FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2020235275> ?p ?o ?g. }

• W2020235275 endingPage "47693" @default.
• W2020235275 startingPage "47685" @default.
• W2020235275 abstract "Collagen prolyl 4-hydroxylases (C-P4Hs) catalyze the formation of 4-hydroxyproline by the hydroxylation of -X-Pro-Gly-triplets. The vertebrate enzymes are α2β2 tetramers, the β-subunit being identical to protein-disulfide isomerase (PDI). Two isoforms of the catalytic α-subunit, which combine with PDI to form [α(I)]2β2 and [α(II)]2β2 tetramers, have been known up to now. We report here on the cloning and characterization of a third vertebrate C-P4H α-subunit isoform, α(III). The processed human, rat and mouse α(III) polypeptides consist of 520–525 residues, all three having signal peptides of 19–22 additional residues. The sequence of the processed human α(III) polypeptide is 35–37% identical to those of human α(I) and α(II), the highest identity being found within the catalytically important C-terminal region and all five critical residues at the cosubstrate binding sites being conserved. The sequence within a region corresponding to the peptide-substrate binding domain is less conserved, but all five α helices constituting this domain can be predicted to be located in identical positions in α(I), α(II), and α(III) and to have essentially identical lengths. The α(III) mRNA is expressed in many human tissues, but at much lower levels than the α(I) and α(II) mRNAs. In contrast to α(I) and α(II), no evidence was found for alternative splicing of the α(III) transcripts. Coexpression of a recombinant human α(III) polypeptide with PDI in human embryonic kidney cells led to the formation of an active enzyme that hydroxylated collagen chains and a collagen-like peptide and appeared to be an [α(III)]2β2 tetramer. The catalytic properties of the recombinant enzyme were very similar to those of the type I and II C-P4Hs, with the exception that its peptide binding properties were intermediate between those of the type I and type II enzymes. Collagen prolyl 4-hydroxylases (C-P4Hs) catalyze the formation of 4-hydroxyproline by the hydroxylation of -X-Pro-Gly-triplets. The vertebrate enzymes are α2β2 tetramers, the β-subunit being identical to protein-disulfide isomerase (PDI). Two isoforms of the catalytic α-subunit, which combine with PDI to form [α(I)]2β2 and [α(II)]2β2 tetramers, have been known up to now. We report here on the cloning and characterization of a third vertebrate C-P4H α-subunit isoform, α(III). The processed human, rat and mouse α(III) polypeptides consist of 520–525 residues, all three having signal peptides of 19–22 additional residues. The sequence of the processed human α(III) polypeptide is 35–37% identical to those of human α(I) and α(II), the highest identity being found within the catalytically important C-terminal region and all five critical residues at the cosubstrate binding sites being conserved. The sequence within a region corresponding to the peptide-substrate binding domain is less conserved, but all five α helices constituting this domain can be predicted to be located in identical positions in α(I), α(II), and α(III) and to have essentially identical lengths. The α(III) mRNA is expressed in many human tissues, but at much lower levels than the α(I) and α(II) mRNAs. In contrast to α(I) and α(II), no evidence was found for alternative splicing of the α(III) transcripts. Coexpression of a recombinant human α(III) polypeptide with PDI in human embryonic kidney cells led to the formation of an active enzyme that hydroxylated collagen chains and a collagen-like peptide and appeared to be an [α(III)]2β2 tetramer. The catalytic properties of the recombinant enzyme were very similar to those of the type I and II C-P4Hs, with the exception that its peptide binding properties were intermediate between those of the type I and type II enzymes. Collagen prolyl 4-hydroxylases (C-P4Hs, 1The abbreviations used are: C-P4Hcollagen prolyl 4-hydroxylasePDIprotein-disulfide isomeraseHIFhypoxia-inducible factorERendoplasmic reticulumRACErapid amplification of cDNA endsHEKhuman embryonic kidney.1The abbreviations used are: C-P4Hcollagen prolyl 4-hydroxylasePDIprotein-disulfide isomeraseHIFhypoxia-inducible factorERendoplasmic reticulumRACErapid amplification of cDNA endsHEKhuman