FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2020144644> ?p ?o ?g. }

• W2020144644 endingPage "186" @default.
• W2020144644 startingPage "176" @default.
• W2020144644 abstract "The protein Fip1 is an important subunit of the eukaryotic polyadenylation apparatus, since it provides a bridge of sorts between poly(A) polymerase, other subunits of the polyadenylation apparatus, and the substrate RNA. In this study, a previously unreported Arabidopsis Fip1 homolog is characterized. The gene for this protein resides on chromosome V and encodes a 1196-amino acid polypeptide. Yeast two-hybrid and in vitro assays indicate that the N-terminal 137 amino acids of the Arabidopsis Fip1 protein interact with poly(A) polymerase (PAP). This domain also stimulates the activity of the PAP. Interestingly, this part of the Arabidopsis Fip1 interacts with Arabidopsis homologs of CstF77, CPSF30, CFIm-25, and PabN1. The interactions with CstF77, CPSF30, and CFIm-25 are reminiscent in various respects of similar interactions seen in yeast and mammals, although the part of the Arabidopsis Fip1 protein that participates in these interactions has no apparent counterpart in other eukaryotic Fip1 proteins. Interactions between Fip1 and PabN1 have not been reported in other systems; this may represent plant-specific associations. The C-terminal 789 amino acids of the Arabidopsis Fip1 protein were found to contain an RNA-binding domain; this domain correlated with an intact arginine-rich region and had a marked preference for poly(G) among the four homopolymers studied. These results indicate that the Arabidopsis Fip1, like its human counterpart, is an RNA-binding protein. Moreover, they provide conceptual links between PAP and several other Arabidopsis polyadenylation factor subunit homologs. The protein Fip1 is an important subunit of the eukaryotic polyadenylation apparatus, since it provides a bridge of sorts between poly(A) polymerase, other subunits of the polyadenylation apparatus, and the substrate RNA. In this study, a previously unreported Arabidopsis Fip1 homolog is characterized. The gene for this protein resides on chromosome V and encodes a 1196-amino acid polypeptide. Yeast two-hybrid and in vitro assays indicate that the N-terminal 137 amino acids of the Arabidopsis Fip1 protein interact with poly(A) polymerase (PAP). This domain also stimulates the activity of the PAP. Interestingly, this part of the Arabidopsis Fip1 interacts with Arabidopsis homologs of CstF77, CPSF30, CFIm-25, and PabN1. The interactions with CstF77, CPSF30, and CFIm-25 are reminiscent in various respects of similar interactions seen in yeast and mammals, although the part of the Arabidopsis Fip1 protein that participates in these interactions has no apparent counterpart in other eukaryotic Fip1 proteins. Interactions between Fip1 and PabN1 have not been reported in other systems; this may represent plant-specific associations. The C-terminal 789 amino acids of the Arabidopsis Fip1 protein were found to contain an RNA-binding domain; this domain correlated with an intact arginine-rich region and had a marked preference for poly(G) among the four homopolymers studied. These results indicate that the Arabidopsis Fip1, like its human counterpart, is an RNA-binding protein. Moreover, they provide conceptual links between PAP and several other Arabidopsis polyadenylation factor subunit homologs. The polyadenylation of messenger RNAs in the nucleus is an important step in the biogenesis of mRNAs in eukaryotes. This RNA processing reaction adds an essential cis element, the poly(A) tail, to the 3′-end of a processed pre-mRNA. This process is also coupled with many other steps in mRNA biogenesis (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Thus, some polyadenylation factors are associated with transcription factors and recruit parts of the polyadenylation apparatus to the transcription initiation complex (2Dantonel J.C. Murthy K.G. Manley J.L. Tora L. Nature. 