1589532501 @default.
• W2020133311 cites W1593559195 @default.
• W2020133311 cites W1646554925 @default.
• W2020133311 cites W1917679240 @default.
• W2020133311 cites W1941660249 @default.
• W2020133311 cites W1964534614 @default.
• W2020133311 cites W1981587090 @default.
• W2020133311 cites W1984783802 @default.
• W2020133311 cites W1989463841 @default.
• W2020133311 cites W1993926172 @default.
• W2020133311 cites W1995786503 @default.
• W2020133311 cites W1999556423 @default.
• W2020133311 cites W2001160033 @default.
• W2020133311 cites W2001288839 @default.
• W2020133311 cites W2013414018 @default.
• W2020133311 cites W2015415328 @default.
• W2020133311 cites W2024349578 @default.
• W2020133311 cites W2025894117 @default.
• W2020133311 cites W2026604399 @default.
• W2020133311 cites W2027593556 @default.
• W2020133311 cites W2027726125 @default.
• W2020133311 cites W2034890717 @default.
• W2020133311 cites W2076849957 @default.
• W2020133311 cites W2079790440 @default.
• W2020133311 cites W2082111448 @default.
• W2020133311 cites W2082127202 @default.
• W2020133311 cites W2101679570 @default.
• W2020133311 cites W2121340563 @default.
• W2020133311 cites W2140102385 @default.
• W2020133311 cites W2143824656 @default.
• W2020133311 doi "https://doi.org/10.1074/jbc.270.38.22167" @default.
• W2020133311 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/7673195" @default.
• W2020133311 hasPublicationYear "1995" @default.
• W2020133311 type Work @default.
• W2020133311 sameAs 2020133311 @default.
• W2020133311 citedByCount "102" @default.
• W2020133311 countsByYear W20201333112012 @default.
• W2020133311 countsByYear W20201333112013 @default.
• W2020133311 countsByYear W20201333112014 @default.
• W2020133311 countsByYear W20201333112015 @default.
• W2020133311 countsByYear W20201333112017 @default.
• W2020133311 countsByYear W20201333112019 @default.
• W2020133311 countsByYear W20201333112020 @default.
• W2020133311 countsByYear W20201333112021 @default.
• W2020133311 countsByYear W20201333112022 @default.
• W2020133311 crossrefType "journal-article" @default.
• W2020133311 hasAuthorship W2020133311A5009441392 @default.
• W2020133311 hasAuthorship W2020133311A5061154995 @default.
• W2020133311 hasAuthorship W2020133311A5062929264 @default.
• W2020133311 hasAuthorship W2020133311A5070221937 @default.
• W2020133311 hasBestOaLocation W20201333111 @default.
• W2020133311 hasConcept C104317684 @default.
• W2020133311 hasConcept C12554922 @default.
• W2020133311 hasConcept C159194896 @default.
• W2020133311 hasConcept C185592680 @default.
• W2020133311 hasConcept C2909472194 @default.
• W2020133311 hasConcept C41282012 @default.
• W2020133311 hasConcept C55493867 @default.
• W2020133311 hasConcept C67705224 @default.
• W2020133311 hasConcept C70721500 @default.
• W2020133311 hasConcept C75934600 @default.
• W2020133311 hasConcept C86803240 @default.
• W2020133311 hasConcept C95444343 @default.
• W2020133311 hasConceptScore W2020133311C104317684 @default.
• W2020133311 hasConceptScore W2020133311C12554922 @default.
• W2020133311 hasConceptScore W2020133311C159194896 @default.
• W2020133311 hasConceptScore W2020133311C185592680 @default.
• W2020133311 hasConceptScore W2020133311C2909472194 @default.
• W2020133311 hasConceptScore W2020133311C41282012 @default.
• W2020133311 hasConceptScore W2020133311C55493867 @default.
• W2020133311 hasConceptScore W2020133311C67705224 @default.
• W2020133311 hasConceptScore W2020133311C70721500 @default.
• W2020133311 hasConceptScore W2020133311C75934600 @default.
• W2020133311 hasConceptScore W2020133311C86803240 @default.
• W2020133311 hasConceptScore W2020133311C95444343 @default.
• W2020133311 hasIssue "38" @default.
• W2020133311 hasLocation W20201333111 @default.
• W2020133311 hasOpenAccess W2020133311 @default.
• W2020133311 hasPrimaryLocation W20201333111 @default.
• W2020133311 hasRelatedWork W1972790961 @default.
• W2020133311 hasRelatedWork W2008487411 @default.
• W2020133311 hasRelatedWork W2058138426 @default.
• W2020133311 hasRelatedWork W2060378644 @default.

• next