embryonic kidney. EC 1.14.11.2), enzymes residing within the lumen of the endoplasmic reticulum (ER), catalyze the formation of 4-hydroxyproline by the hydroxylation of proline in -X-Pro-Gly-triplets in collagens and more than 15 other proteins with collagen-like sequences (1Kivirikko K.I. Pihlajaniemi T. Adv. Enzymol. Related Areas Mol. Biol. 1998; 72: 325-398PubMed Google Scholar, 2Kivirikko K.I. Myllyharju J. Matrix Biol. 1998; 16: 357-368Crossref PubMed Scopus (233) Google Scholar, 3Myllyharju J. Matrix Biol. 2003; 22: 15-24Crossref PubMed Scopus (317) Google Scholar). The C-P4Hs have a central role in the synthesis of all collagens, as 4-hydroxyproline residues are essential for the folding of the newly synthesized collagen polypeptide chains into triple-helical molecules. All known vertebrate C-P4Hs are α2β2 tetramers in which the two catalytic sites are located in the α-subunits and the β-subunit is identical to the enzyme and chaperone protein-disulfide isomerase (PDI). Two isoforms of the α-subunit, α(I) and α(II), have been identified and shown to combine with PDI to form [α(I)]2β2 and [α(II)]2β2 tetramers, the type I and type II enzymes, respectively, and to possess very similar but not identical catalytic properties (4Helaakoski T. Vuori K. Myllylä R. Kivirikko K.I. Pihlajaniemi T. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4392-4396Crossref PubMed Scopus (103) Google Scholar, 5Helaakoski T. Annunen P. Vuori K. MacNeil I.A. Pihlajaniemi T. Kivirikko K.I. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 4427-4431Crossref PubMed Scopus (88) Google Scholar, 6Annunen P. Helaakoski T. Myllyharju J. Veijola J. Pihlajaniemi T. Kivirikko K.I. J. Biol. Chem. 1997; 272: 17342-17348Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). Type I C-P4H is the main form in most cell types, while type II is the main form in chondrocytes and endothelial cells (7Annunen P. Autio-Harmainen H. Kivirikko K.I. J. Biol. Chem. 1998; 273: 5989-5992Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 8Nissi R. Autio-Harmainen H. Marttila P. Sormunen R. Kivirikko K.I. J. Histochem. Cytochem. 2001; 49: 1143-1153Crossref PubMed Scopus (50) Google Scholar). collagen prolyl 4-hydroxylase protein-disulfide isomerase hypoxia-inducible factor endoplasmic reticulum rapid amplification of cDNA ends human embryonic kidney. collagen prolyl 4-hydroxylase protein-disulfide isomerase hypoxia-inducible factor endoplasmic reticulum rapid amplification of cDNA ends human embryonic kidney. A novel family of three cytoplasmic P4Hs that play a central role in the regulation of the hypoxia-inducible transcription factor HIF has recently been identified (9Epstein A.C.R. Gleadle J.M. McNeill L.A. Hewitson K.S. O'Rourke J. Mole D.R. Mukherji M. Metzen E. Wilson M.I. Dhanda A. Tian Y.-M. Masson N. Hamilton D.L. Jaakkola P. Barstead R. Hodgkin J. Maxwell P.H. Pugh C.W. Schofield C.J. Ratcliffe P.J. Cell. 2001; 107: 43-54Abstract Full Text Full Text PDF PubMed Scopus (2674) Google Scholar, 10Bruick R.K. McKnight S.L. Science. 2001; 294: 1337-1340Crossref PubMed Scopus (2066) Google Scholar, 11Ivan M. Haberberger T. Gervasi D.C. Michelson K.S. Günzler V. Kondo K. Yang H. Sorokina I. Conaway R.C. Conaway J.W. Kaelin Jr., W.G. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13459-13464Crossref PubMed Scopus (479) Google Scholar). HIFα is synthesized continuously, and at least one of two critical -Leu-X-X-Leu-Ala-Pro-sequences becomes hydroxylated under normoxic conditions (12Ivan M. Kondo K. Yang H. Kim W. Valiando J. Ohh M. Salic A. Asara J.M. Lane W.S. Kaelin Jr., W.G. Science. 2001; 292: 464-468Crossref PubMed Scopus (3783) Google Scholar, 13Jaakkola P. Mole D.R. Tian Y.-M. Wilson M.I. Gielbert J. Gaskell S.J. Kriegsheim A.V. Hebestreit H.F. Mukherji M. Schofield C.J. Maxwell P.H. Pugh C.W. Ratcliffe P.J. Science. 2001; 292: 468-472Crossref PubMed Scopus (4324) Google Scholar, 14Masson N. Willam C. Maxwell P.H. Pugh C.W. Ratcliffe P.J. EMBO J. 2001; 20: 5197-5206Crossref PubMed Scopus (840) Google Scholar, 15Min J.H. Yang H. Ivan M. Gertler F. Kaelin Jr., W.G. Pavletich N.P. Science. 2002; 296: 1886-1889Crossref PubMed Scopus (568) Google Scholar). The 4-hydroxyproline formed is essential for the binding of HIFα to the von Hippel-Lindau E3 ubiquitin ligase complex and subsequent rapid proteasomal degradation (12Ivan M. Kondo K. Yang H. Kim W. Valiando J. Ohh M. Salic A. Asara J.M. Lane W.S. Kaelin Jr., W.G. Science. 