1997; 389: 399-402Crossref PubMed Scopus (253) Google Scholar). Polyadenylation is linked to pre-mRNA splicing in a number of ways. For example, interactions between the polyadenylation and splicing machineries are important for the definition of 3′-terminal exons in animal cells (3Lutz C.S. Alwine J.C. Genes Dev. 1994; 8: 576-586Crossref PubMed Scopus (126) Google Scholar, 4Wassarman K.M. Steitz J.A. Genes Dev. 1993; 7: 647-659Crossref PubMed Scopus (91) Google Scholar). Other interactions help to modulate different processing fates for pre-mRNAs, thus contributing to the scope of alternative splicing and polyadenylation in eukaryotes. The polyadenylation apparatus interacts with the C-terminal domain of the large subunit of RNA polymerase II (5Barilla D. Lee B.A. Proudfoot N.J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 445-450PubMed Google Scholar, 6Dichtl B. Blank D. Ohnacker M. Friedlein A. Roeder D. Langen H. Keller W. Mol. Cell. 2002; 10: 1139-1150Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 7McCracken S. Fong N. Yankulov K. Ballantyne S. Pan G. Greenblatt J. Patterson S.D. Wickens M. Bentley D.L. Nature. 1997; 385: 357-361Crossref PubMed Scopus (735) Google Scholar, 8Hirose Y. Manley J.L. Genes Dev. 2000; 14: 1415-1429PubMed Google Scholar, 9Bentley D. Curr. Opin. Cell Biol. 2002; 14: 336-342Crossref PubMed Scopus (212) Google Scholar) and with factors that play roles in transcription termination (10Aranda A. Proudfoot N. Mol. Cell. 2001; 7: 1003-1011Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar); these interactions suggest a central role for 3′-end processing in the termination of transcription by RNA polymerase II and subsequent recycling of polymerase II for new rounds of initiation.Polyadenylation is mediated by a multifactor complex in yeast and mammals. This complex recognizes the polyadenylation signal in the pre-mRNA, cleaves the pre-mRNA at a site that is defined by the cis elements, and adds a defined tract of poly(A) to the processed pre-mRNA. In mammals, the factors involved in this process have been classified according to chromatographic and biochemical behaviors, and termed cleavage and polyadenylation specificity factor (CPSF), 2The abbreviations used are: CPSFcleavage and polyadenylation specificity factorPAPpoly(A) polymeraseCPSF30, CPSF73, CPSF100 and CPSF16030-,73-, 100-, and 160-kDa subunit of CPSF, respectivelyCstFcleavage-stimulatory factorCstF50, CstF64, and CstF7750-, 64-, and 77-kDa subunit of CstF, respectivelyhFiphuman FipMBPmaltose-binding proteinCBDcalmodulin binding domainCATchloramphenicol acetyltransferaseGSTglutathione S-transferaseRTreverse transcriptionADactivation domainBDbinding domainFUEfar upstream elementNUEnear upstream elementCScleavage/polyadenylation siteCaMVcauliflower mosaic virusMES2-(N-morpholino)ethanesulfonic acid.2The abbreviations used are: CPSFcleavage and polyadenylation specificity factorPAPpoly(A) polymeraseCPSF30, CPSF73, CPSF100 and CPSF16030-,73-, 100-, and 160-kDa subunit of CPSF, respectivelyCstFcleavage-stimulatory factorCstF50, CstF64, and CstF7750-, 64-, and 77-kDa subunit of CstF, respectivelyhFiphuman FipMBPmaltose-binding proteinCBDcalmodulin binding domainCATchloramphenicol acetyltransferaseGSTglutathione S-transferaseRTreverse transcriptionADactivation domainBDbinding domainFUEfar upstream elementNUEnear upstream elementCScleavage/polyadenylation siteCaMVcauliflower mosaic virusMES2-(N-morpholino)ethanesulfonic acid. cleavage-stimulatory factor (CstF), and cleavage factors I and II (CFIm and CFIIm, respectively) (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Each of these factors in turn consists of several distinct subunits. With the exception of CFIm (the two subunits of which are not obviously apparent in the yeast proteome), yeast possesses a similar array of polyadenylation factor subunits that form a somewhat different set of chromatographically distinct factors, namely cleavage and polyadenylation factor and cleavage factor I (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Interestingly, the enzyme that adds poly(A) (poly(A) polymerase, or PAP) is part of the cleavage and polyadenylation factor in yeast nuclear extracts but fractionates largely as a separate protein in mammalian extracts. Whereas there are differences in the chromatographic behaviors of the complexes in mammals and yeast, most of the functions of the individual subunits seem to be similar. Besides the PAPs, this includes RNA binding by CPSF160, CPSF30, and CstF64 and their yeast counterparts (Yhh1p, Yth1p, and Rna15p, respectively) (11Keller W. Bienroth S. Lang