FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2020994777> ?p ?o ?g. }

• W2020994777 endingPage "19875" @default.
• W2020994777 startingPage "19867" @default.
• W2020994777 abstract "The phosphatidylinositol-specific phospholipase C (PI-PLC) from Bacillus thuringiensis exhibits several types of interfacial activation. In the crystal structure of the closely related Bacillus cereus PI-PLC, the rim of the active site is flanked by a short helix B and a loop that show an unusual clustering of hydrophobic amino acids. Two of the seven tryptophans in PI-PLC are among the exposed residues. To test the importance of these residues in substrate and activator binding, we prepared several mutants of Trp-47 (in helix B) and Trp-242 (in the loop). Two other tryptophans, Trp-178 and Trp-280, which are not near the rim, were mutated as controls. Kinetic (both phosphotransferase and cyclic phosphodiesterase activities), fluorescence, and vesicle binding analyses showed that both Trp-47 and Trp-242 residues are important for the enzyme to bind to interfaces, both activating zwitterionic and substrate anionic surfaces. Partitioning of the enzyme to vesicles is decreased more than 10-fold for either W47A or W242A, and removal of both tryptophans (W47A/W242A) yields enzyme with virtually no affinity for phospholipid surfaces. Replacement of either tryptophan with phenylalanine or isoleucine has moderate effects on enzyme affinity for surfaces but yields a fully active enzyme. These results are used to describe how the enzyme is activated by interfaces. The phosphatidylinositol-specific phospholipase C (PI-PLC) from Bacillus thuringiensis exhibits several types of interfacial activation. In the crystal structure of the closely related Bacillus cereus PI-PLC, the rim of the active site is flanked by a short helix B and a loop that show an unusual clustering of hydrophobic amino acids. Two of the seven tryptophans in PI-PLC are among the exposed residues. To test the importance of these residues in substrate and activator binding, we prepared several mutants of Trp-47 (in helix B) and Trp-242 (in the loop). Two other tryptophans, Trp-178 and Trp-280, which are not near the rim, were mutated as controls. Kinetic (both phosphotransferase and cyclic phosphodiesterase activities), fluorescence, and vesicle binding analyses showed that both Trp-47 and Trp-242 residues are important for the enzyme to bind to interfaces, both activating zwitterionic and substrate anionic surfaces. Partitioning of the enzyme to vesicles is decreased more than 10-fold for either W47A or W242A, and removal of both tryptophans (W47A/W242A) yields enzyme with virtually no affinity for phospholipid surfaces. Replacement of either tryptophan with phenylalanine or isoleucine has moderate effects on enzyme affinity for surfaces but yields a fully active enzyme. These results are used to describe how the enzyme is activated by interfaces. Phosphatidylinositol-specific phospholipase C (PI-PLC) 1The abbreviations used are: PI-PLCphosphatidylinositol-specific phospholipase CcIPd-myo-inositol 1,2-cyclic-phosphateI1Pd-myo-inositol 1-phosphateCMCcritical micelle concentrationPCphosphatidylcholinediCnPC1,2-diacylphosphatidylcholine with n carbons in each acyl chainPOPC1-palmitoyl-2-oleoyl-glycero-3-phosphocholineSUVsmall unilamellar vesicleLUVlarge unilamellar vesicleCDcircular dichroismTX-100Triton X-100WTwild type PI-PLCPAphosphatidic acidPMephosphatidylmethanolPGphosphatidyl glyceroliPrOHisopropanol. catalyzes the hydrolysis of PI in two steps: (i) an intramolecular phosphotransferase reaction to form inositol 1,2-cyclic-phosphate (cIP), followed by (ii) a cyclic phosphodiesterase activity that converts cIP to inositol 1-phosphate (I1P). Although the enzymes in eukaryotes play key roles in generating membrane-associated second messengers and in some case water-soluble second messengers (1Berridge M.J. Biochem. J. 1984; 220: 345-360Crossref PubMed Scopus (2493) Google Scholar, 2Nishizuka K. Science. 1986; 233: 305-311Crossref PubMed Scopus (4038) Google Scholar), PI-PLC enzymes in bacteria are secreted and play critical roles in cell infectivity (3Marques M.B. Weller P.F. Parsonnet J. Ransil B.J. Nicholson-Weller A. J. Clin. Microbiol. 