2001; 292: 464-468Crossref PubMed Scopus (3783) Google Scholar, 13Jaakkola P. Mole D.R. Tian Y.-M. Wilson M.I. Gielbert J. Gaskell S.J. Kriegsheim A.V. Hebestreit H.F. Mukherji M. Schofield C.J. Maxwell P.H. Pugh C.W. Ratcliffe P.J. Science. 2001; 292: 468-472Crossref PubMed Scopus (4324) Google Scholar, 14Masson N. Willam C. Maxwell P.H. Pugh C.W. Ratcliffe P.J. EMBO J. 2001; 20: 5197-5206Crossref PubMed Scopus (840) Google Scholar, 15Min J.H. Yang H. Ivan M. Gertler F. Kaelin Jr., W.G. Pavletich N.P. Science. 2002; 296: 1886-1889Crossref PubMed Scopus (568) Google Scholar). Under hypoxia, this hydroxylation that requires O2 ceases, so that HIFα escapes degradation and forms a dimer with HIFβ, which is translocated into the nucleus and activates a number of hypoxia-inducible genes (16Semenza G.L. Cell. 2001; 107: 1-3Abstract Full Text Full Text PDF PubMed Scopus (770) Google Scholar). The hydroxylations catalyzed by the P4Hs require Fe2+, 2-oxoglutarate, O2, and ascorbate (1Kivirikko K.I. Pihlajaniemi T. Adv. Enzymol. Related Areas Mol. Biol. 1998; 72: 325-398PubMed Google Scholar, 2Kivirikko K.I. Myllyharju J. Matrix Biol. 1998; 16: 357-368Crossref PubMed Scopus (233) Google Scholar, 3Myllyharju J. Matrix Biol. 2003; 22: 15-24Crossref PubMed Scopus (317) Google Scholar). No amino acid sequence similarity is found between the C-P4H α-subunits and the HIF-P4Hs, with the exception that the three Fe2+ binding residues, two histidines and one aspartate, are conserved (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar). The basic residue that binds the C-5 carboxyl group of the 2-oxoglutarate is a lysine in position +10 with respect to the second iron-binding histidine in the C-P4H α-subunits (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar), while it is an arginine in position +9 in the HIF-P4Hs (9Epstein A.C.R. Gleadle J.M. McNeill L.A. Hewitson K.S. O'Rourke J. Mole D.R. Mukherji M. Metzen E. Wilson M.I. Dhanda A. Tian Y.-M. Masson N. Hamilton D.L. Jaakkola P. Barstead R. Hodgkin J. Maxwell P.H. Pugh C.W. Schofield C.J. Ratcliffe P.J. Cell. 2001; 107: 43-54Abstract Full Text Full Text PDF PubMed Scopus (2674) Google Scholar, 10Bruick R.K. McKnight S.L. Science. 2001; 294: 1337-1340Crossref PubMed Scopus (2066) Google Scholar, 11Ivan M. Haberberger T. Gervasi D.C. Michelson K.S. Günzler V. Kondo K. Yang H. Sorokina I. Conaway R.C. Conaway J.W. Kaelin Jr., W.G. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13459-13464Crossref PubMed Scopus (479) Google Scholar). We report here on the characterization of a novel vertebrate C-P4H α-subunit, α(III), from human, rat, and mouse tissues. The amino acid sequence of the human α(III)-subunit is 35–37% identical to those of the human α(I) and α(II) subunits, and its mRNA is expressed in a variety of human tissues, but at much lower levels than the α(I) and α(II) mRNAs. Coexpression of recombinant α(III) and PDI polypeptides in human embryonic kidney cells led to the formation of an active enzyme that hydroxylated collagen chains and a collagen-like peptide and appeared to be an [α(III)]2β2 tetramer. Isolation of cDNA Clones—PCR primers 1-α(III) (5′-GTTAGGAATGCAGCACTGTTT-3′) and 2-α(III) (5-GCTGGAGCTGCAGGGTCT-3′) were used to obtain a 162-bp product from a Human Fetal Marathon-Ready cDNA (BD Biosciences), which was then used to screen a human umbilical vein endothelial cell (HUVEC) lambda cDNA library (Stratagene), 13 positive clones being obtained. The human α(III) cDNA was also analyzed by consecutive overlapping 5′- and 3′-RACE reactions in a Marathon-Ready human total fetal cDNA pool (BD Biosciences), and its 5′-end was obtained by 5′-RACE of HUVEC cDNA using Advantage-GC 2 polymerase (BD Biosciences). HUVEC cDNA was generated using the SMART RACE cDNA amplification kit (BD Biosciences), and total RNA isolated from cultured HUVEC cells with the RNeasy Midi kit (Qiagen). The full-length human α(III) cDNA was cloned into pUC18 in two steps. An α(III) fragment extending from nucleotide 184 to the poly(A) tail was first cloned into pUC18 using the SureClone ligation kit (Amersham Biosciences), after which this construct was digested with BamHI-ApaI and a similarly digested