K.M. Christofori G. EMBO J. 1991; 10: 4241-4249Crossref PubMed Scopus (159) Google Scholar, 12Jenny A. Keller W. Nucleic Acids Res. 1995; 23: 2629-2635Crossref PubMed Scopus (41) Google Scholar, 13Barabino S.M. Hubner W. Jenny A. Minvielle-Sebastia L. Keller W. Genes Dev. 1997; 11: 1703-1716Crossref PubMed Scopus (149) Google Scholar, 14Gross S. Moore C.L. Mol. Cell. Biol. 2001; 21: 8045-8055Crossref PubMed Scopus (75) Google Scholar, 15Barabino S.M. Ohnacker M. Keller W. EMBO J. 2000; 19: 3778-3787Crossref PubMed Scopus (65) Google Scholar, 16Dichtl B. Keller W. EMBO J. 2001; 20: 3197-3209Crossref PubMed Scopus (63) Google Scholar, 17Dichtl B. Blank D. Sadowski M. Hubner W. Weiser S. Keller W. EMBO J. 2002; 21: 4125-4135Crossref PubMed Scopus (105) Google Scholar) and bridging between factors (CstF77 and its yeast counterpart RNA14p, hFip1p and the yeast counterpart Fip1p) (18Kaufmann I. Martin G. Friedlein A. Langen H. Keller W. EMBO J. 2004; 23: 616-626Crossref PubMed Scopus (187) Google Scholar, 19Takagaki Y. Ryner L.C. Manley J.L. Genes Dev. 1989; 3: 1711-1724Crossref PubMed Scopus (151) Google Scholar, 20Gilmartin G.M. Nevins J.R. Genes Dev. 1989; 3: 2180-2190Crossref PubMed Scopus (126) Google Scholar, 21Gross S. Moore C. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6080-6085Crossref PubMed Scopus (82) Google Scholar, 22Preker P.J. Ohnacker M. Minvielle-Sebastia L. Keller W. EMBO J. 1997; 16: 4727-4737Crossref PubMed Scopus (79) Google Scholar). Of particular interest are the protein Fip1p and its human counterpart, hFip1. In yeast, Fip1p appears to be the principal means by which PAP is linked with the rest of the cleavage and polyadenylation factor. Fip1p is the only polyadenylation factor subunit that has been shown to interact with PAP (23Preker P.J. Lingner J. Minvielle-Sebastia L. Keller W. Cell. 1995; 81: 379-389Abstract Full Text PDF PubMed Scopus (110) Google Scholar). Fip1p also interacts with Yhh1p, Yth1p, Pfs2p, and RNA14, components of the two major polyadenylation complexes (cleavage and polyadenylation factor and cleavage factor I) in yeast (13Barabino S.M. Hubner W. Jenny A. Minvielle-Sebastia L. Keller W. Genes Dev. 1997; 11: 1703-1716Crossref PubMed Scopus (149) Google Scholar, 22Preker P.J. Ohnacker M. Minvielle-Sebastia L. Keller W. EMBO J. 1997; 16: 4727-4737Crossref PubMed Scopus (79) Google Scholar). The human homolog, hFip1, interacts with PAP and CPSF160 (the mammalian counterpart of Yhh1p) and has been recently recognized as an authentic subunit of CPSF (18Kaufmann I. Martin G. Friedlein A. Langen H. Keller W. EMBO J. 2004; 23: 616-626Crossref PubMed Scopus (187) Google Scholar). The yeast and human Fip (factor interacting with poly(A) polymerase) proteins have somewhat contrasting properties; the yeast protein lacks an RNA-binding domain and inhibits the nonspecific activity (24Zhelkovsky A. Helmling S. Moore C. Mol. Cell. Biol. 1998; 18: 5942-5951Crossref PubMed Google Scholar) (e.g. activity on RNA substrates that do not possess authentic polyadenylation signals) of PAP, whereas the human Fip1 can bind RNA and stimulates PAP activity (18Kaufmann I. Martin G. Friedlein A. Langen H. Keller W. EMBO J. 2004; 23: 616-626Crossref PubMed Scopus (187) Google Scholar). Kaufmann et al. (18Kaufmann I. Martin G. Friedlein A. Langen H. Keller W. EMBO J. 2004; 23: 616-626Crossref PubMed Scopus (187) Google Scholar) have suggested that these contrasting properties may reflect the differing RNA-binding abilities of the two proteins and that the yeast protein, in concert with other components of cleavage and polyadenylation factor, may stimulate PAP much as does the human Fip1. In this light, the functioning of Fip in the two systems may be relatively conserved, serving to promote PAP activity via some sort of tethering to the RNA substrate.Plant polyadenylation signals have been well characterized and found to be distinct in many ways from their mammalian and fungal counterparts (25Hunt A. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1994; 45: 47-60Crossref Scopus (91) Google Scholar, 26Rothnie H.M. Plant Mol. Biol. 1996; 32: 43-61Crossref PubMed Scopus (118) Google Scholar). However, the properties of the plant polyadenylation apparatus are less well understood. Bioinformatic analysis of the Arabidopsis genome indicates that plants possess genes that encode most of the subunits of the mammalian polyadenylation complex. 