1989; 27: 2451-2454Crossref PubMed Google Scholar, 4Mengaud J. Braun-Breton C. Cossart P. Mol. Microbiol. 1991; 5: 367-372Crossref PubMed Scopus (144) Google Scholar). The PI-PLC from Bacillus thuringiensis exhibits several types of kinetic interfacial activation by interfaces. Micellar PI is a better substrate than monomeric PI (5Lewis K.A. Garigapati V.R. Zhou C. Roberts M.F. Biochemistry. 1993; 32: 8836-8841Crossref PubMed Scopus (74) Google Scholar, 6Hendrickson H.S. Hendrickson E.K. Johnson J.L. Khan T.H. Chial H.J. Biochemistry. 1992; 31: 12169-12172Crossref PubMed Scopus (49) Google Scholar), and interfaces of phosphatidylcholine, a nonsubstrate that does not bind at the active site, activate the enzyme for both PI cleavage (7Qian X. Zhou C. Roberts M.F. Biochemistry. 1998; 37: 6513-6522Crossref PubMed Scopus (28) Google Scholar) and cIP hydrolysis (8Zhou C., Wu, Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Crossref PubMed Scopus (61) Google Scholar). In the available crystal structure (9Heinz D.W. Ryan M. Bullock T.L. Griffith O.H. EMBO J. 1995; 14: 3855-3863Crossref PubMed Scopus (147) Google Scholar) of the closely related Bacillus cereus PI-PLC, bound myo-inositol localized the active site inside the βα barrel. However, the orientation of PI substrate side chains and any other sites for interfacial PC were not defined. phosphatidylinositol-specific phospholipase C d-myo-inositol 1,2-cyclic-phosphate d-myo-inositol 1-phosphate critical micelle concentration phosphatidylcholine 1,2-diacylphosphatidylcholine with n carbons in each acyl chain 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine small unilamellar vesicle large unilamellar vesicle circular dichroism Triton X-100 wild type PI-PLC phosphatidic acid phosphatidylmethanol phosphatidyl glycerol isopropanol. The rim of the active site of bacterial PI-PLC (9Heinz D.W. Ryan M. Bullock T.L. Griffith O.H. EMBO J. 1995; 14: 3855-3863Crossref PubMed Scopus (147) Google Scholar) has a short helix B and one particular loop (residues 237–243) that show an unusual clustering of hydrophobic amino acids that are fully exposed to solvent (Fig. 1). This structural characteristic could contribute to the binding of substrate fatty acyl chains (for PI) but also to the binding of the PC activator. Tryptophan residues are often elements inserted into bilayers when a peripheral protein binds (e.g. annexin V (10Pigault C. Follenius-Wund A. Chabbert M. Biochem. Biophys. Res. Commun. 1999; 254: 484-489Crossref PubMed Scopus (10) Google Scholar) or phospholipase A2 (11Sumandea M. Das S. Sumandea C. Cho W. Biochemistry. 1999; 38: 16290-16297Crossref PubMed Scopus (54) Google Scholar)). Two of the seven tryptophans (Trp-47 and Trp-242) in PI-PLC are among the exposed hydrophobic amino acids. Their structural orientation is consistent with previous spectroscopic data (12Volwerk J.J. Filthuth E. Griffith O.H. Jain M.K. Biochemistry. 1994; 33: 3464-3474Crossref PubMed Scopus (63) Google Scholar, 13Zhou C. Roberts M.F. Biochemistry. 1998; 37: 16430-16439Crossref PubMed Scopus (22) Google Scholar), which showed enzyme intrinsic fluorescence increases significantly upon binding to micelles or vesicles. However, the details of any conformational changes in the proteins induced by activating surfaces have not yet been investigated. A definition for where activator molecules versus substrate acyl chains bind is needed to understand how the kinetic activation occurs. If helix B and loop 237–243 at the opening of active site are involved in lipid activation of the protein, mutations of the tryptophans in each element should affect PI-PLC intrinsic fluorescence and may alter the kinetic activation by PC surfaces. To test this hypothesis, we prepared the following mutant PI-PLCs: W47A, W242A, the double mutant W47A/W242A, W47F, W47I, W242F, and W242I. These were characterized for kinetic activation of PI and cIP hydrolysis by diC7PC and organic solvent, ability to bind to PC interfaces (comparing both intrinsic fluorescence and a filtration assays), and any changes in secondary structure (analyzed by CD spectroscopy). As controls, two other tryptophans were mutated: W178A and W280A. Trp-178 fulfills a dual function in PI-PLC by separating the bottom of the active site from the core of the protein and by forming a hydrogen bond with the side chain of Asp-198, a residue shown to be critical for substrate binding. The conservative replacement of Trp-178 by tyrosine eliminates the hydrogen bonding potential between position Trp-178 and Asp-198 and has been shown to decrease the rate of PI hydrolysis (14Gassler C.S. Ryan M. Liu T. Griffith O.H. Heinz D.W. Biochemistry. 