α(III) fragment covering bp 1–418 was ligated to it. The rat and mouse α(III) cDNAs were assembled by consecutive overlapping 5′- and 3′-RACE reactions using various rat and mouse Marathon-Ready cDNA pools (BD Biosciences) as templates and initial 5′- and 3′-RACE primers based on a 169 bp rat sequence (GenBank™ accession number AW921407). DNA sequencing was performed on ABI Prism 377 (Applied Biosystems). Nucleotide and amino acid sequence homology comparisons were made using the ClustalW service at the European Bioinformatics Institute. Analysis of the Expression of Human α(III) Subunit mRNA—Human MTN Blot (BD Clontech) and Real™ Human Fetal mRNA Blot I and II (Invitrogen) containing 2 μg poly(A)+ RNA per lane were hybridized using ULTRAhyb™ solution under the conditions specified by the manufacturer, with 0.5 μg of a 2250-bp α(III) or a 1440-bp α(I) cDNA fragment as the probe, the blots being exposed for 72 and 4 h, respectively. PCR analysis of the Human MTC Panel I and Human Fetal MTC Panel (BD Clontech) was performed according to the manufacturer's protocol with the primer pairs α(I)panel-5′ (GAAGGCGAGATTTCTACCATAGATAAAGTC) and α(I)panel-3′ (CCTTGTACGTTGTCAGAATTGGAATGAC), and α(III)panel-5′ (GACATGGGGGATTATTACCATGCCATTC) and α(III)panel-3′ (ACCCAAAACTGGTGACCCTCAACCAC). The amounts of the α(I) and α(III) primers were optimized prior to the analyses to produce similar amounts of DNA from equal amounts of the α(I) and α(III) plasmids under the same PCR conditions. The preincubation was at 95 °C for 1 min, followed by 26, 30, 34, 38, and 42 cycles at 95 °C for 30 s and 68 °C for 1 min, 5-μl aliquots being taken at each point and analyzed on 1% agarose gels. Total RNA from human fetal epiphyseal cartilage was a gift from Dr. E. Vuorio, University of Turku, Finland, while total RNA from human fibroblasts (N-09) was isolated using the RNeasy Midi kit (Qiagen). RT-PCR was performed using a SMART RACE cDNA amplification kit (BD Clontech), and PCR analysis as for the MTC panels, using the α(I) and α(III) primers described above and the α(II) primers α(II)panel-5′ (GAGGAGGCCACCACAACCAAGTCA) and α(II)panel-3′ (GACCTTGTGGATCAACAGAAGTTGACTG). Alternative splicing of the α(III) mRNA was analyzed by PCR with various human MTC panel and Marathon-Ready cDNAs (BD Biosciences) as templates. The primer pairs used were α(III)-17 (CTGCGGGACCTGACTAGATTCTAC), spanning the boundary between exons 1 and 2, and α(III)r7 (GTGGTTGACGGTCACGACTTTTGGGT) from exon 9, and α(III)-20 (CCTCTACTGTTCCTATGAGACCAATT) from exon 7 and α(III)-2 (GCTGGAGCTGCAGGGTCT) from exon 13. Expression and Analysis of a Recombinant α(III) Polypeptide in Insect and Mammalian Cells—The full-length human α(III) cDNA was cut into two pieces from pUC18 with BamHI-EcoRI digestion and cloned into a similarly digested baculovirus vector pVL1393 (BD Pharmingen). The α(III) cDNA lacking sequences coding for the signal peptide was generated by PCR and cloned into pACGP67A (BD Pharmingen) in-frame with the GP67 signal sequence. The recombinant baculoviruses were generated and the Sf9 and High Five insect cells were coinfected with viruses encoding the α(III) and PDI polypeptides and analyzed as described previously (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar, 18Vuori K. Pihlajaniemi T. Marttila M. Kivirikko K.I. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7467-7470Crossref PubMed Scopus (114) Google Scholar). Mammalian expression vectors were generated by cloning the full-length PDI cDNA into pCDNA3.1(+) (Invitrogen) and the full-length α(III) and α(I) cDNAs into pCDNA3.1(+)Hygro vectors (Invitrogen). The pCDNA3.1(+)PDI construct was linearized with BglII, transfected into human embryonic kidney HEK-293 cells using PolyFect (Qiagen), and stably transfected cells were selected with 400 μg/ml of Geneticin (Invitrogen). The HEK-293 cells were cultured in Dulbecco's modified Eagle's medium (Biochrom) supplemented with 10% fetal calf serum (BioClear) and 50 μg/ml of ascorbic acid at 37 °C. The pCDNA3.1(+)Hygro vectors encoding the α(III) and α(I) polypeptides were linearized with BglII and FspI, respectively, transfected into the stable HEK-293 cell line expressing recombinant human PDI, and stable cell lines were selected with 25 μg/ml of hygromycin (Invitrogen). A control cell line was established by stable transfection of pCDNA3.1(+)HygroLacZ (Invitrogen). The cells were harvested at confluency and homogenized in a Triton X-100 buffer (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar, 18Vuori K. Pihlajaniemi T. Marttila M. Kivirikko K.I. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7467-7470Crossref PubMed Scopus (114) Google Scholar). Soluble and insoluble fractions of the insect and mammalian cell homogenates were analyzed by 8% SDS-PAGE under reducing or nonreducing conditions and 8% nondenaturing PAGE followed by Coomassie Blue staining or Western blotting with a PDI antibody 5B5 (Dako), a polyclonal α(I) antibody K17 (19Veijola J. Pihlajaniemi T. Kivirikko K.I. Biochem. J. 1996; 315: 613-618Crossref PubMed Scopus (27) Google Scholar) or a monoclonal antibody VTT1081 against the α(III) subunit generated at the Technical Research Centre of Finland by immunizing mice with a recombinant α(III) polypeptide (amino acids 177–501) expressed in Escherichia coli using the pET expression system (Novagen) and purified from the inclusion bodies (20Lane D. Harlow E. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988: 90-91Google Scholar). P4H activity was assayed by methods based on the formation of 4-hydroxy[14C]proline in a [14C]proline-labeled substrate consisting of nonhydroxylated procollagen polypeptide chains or the hydroxylation-coupled decarboxylation of 2-oxo[1-14C]glutarate (21Kivirikko K.I. Myllylä R. Methods Enzymol. 1982; 82: 245-304Crossref PubMed Scopus (320) Google Scholar). Km and Ki values were determined as described (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar). Native immunoprecipitation was performed with Protein G Sepharose 4 Fast Flow according to the instructions provided by the manufacturer (Amersham Biosciences). The cell lysates were precleared, immunoprecipitated with 1–5 μg of the antibodies VTT1081 against the α(III) subunit or anti-FLAG (Sigma) as a negative control, and the Sepharose and the bound antibody-protein complexes were washed three times with a Triton X-100 buffer (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar, 18Vuori K. Pihlajaniemi T. Marttila M. Kivirikko K.I. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7467-7470Crossref PubMed Scopus (114) Google Scholar). The samples were then boiled in SDS-PAGE sample buffer and analyzed by SDS-PAGE followed by Western blotting. N-glycosidase F treatment was carried out according to the instructions provided by the manufacturer (Roche Applied Science). Gel filtration was performed in a calibrated Superdex 200 column (Amersham Biosciences). Recombinant human type I and II C-P4Hs were expressed in insect cells, and the type I enzyme was purified as described (6Annunen P. Helaakoski T. Myllyharju J. Veijola J. Pihlajaniemi T. Kivirikko K.I. J. Biol. Chem. 1997; 272: 17342-17348Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Vuori K. Pihlajaniemi T. Marttila M. Kivirikko K.I. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 7467-7470Crossref PubMed Scopus (114) Google Scholar). Cloning of the Human, Rat, and Mouse α(III) Subunits—A sequence homology search identified several human ESTs representing a gene product with similarity to the conserved C-terminal regions of the C-P4H α(I) and α(II) subunits. EST AA116081 was used to design primers for the initial 5′- and 3′-RACE reactions and amplification of a 162-bp probe, which was then used to screen a human umbilical vein endothelial cell cDNA library, the 5′-end of the cDNA being obtained by 5′-RACE reactions. The cDNA clones cover 43 bp of the 5′-untranslated sequence, a 1635-bp open reading frame, and 591 bp of the 3′-untranslated sequence, with a canonical polyadenylation signal ATTAAA followed 15-bp downstream by a poly(A) tail. A sequence homology search with the human α(III) cDNA identified a 169-bp rat sequence that is 89% identical to the coding nucleotides at the 3′-end of the human sequence. The rat sequence information was used to design primers for 5′-RACE reactions in rat cDNA pools, and 5′- and 3′-RACE reactions in mouse cDNA pools. The cDNA fragments obtained cover the full-length coding sequences of the rat and mouse α(III) subunit cDNAs, including 25 and 13 bp of the 5′-untranslated region, respectively. The human, rat, and mouse α(III) cDNA sequences have been deposited