3Q. Q. Li and A. G. Hunt, unpublished observations.3Q. Q. Li and A. G. Hunt, unpublished observations. Insertions in two of these (encoding homologs of CPSF100 and CPSF73, respectively) lead to embryo lethality (27Meinke D.W. Meinke L.K. Showalter T.C. Schissel A.M. Mueller L.A. Tzafrir I. Plant Physiol. 2003; 131: 409-418Crossref PubMed Scopus (71) Google Scholar, 28Xu R. Ye X. Quinn Li Q. Gene (Amst.). 2004; 324: 35-45Crossref PubMed Scopus (33) Google Scholar). The Arabidopsis CPSF100 protein interacts with at least one of the four PAPs (29Elliott B.J. Dattaroy T. Meeks-Midkiff L.R. Forbes K.P. Hunt A.G. Plant Mol. Biol. 2003; 51: 373-384Crossref PubMed Scopus (17) Google Scholar), an interaction that seems to be unique to the plant polyadenylation machinery. There is a degree of novelty in the properties of the Arabidopsis homologs of the CstF subunits, in that one of the three proteins (AtCstF50) does not interact with AtCstF77 (30Yao Y. Song L. Katz Y. Galili G. J. Exp. Bot. 2002; 53: 2277-2278Crossref PubMed Scopus (22) Google Scholar), in contrast to what has been shown in the mammalian complex (31Takagaki Y. Manley J.L. Mol. Cell. Biol. 2000; 20: 1515-1525Crossref PubMed Scopus (196) Google Scholar). The CstF64-CstF77 interaction does seem to be evolutionarily conserved (30Yao Y. Song L. Katz Y. Galili G. J. Exp. Bot. 2002; 53: 2277-2278Crossref PubMed Scopus (22) Google Scholar). Arabidopsis possesses four PAP-encoding genes (32Addepalli B. Meeks L.R. Forbes K.P. Hunt A.G. Biochim. Biophys. Acta. 2004; 1679: 117-128Crossref PubMed Scopus (19) Google Scholar). Three of the corresponding PAP isoforms are similar in size to each other, whereas the fourth is much smaller, lacking an obvious nuclear localization signal. An Arabidopsis homolog of the yeast polyadenylation factor subunit Pfs2p (the Arabidopsis protein has been termed FY) has been shown to act in concert with the flower-timing regulatory protein FCA to promote alternative polyadenylation of FCA-encoding RNAs and consequently to regulate flower timing (33Simpson G.G. Dijkwel P.P. Quesada V. Henderson I. Dean C. Cell. 2003; 113: 777-787Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar).As mentioned above, the yeast and mammalian Fip1 proteins are important bridging factors in the polyadenylation complex, providing links between PAP, RNA, and other multisubunit complexes. These links presumably recruit PAP or stabilize the association of PAP with the apparatus and may contribute to the differential recognition of various RNAs by the 3′-processing machinery. In this report, we present a characterization of an Arabidopsis Fip1 isoform (geneid At5g58040, termed AtFip1(V)). We find that this protein binds RNA; interacts with the Arabidopsis polyadenylation factor subunits AtPAP, AtCstF77, AtCPSF30, AtCFI-25m, and AtPabN1; and stimulates nonspecific PAP activity. The abilities to bind RNA; interact with AtPAP, AtCstF77, and AtCPSF30; and stimulate PAP activity are properties that the AtFip1(V) shares with its human counterpart. The interaction with AtCFIm-25 may also be analogous to a recently reported CFIm-hFip1 interaction (47Venkataraman K. Brown K.M. Gilmartin G.M. Genes Dev. 2005; 19: 1315-1327Crossref PubMed Scopus (170) Google Scholar). However, the interaction with AtPabN1 has not been reported in other systems and may reflect a unique aspect of the plant polyadenylation machinery. Taken together, these results indicate that AtFip1(V) coordinates a number of polyadenylation factor subunits with PAP and with RNA.EXPERIMENTAL PROCEDURESPlant Materials—Arabidopsis thaliana seed was obtained from Lehle Seeds. Seeds were germinated and plants were cultivated in the greenhouse or growth room for 3–4 weeks. Plants were harvested before as well as after the flowering stage. Leaves, stems, and flowers were used for total RNA isolation (see below). Root material was gathered from seedlings that were grown in liquid culture under lights with shaking. 