in the GenBank™ with accession numbers AY313448, AY313450, and AY313449, respectively. Amino Acid Sequences of the Human, Rat, and Mouse α(III) Subunits—The human and rat α(III) cDNAs encode polypeptides of 544 amino acids, the mouse polypeptide being two residues shorter. Putative signal peptides (22Nielsen H. Engelbrecht J. Brunak S. von Heijne G. Protein Eng. 1997; 10: 1-6Crossref PubMed Scopus (4911) Google Scholar) of 19, 19, and 22 residues are present in the N termini of the human, rat, and mouse α(III) polypeptides, respectively, the lengths of the processed human and rat α(III) subunits thus being 525 amino acids and that of the mouse α(III) 520 amino acids (Fig. 1). The processed human α(III) subunit is slightly longer than the processed human α(I) and α(II), which consist of 517 and 514 residues, respectively (4Helaakoski T. Vuori K. Myllylä R. Kivirikko K.I. Pihlajaniemi T. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4392-4396Crossref PubMed Scopus (103) Google Scholar, 6Annunen P. Helaakoski T. Myllyharju J. Veijola J. Pihlajaniemi T. Kivirikko K.I. J. Biol. Chem. 1997; 272: 17342-17348Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). The human α(III) sequence shows 91 and 94% identity to the rat and mouse sequences, respectively, the latter two being 95% identical. The overall sequence identity between the processed human α(III) and α(I) subunits is 35%, and that between α(III) and α(II) 37% (Fig. 1), while the identity between α(I) and α(II) is higher, 65%. The identity is highest within the catalytically important C-terminal region (1Kivirikko K.I. Pihlajaniemi T. Adv. Enzymol. Related Areas Mol. Biol. 1998; 72: 325-398PubMed Google Scholar, 2Kivirikko K.I. Myllyharju J. Matrix Biol. 1998; 16: 357-368Crossref PubMed Scopus (233) Google Scholar, 3Myllyharju J. Matrix Biol. 2003; 22: 15-24Crossref PubMed Scopus (317) Google Scholar, 17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar), the 120 C-terminal residues of the human α(III) subunit being 56–57% identical to those of human α(I) and α(II) (Fig. 1), while the identity between α(I) and α(II) in this region is 80%. All four critical residues at the catalytic site, the two histidines and one aspartate that bind the Fe2+ atom and the lysine that binds the C-5 carboxyl group of the 2-oxoglutarate in position +10 with respect to the second iron-binding histidine (1Kivirikko K.I. Pihlajaniemi T. Adv. Enzymol. Related Areas Mol. Biol. 1998; 72: 325-398PubMed Google Scholar, 2Kivirikko K.I. Myllyharju J. Matrix Biol. 1998; 16: 357-368Crossref PubMed Scopus (233) Google Scholar, 3Myllyharju J. Matrix Biol. 2003; 22: 15-24Crossref PubMed Scopus (317) Google Scholar, 17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar), are conserved in all these α-subunits (Fig. 1). The residue that binds the C-5 carboxyl group of 2-oxoglutarate in the HIF asparaginyl hydroxylase (FIH) is also a lysine, but it is present in position +15 with respect to the first iron-binding histidine (23Elkins J.M. Hewitson K.S. McNeill L.A. Seibel J.F. Schlemminger I. Pugh C.W. Ratcliffe P.J. Schofield C.J. J. Biol. Chem. 2003; 278: 1802-1806Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar, 24Lee C. Kim S.J. Jeong D.G. Lee S.M. Ryu S.E. J. Biol. Chem. 2003; 278: 7558-7563Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). The other 2-oxoglutarate-dependent dioxygenases, including the HIF-P4Hs and lysyl hydroxylases, differ from the C-P4Hs and FIH in that their 2-oxoglutarate binding residue is an arginine (3Myllyharju J. Matrix Biol. 2003; 22: 15-24Crossref PubMed Scopus (317) Google Scholar, 9Epstein A.C.R. Gleadle J.M. McNeill L.A. Hewitson K.S. O'Rourke J. Mole D.R. Mukherji M. Metzen E. Wilson M.I. Dhanda A. Tian Y.-M. Masson N. Hamilton D.L. Jaakkola P. Barstead R. Hodgkin J. Maxwell P.H. Pugh C.W. Schofield C.J. Ratcliffe P.J. Cell. 2001; 107: 43-54Abstract Full Text Full Text PDF PubMed Scopus (2674) Google Scholar, 10Bruick R.K. McKnight S.L. Science. 2001; 294: 1337-1340Crossref PubMed Scopus (2066) Google Scholar, 11Ivan M. Haberberger T. Gervasi D.C. Michelson K.S. Günzler V. Kondo K. Yang H. Sorokina I. Conaway R.C. Conaway J.W. Kaelin Jr., W.G. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13459-13464Crossref PubMed Scopus (479) Google Scholar, 25Passoja K. Myllyharju J. Pirskanen A. Kivirikko K.I. FEBS Lett. 1998; 434: 141-148Crossref Scopus (32) Google Scholar, 26Passoja K. Rautavuoma K. Ala-Kokko L. Kosonen T. Kivirikko K.I. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10482-10486Crossref PubMed Scopus (89) Google Scholar). Furthermore, a fifth critical residue, a histidine that is probably involved in the binding of the C-1 carboxyl group of the 2-oxoglutarate to the Fe2+ atom and the decarboxylation of this cosubstrate (17Myllyharju J. Kivirikko K.I. EMBO J. 1997; 16: 1173-1180Crossref PubMed Scopus (162) Google Scholar), is likewise conserved in all the C-P4H α-subunits (Fig. 1). The peptide-substrate binding domain of the C-P4Hs is distinct from the catalytic domain and is located between Phe-144 and Ser-244 in the human α(I) subunit (27Myllyharju J. Kivirikko K.I. EMBO J. 1999; 18: 306-312Crossref PubMed Scopus (60) Google Scholar, 28Hieta R. Kukkola L. Permi P. Pirilä P. Kivirikko K.I. Kilpeläinen I. Myllyharju J. J. Biol. Chem. 2003; 278: 34966-34974Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). Recent NMR studies have shown that this domain is composed of five α helices that can also be accurately predicted (29Rost B. Methods Enzymol. 1996; 266: 525-539Crossref PubMed Google Scholar) based on amino acid sequence (28Hieta R. Kukkola L. Permi P. Pirilä P. Kivirikko K.I. Kilpeläinen I. Myllyharju J. J. Biol. Chem. 2003; 278: 34966-34974Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). The sequence identity between the human α(I) peptide-binding domain and the corresponding regions of the human α(II) and α(III) subunits is 57 and 35%, respectively, while that between the α(II) and α(III) polypeptides is 34%. However, all five α helices can be predicted (29Rost B. Methods Enzymol. 1996; 266: 525-539Crossref PubMed Google Scholar) to be located in identical positions in all three polypeptides and to be identical in length, the only exception being the slightly shorter fifth helix in the α(III) polypeptide (Fig. 1). It thus seems probable that the structures of the peptide-binding domains of all three α-subunits are highly similar despite their relatively low overall amino acid sequence identity. Detailed studies to verify this aspect would nevertheless require comparison of the crystal-based structures of complexes of the three domains with a peptide substrate, which is clearly beyond the scope of this study. Expression of the α(III) Subunit mRNA in Various Human Tissues—Expression of the α(III) and α(I) subunit mRNAs was studied by Northern hybridization, the blots being exposed for 72 or 4 h, respectively. The α(III) mRNA was found to be about 2.7 kb in size, whereas the α(I) mRNA is about 3.0 kb (Fig. 2A). The highest α(III) mRNA expression levels were found in the placenta, adult liver, and fetal skin, low levels being detected in the fetal liver, lung and muscle (Fig. 2A). However, as exposure times shorter than 72 h produced no visible bands with the α(III) probe, the relative expression levels of this mRNA must be much lower than those of the α(I) mRNA in all the tissues studied. Expression of the α(III) mRNA was studied further by PCR analysis of human multitissue cDNA panels under conditions that produced similar amounts of DNA from equal amounts of α(III) and α(I) plasmids. The highest α(III) mRNA expression levels were seen in the placenta and fetal kidney, liver and lung (Fig. 2B). The expression levels of the α(III) mRNA were again much lower than those of the α(I) mRNA in all the tissues studied, since no α(III) mRNA was detected in these samples after 34 cycles, whereas the α(I) mRNA was already clearly seen in many tissues after 30 cycles (Fig. 2B). Furthermore, PCR analysis of hu" @default.
• W2020235275 created "2016-06-24" @default.
• W2020235275 creator A5002072250 @default.
• W2020235275 creator A5004169682 @default.
• W2020235275 creator A5006221161 @default.
• W2020235275 creator A5064900083 @default.
• W2020235275 date "2003-11-01" @default.
• W2020235275 modified "2023-10-07" @default.
• W2020235275 title "Identification and Characterization of a Third Human, Rat, and Mouse Collagen Prolyl 4-Hydroxylase Isoenzyme" @default.
• W2020235275 cites W1499450468 @default.
• W2020235275 cites W1545678257 @default.
• W2020235275 cites W1566565153 @default.
• W2020235275 cites W1575957636 @default.