50 ml of germination medium (500 mg of sucrose, 215.5 mg of Murashige and Skoog Basal Medium (Sigma), and 25 mg of MES was inoculated with 30–40 sterilized seeds and grown for 2–3 weeks at room temperature under a 12-h light, 12-h dark cycle. For scoring T-DNA insertion plants, this medium was supplemented with kanamycin (50 μg/ml).PCR Genotyping of Salk T-DNA Lines—The T-DNA insertion line, SALK_087117, was generated by the Salk Institute (available on the World Wide Web at signal.salk.edu/cgi-bin/tdnaexpress), and seed was obtained from the Arabidopsis Biological Resource Center. Seeds from the stock center were germinated, and the plants were allowed to self-fertilize so as to generate a bulk stock of seed. Seeds from this bulked population were germinated, and plants were cultivated in the greenhouse or growth room. DNA from single leaves was extracted using a rapid homogenization plant leaf DNA amplification kit (Cartagen). Extracted DNA was used in a typical PCR (see supplemental materials) with AtFip1(V)-specific primers 5′ GFIP and 3′ INT (Table 1), yielding a 1-kb genomic DNA fragment, and with a combination of AtFip1(V)- and T-DNA-specific primers (AtFip1(V)-specific primer 5′ INT and a T-DNA-specific primer LBb1, yielding a ∼500-bp fragment) for verifying the presence and location of the T-DNA insertion.TABLE 1List of oligonucleotides used for PCR and sequencingGene or usePrimer designationSequence (5′-3′)AtFip1(V)5′FLCCGCATGGAAGAGGACGATGAGTTCGGA5′INTCCCGGATCCGAGTTAGCTGCAGCAACAGGGGCA5′INT1CCCAGATCTGGTTCCGAAGATCGATCATCAAGG3′INTGCGAATTCACCCGAGGGTTCATCCTCATG3′INT1CCCGAATTCTTGATGATCGATCTTCGGAACCTC3′INT2CTAGTTTTGAGGAAATGGATGATG3′FLTTATGCGTATTCCCTCCCTATTCTTACACA5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAAGAGGACGATGAGTTC5′GW1GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAGTT AGCTGCAGCA3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTATCAACCCGAGGGTTCATCCTC3′GW1GGGGACCACTTTGTACAAGAAAGCTGGGTATTATGCGTATTCCCTCCCTATTCTTACACA5′GFIPGTCTACTCTGTGCTTAGGAAtCstF505′FLCGCGAATTCATGGGGAATAGTGGAGATTTG5′INTCCAGATCTTTCTTCGACTTCTCCAAAACCACGGCT3′INTGTTATGGTTAGAAGGCCACTTTGCCACTTT3′FLCCGGAATTCTTAAACGGATTCCTTCCAGAACCGAAT5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTGGATGGGGAATAGTGGAGATT3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTCCTTAAACGGATTCCTTCCAGAAAtCstF645′FLGGAGATCTGCCATGGCCATGGCTTCATCATCATCC3′FLCCAGATCTATCGATTGAAGGCTGCATCATGTGG5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTTCATCATCATCCCA3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTAGTGAAGGCTGCATCATGTGGTAtCstF775′FLATGGCTGATAAGTACATCGTCGAG3′INTTTCCAGAAAGTGCTTCTTTCATTC3′FLTTAGCCAGTGCTACCAGAAAGCTCGCCAGA5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCTGATAAGTACATCGTC5′GW1GGGGACAAGTTTGTACAAAAAAGCAGGCTTCTTAAGCACGTTACCAGTTGA3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGCCAGTGCTACCAGAAAGAtPfs2p5′FLATGTACGCCGGCGGCGATATGCACAGG5′INTAGTGTTTGGGATCTTGCATGGCATCCT3′INTAAGAACATCTCGGGGATTATCTGCAGG3′FLCTACTGATGTTGCTGATTGTTGTTTGG5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTACGCCGGCGGCGATATG3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTACTACTGATGTTGCTGATTGTTAtPAP(IV)5′MRCCGAGATCTTTCATCATCTTGCATGATATATTGGCT3′MRCCGAGATCTACTGCCGAGGCCTTCGATATCCATTAG5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGTGGGTACTCAAAATTTAGGTGGT3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGCTCTGTCTTCCGACTTCTCCATCAtCFI-255′FLATGGGTGAAGAAGCTCGAGCGTTAGATATGGAG3′FLCATATCTCCATCATGTTGAAGGAGAATTTCGAAAG5′GWGGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGTGAAGAAGCTCGAGCGTT3′GWGGGGACCACTTTGTACAAGAAAGCTGGGTACATATCTCCATCATGTTGAAGGAGAtPABN15′FLCCAGATCTATGCCGGTGCACGATGAGC3′FLCCAGATCTTCAGTACGGTCTGTAGCGCT-DNALBb1GCGTGGACCGCTTGCAACTCaMV RNAs 1, 2, 3T7-STSTAATACGACTCACTATAGGGAAACACGCTGAAATCACCAGTCTCTCT 4T7-NUETAATACGACTCACTATAGGGAAAATACTTCTATCAATAAAATTTCT 1, 4CaMV61/80RTCTCGTGTCTGGTTTATATT 3CaMV20/1RAGGAATTAGAAATTTTATTGAT 2CaMV 50/70RTATAAATACAAATACATACTAAGGrbcS-E9 RNAT7-E9TAATACGACTCACTATAGGGAGTATTATGGCATTGGGAAE9 61-80AAATGTTTGCATATCTCTTA Open table in a new tab RNA Isolation from Arabidopsis and Generation of First Strand cDNA—Total RNA was isolated from Arabidopsis leaves using either an SV Total RNA Isolation Kit (Promega), RNeasy® Plant Mini Kit (Qiagen), or Trizol (Invitrogen), following the manufacturers' instructions. Reverse transcription experiments were conducted using the total RNA, oligo(dT) and Superscript RT II (Invitrogen), oligo(dT) with the ProS-TAR™ Ultra HF RT-PCR system (Stratagene), or random primers using a RETROscript™ First Strand Synthesis kit (Ambion).Isolation and Characterization of Arabidopsis AtFip1(V) cDNAs—cDNAs derived from the Arabidopsis AtFip1(V) gene were isolated by PCR and RT-PCR. Potential Fip1-encoding genes were identified in the Arabidopsis genome (available on the World Wide Web at www.Arabidopsis.org/home.html) with TBLASTN and BLASTP (34Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59138) Google Scholar) using the human and yeast Fip1 amino acid sequences as search queries. Based on the results, primers were designed to amplify the cDNA coding region of the AtFip1(V) gene (Table 1). Various combinations of these primers were used in PCRs with first strand cDNA or with a 3–6-kb cDNA expression library for Arabidopsis (CD4-16; ABRC-DNA Stock Center (35Kieber J.J. Rothenberg M. Roman G. Feldmann K.A. Ecker J.R. Cell. 1993; 72: 427-441Abstract Full Text PDF PubMed Scopus (1475) Google Scholar)) as templates. PCR products were subcloned into pGEM-T Easy vector and sequenced by automated sequencing (ABI Prism 310 Genetic Analyzer; PerkinElmer Life Sciences) using the BigDye Terminator Cycle Sequencing Ready Reaction kit (ABI prism) and T7 and SP6 primers.Three pGEM clones that represent the 5′-end (bases 1–1478), middle region (bases 1220–2692), and 3′-end (bases 2672–3588) of the full-length coding region, respectively, were generated. Full-length clones were assembled in pGEM using common restriction enzyme sites; the C-terminal domain of AtFip1(V) was amplified and subcloned using full-length cDNAs. One clone containing the 5′-end of AtFip1(V) contained a premature stop codon after residue 137 of the protein, presumably due to a PCR error. This stop codon conveniently delimits the highly divergent part of the N terminus of AtFip1(V) (Fig. 1A); for this reason, it was selected to produce yeast two-hybrid and protein expression clones. Cloning details are provided in supplemental materials.For expression analysis of AtFip1 genes in different Arabidopsis tissues, PCR amplification was done with 1.5 μl of first strand cDNA (ProSTAR; Stratagene) added to 100 ng of each primer, 0.8 mm dNTPs, 5.0 μl of Ultra HF PCR buffer (Stratagene), and 2.5 units of Pfu Turbo DNA polymerase (Stratagene) in a 50-μl reaction.Cloning of Arabidopsis cDNAs Encoding Arabidopsis Polyadenylation Factor Subunits—Data base searches of the Arabidopsis genome using TBLASTN and BLASTP with the yeast Pfs2 and human CstF50, -64, and -77 subunits as well as mammalian CFIm-25 and PabN1 as search queries identified potential homologs for each subunit. Based on the sequence information, primers were designed to amplify the cDNA coding regions of these genes (Table 1). Clones were generated by PCR or RT-PCR, subcloned in pGEM, and sequenced. In cases where partial clones were produced, full-length cDNAs were assembled using common restriction enzyme sites. Full-length clones were used to produce yeast two-hybrid and protein expression clones. Cloning details are provided in supplemental materials. Clones encoding the Arabidopsis chromosome IV-encoded PAP have been described elsewhere (32Addepalli B. Meeks L.R. Forbes K.P. Hunt A.G. Biochim. Biophys. Acta. 2004; 1679: 117-128Crossref PubMed Scopus (19) Google Scholar).Yeast Two-hybrid Assay—A Gal4-based two-hybrid system was used as described previously (36James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). The yeast strain used was PJ69-4, and the expression vectors were pGAD-C (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) and pGBD-C (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) for activation domain (AD) and binding domain (BD), respectively.Clones encoding the relevant protein-coding regions were cloned into AD and BD expression vectors using Gateway™ cloning technology (Invitrogen). For this, the appropriate coding sequences were amplified by PCR using 5′GW/3′GW primers listed in Table 1 and the amplification products mobilized into pDONR 201 according to the manufacturer's instructions. The various protein-coding regions were then mobilized into Gateway-compatible versions of pGAD-C (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) and pGBD-C (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) (generated as recommended by the manufacturer). The resulting expression clones were sequenced to ensure that the gene fusions were in the correct reading frame. The pGAD-C (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) and pGBD-C (1Proudfoot N. O'Sullivan J. Curr. Biol. 2002; 12: R855-R857Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) clones of AtCPSF factors used in this experiment were obtained from Drs. Ruqiang Xu and Quinn Li (Miami University, Oxford, OH).Yeast cells were transformed with plasmid DNA using the polyethylene glycol/lithium acetate method (37Gietz D. St. Jean A. Woods R.A. Schiestl R.H. Nucleic Acids Res. 1992; 20: 1425Crossref PubMed Scopus (2877) Google Scholar). Two-hybrid analysis was carried out by plating yeast transformants on defined media containing glucose as a carbon source and lacking the nutritional supplements suited for selection of transformants (leucine and tryptophan) and for identification of interactions (adenine) (LW and ALW medium, respectively). Positive interactions were those in which the colony numbers on ALW medium were 50% or more than those seen on LW medium. Negative interactions were those that yielded less than 10% of the colonies on ALW plates compared with LW medium. With negative controls (e.g. experiments with “empty” two-hybrid vectors as well as those in which one test plasmid was co-transformed with the complementary “empty vector”), the numbers of colonies growing on ALW selective media were invariably less than 2% (and usually 0%) of the numbers seen on LW medium. Positive samples (such as the combination using clones for the Arabidopsis orthologues for CstF77 and CstF64, which have been reported elsewhere to interact (30Yao Y. Song L. Katz Y. Galili G. J. Exp. Bot. 2002; 53: 2277-2278Crossref PubMed Scopus (22) Google Scholar) and which in our hands is a very strong two-hybrid interaction) yielded, on ALW medium, from 50 to 200% of the colonies seen on LW medium.Production of Recombinant Proteins—To produce recombinant proteins in Escherichia coli, the coding regions for respective AtFip1(V)-derived proteins were mobilized into pDEST15 and pDEST17 using LR Clonase and the respective entry clones (see above). This would enable the production of GST- or histidine-tagged proteins, respectively. In addition, AtCstF77, AtCPSF30, and AtPabN1 were subcloned into pMAL-C2x (New England Biolabs) so as to produce maltose-binding protein fusions. AtCFIm-25 was cloned into a Gateway-converted form of pCal-kc (Stratagene), using the corresponding Gateway-compatible entry clone and LR Clonase. The resulting recombinant plasmids were introduced into Rosetta(D3) cells (Novagen) for the production of protein.Extracts containing the appropriate fusion protein were prepared after induction of Rosetta(D3) cells (Novagen). Briefly, overnight 10-ml cultures of LB(+) (LB plus 100 μg/ml ampicillin and 25 μg/ml chloramphenicol) were used to inoculate 200 ml of LB(+) media, and cells were grown at 37 °C until an A600 of 1.0–1.2. Expression of the fusion protein genes was then induced by the addition of 200 μl of 1 m isopropyl 1-thio-β-d-galactopyranoside. After additional growth for 2 h at 37 °C, cells were harvested and resuspended in 5 ml of lysis buffer (50 mm Tris-HCl, pH 8.0, 150 mm NaCl, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride). Cells were disrupted by sonication (three bursts, 30 s each), and debris was removed by centrifugation. Extracts were stored as 1-ml aliquots at –80 °C.To produce the histidine-tagged FipN protein, extracts were prepared after induction of Rosetta(D3) cells (Novagen) containing recombinant pDEST-17 construct. Cells were grown, and expression was induced as described above. Cells were harvested and resuspended in 5 ml of binding buffer (20 mm Tris-HCl, pH 7.9, 500 mm NaCl, and 5 mm imidazole). Cell" @default.
• W2020144644 created "2016-06-24" @default.
• W2020144644 creator A5065390003 @default.
• W2020144644 creator A5067683969 @default.
• W2020144644 creator A5088265062 @default.
• W2020144644 date "2006-01-01" @default.
• W2020144644 modified "2023-10-16" @default.
• W2020144644 title "An Arabidopsis Fip1 Homolog Interacts with RNA and Provides Conceptual Links with a Number of Other Polyadenylation Factor Subunits" @default.
• W2020144644 cites W1481160548 @default.
• W2020144644 cites W1489207129 @default.
• W2020144644 cites W1522558159 @default.