• W2020235275 cites W1576657934 @default.
• W2020235275 cites W1586693737 @default.
• W2020235275 cites W1966974151 @default.
• W2020235275 cites W1988073167 @default.
• W2020235275 cites W1999560052 @default.
• W2020235275 cites W1999773791 @default.
• W2020235275 cites W2005729255 @default.
• W2020235275 cites W2005868568 @default.
• W2020235275 cites W2010060668 @default.
• W2020235275 cites W2011874786 @default.
• W2020235275 cites W2014807848 @default.
• W2020235275 cites W2015715216 @default.
• W2020235275 cites W2021672544 @default.
• W2020235275 cites W2021932335 @default.
• W2020235275 cites W2022369905 @default.
• W2020235275 cites W2026481299 @default.
• W2020235275 cites W2034880552 @default.
• W2020235275 cites W2040031153 @default.
• W2020235275 cites W2040516403 @default.
• W2020235275 cites W2041855656 @default.
• W2020235275 cites W2042216712 @default.
• W2020235275 cites W2044081210 @default.
• W2020235275 cites W2044296578 @default.
• W2020235275 cites W2048633849 @default.
• W2020235275 cites W2057080560 @default.
• W2020235275 cites W2068053372 @default.
• W2020235275 cites W2079818590 @default.
• W2020235275 cites W2086812941 @default.
• W2020235275 cites W2115940884 @default.
• W2020235275 cites W2133544300 @default.
• W2020235275 cites W2143705273 @default.
• W2020235275 cites W2144625075 @default.
• W2020235275 cites W2169653176 @default.
• W2020235275 cites W2171091522 @default.
• W2020235275 cites W2596045242 @default.
• W2020235275 cites W344406017 @default.
• W2020235275 doi "https://doi.org/10.1074/jbc.m306806200" @default.
• W2020235275 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/14500733" @default.
• W2020235275 hasPublicationYear "2003" @default.
• W2020235275 type Work @default.
• W2020235275 sameAs 2020235275 @default.
• W2020235275 citedByCount "111" @default.
• W2020235275 countsByYear W20202352752012 @default.
• W2020235275 countsByYear W20202352752013 @default.
• W2020235275 countsByYear W20202352752014 @default.
• W2020235275 countsByYear W20202352752015 @default.
• W2020235275 countsByYear W20202352752016 @default.
• W2020235275 countsByYear W20202352752017 @default.
• W2020235275 countsByYear W20202352752018 @default.
• W2020235275 countsByYear W20202352752019 @default.
• W2020235275 countsByYear W20202352752020 @default.
• W2020235275 countsByYear W20202352752021 @default.
• W2020235275 countsByYear W20202352752022 @default.
• W2020235275 countsByYear W20202352752023 @default.
• W2020235275 crossrefType "journal-article" @default.
• W2020235275 hasAuthorship W2020235275A5002072250 @default.
• W2020235275 hasAuthorship W2020235275A5004169682 @default.
• W2020235275 hasAuthorship W2020235275A5006221161 @default.
• W2020235275 hasAuthorship W2020235275A5064900083 @default.
• W2020235275 hasBestOaLocation W20202352751 @default.
• W2020235275 hasConcept C116834253 @default.
• W2020235275 hasConcept C119795356 @default.
• W2020235275 hasConcept C181199279 @default.
• W2020235275 hasConcept C185592680 @default.
• W2020235275 hasConcept C55493867 @default.
• W2020235275 hasConcept C59822182 @default.
• W2020235275 hasConcept C86803240 @default.
• W2020235275 hasConceptScore W2020235275C116834253 @default.
• W2020235275 hasConceptScore W2020235275C119795356 @default.
• W2020235275 hasConceptScore W2020235275C181199279 @default.
• W2020235275 hasConceptScore W2020235275C185592680 @default.
• W2020235275 hasConceptScore W2020235275C55493867 @default.
• W2020235275 hasConceptScore W2020235275C59822182 @default.
• W2020235275 hasConceptScore W2020235275C86803240 @default.
• W2020235275 hasIssue "48" @default.
• W2020235275 hasLocation W20202352751 @default.
• W2020235275 hasOpenAccess W2020235275 @default.
• W2020235275 hasPrimaryLocation W20202352751 @default.
• W2020235275 hasRelatedWork W154346754 @default.
• W2020235275 hasRelatedWork W1641042124 @default.
• W2020235275 hasRelatedWork W1990804418 @default.
• W2020235275 hasRelatedWork W1993764875 @default.
• W2020235275 hasRelatedWork W2013243191 @default.
• W2020235275 hasRelatedWork W2050182051 @default.
• W2020235275 hasRelatedWork W2082860237 @default.

• next