• W2020144644 cites W1903792504 @default.
• W2020144644 cites W1971116869 @default.
• W2020144644 cites W1972208485 @default.
• W2020144644 cites W1982551833 @default.
• W2020144644 cites W1987525725 @default.
• W2020144644 cites W1989209852 @default.
• W2020144644 cites W1993712998 @default.
• W2020144644 cites W1997569498 @default.
• W2020144644 cites W2001452204 @default.
• W2020144644 cites W2003805923 @default.
• W2020144644 cites W2006337626 @default.
• W2020144644 cites W2015065370 @default.
• W2020144644 cites W2021735978 @default.
• W2020144644 cites W2022046147 @default.
• W2020144644 cites W2026168910 @default.
• W2020144644 cites W2032033331 @default.
• W2020144644 cites W2035225194 @default.
• W2020144644 cites W2035751664 @default.
• W2020144644 cites W2054084236 @default.
• W2020144644 cites W2060714285 @default.
• W2020144644 cites W2063407644 @default.
• W2020144644 cites W2075988374 @default.
• W2020144644 cites W2078185082 @default.
• W2020144644 cites W2079652085 @default.
• W2020144644 cites W2084181602 @default.
• W2020144644 cites W2086660631 @default.
• W2020144644 cites W2088621531 @default.
• W2020144644 cites W2090173484 @default.
• W2020144644 cites W2090687602 @default.
• W2020144644 cites W2096451658 @default.
• W2020144644 cites W2097460406 @default.
• W2020144644 cites W2097664345 @default.
• W2020144644 cites W2098115340 @default.
• W2020144644 cites W2109302137 @default.
• W2020144644 cites W2109684789 @default.
• W2020144644 cites W2115572335 @default.
• W2020144644 cites W2140446786 @default.
• W2020144644 cites W2143173841 @default.
• W2020144644 cites W2148195122 @default.
• W2020144644 cites W2155077792 @default.
• W2020144644 cites W2158714788 @default.
• W2020144644 cites W2171171901 @default.
• W2020144644 cites W2336581149 @default.
• W2020144644 cites W238513558 @default.
• W2020144644 cites W2616366986 @default.
• W2020144644 cites W27023215 @default.
• W2020144644 doi "https://doi.org/10.1074/jbc.m510964200" @default.
• W2020144644 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16282318" @default.
• W2020144644 hasPublicationYear "2006" @default.
• W2020144644 type Work @default.
• W2020144644 sameAs 2020144644 @default.
• W2020144644 citedByCount "47" @default.
• W2020144644 countsByYear W20201446442012 @default.
• W2020144644 countsByYear W20201446442014 @default.
• W2020144644 countsByYear W20201446442015 @default.
• W2020144644 countsByYear W20201446442018 @default.
• W2020144644 countsByYear W20201446442019 @default.
• W2020144644 countsByYear W20201446442020 @default.
• W2020144644 countsByYear W20201446442021 @default.
• W2020144644 countsByYear W20201446442022 @default.
• W2020144644 countsByYear W20201446442023 @default.
• W2020144644 crossrefType "journal-article" @default.
• W2020144644 hasAuthorship W2020144644A5065390003 @default.
• W2020144644 hasAuthorship W2020144644A5067683969 @default.
• W2020144644 hasAuthorship W2020144644A5088265062 @default.
• W2020144644 hasBestOaLocation W20201446441 @default.
• W2020144644 hasConcept C104317684 @default.
• W2020144644 hasConcept C142575336 @default.
• W2020144644 hasConcept C143065580 @default.
• W2020144644 hasConcept C185592680 @default.
• W2020144644 hasConcept C2779491563 @default.
• W2020144644 hasConcept C54355233 @default.
• W2020144644 hasConcept C67705224 @default.
• W2020144644 hasConcept C70721500 @default.
• W2020144644 hasConcept C86803240 @default.
• W2020144644 hasConcept C95444343 @default.
• W2020144644 hasConceptScore W2020144644C104317684 @default.
• W2020144644 hasConceptScore W2020144644C142575336 @default.
• W2020144644 hasConceptScore W2020144644C143065580 @default.
• W2020144644 hasConceptScore W2020144644C185592680 @default.
• W2020144644 hasConceptScore W2020144644C2779491563 @default.
• W2020144644 hasConceptScore W2020144644C54355233 @default.
• W2020144644 hasConceptScore W2020144644C67705224 @default.
• W2020144644 hasConceptScore W2020144644C70721500 @default.
• W2020144644 hasConceptScore W2020144644C86803240 @default.
• W2020144644 hasConceptScore W2020144644C95444343 @default.
• W2020144644 hasIssue "1" @default.

• next