1997; 36: 12802-12813Crossref PubMed Scopus (42) Google Scholar). W178A was prepared to see how this change affects enzyme fluorescence as well as kinetic activation by interfaces. Trp-280 is located in the C-terminal loop that connects with the eighth strand and helix of the αβ-barrel; it is far away from the hypothesized activator binding and the active sites. Modification of this residue should play little role in substrate and activator binding. Analyses of these mutant PI-PLCs show that the two tryptophan residues Trp-47 and Trp-242 are critical for the enzyme to bind to zwitterionic activating interfaces. Trp-242 is also the major fluorophore responding to micelle binding. POPC, diC6PC, diC7PC, and PI were purchased from Avanti; crude PI for preparing cIP was purchased from Sigma Chemical Co. diC6PA was prepared from the corresponding short-chain PCs using Streptomyces chromofuscus phospholipase D (13Zhou C. Roberts M.F. Biochemistry. 1998; 37: 16430-16439Crossref PubMed Scopus (22) Google Scholar). cIP was prepared from PI as described previously (8Zhou C., Wu, Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Crossref PubMed Scopus (61) Google Scholar). myo-Inositol was purchased from Sigma. A plasmid containing the B. thuringiensisPI-PLC gene obtained from Dr. Ming-Daw Tsai (Ohio State University) was transformed into Escherichia coli BL21 cells (BL21-Codonplus(DE3)-RIL from Stratagene). Overexpression of the recombinant protein was induced by addition of isopropyl-1-thio-β-d-galactopyranoside (0.8 mm) to the E. coli grown at 37 °C to an A600 ∼ 0.7 in LB medium, pH 7.0, containing ampicillin and chloramphenicol. Continued incubation until A600 reached 1.2 (2–3 h) yielded a reasonable amount of PI-PLC protein in the cytoplasm. After centrifugation, the cell pellet was lysed by sonication, and the solution was centrifuged again. The supernatant was subjected to two chromatographic steps, a Q-Sepharose fast flow column followed by a phenyl-Sepharose column, to purify the PI-PLC. Millipore Centraplus 10 filters were used to concentrate the protein. All of the mutations of the PI-PLC gene were carried out by QuikChange methodology (15Braman J. Papworth C. Greener A. Methods Mol. Biol. 1996; 57: 31-44PubMed Google Scholar, 16Wang W. Malcolm B.A. BioTechniques. 1999; 26: 680-682Crossref PubMed Scopus (496) Google Scholar) using a site-directed mutagenesis kit from Stratagene. Two complimentary mutagenic primers (all purchased from Operon) containing the desired mutation (codon indicated in bold) were annealed to the same sequence on opposite strands of the plasmid. The 33 base mutagenic primers CCGATTAAGCAAGTGGCG GGAATGACGCAAG, CCGATTAAGCAAGTGATC GGAATGACGCAAG, and CCGATTAAGCAAGTGTTC GGAATGACGCAAG were used for W47A, W47I, and W47F; for W242A, W242I, and W242F, the mutagenic primers were CTTCTGGTGGTACAGCAGCG AATAGTCCATATTAC, CTTCTGGTGGTACAGCAATC AATAGTCCATATTAC, and CTTCTGGTGGTACAGCATTC AATAGTCCATATTAC. Construction of the double mutant W47A/W242A introduced a second mutation (W242A) into the W47A gene using the appropriate primer. The primers GGATATAATAATTTTTATGCG CCAGATAATGAGACG and CTACATAAATGAAAAGGCG TCACCATTAT TGTATC were used for the preparation of W178A and W280A, respectively. All primers were purified by high performance liquid chromatography before mutagenesis. WT and mutant secondary structure and thermal stability as monitored by the thermal denaturation transition (Tm) were measured by CD spectroscopy using an AVIV 202 spectrophotometer. Proteins were dialyzed in 10 mmborate buffer, pH 8.0. For Tm measurements, protein (0.03∼0.04 mg/ml) was incubated in a 1-cm cell, and the wavelength at 222 nm was monitored as the temperature was increased from 25 to 75 °C in 1o steps with an equilibration time of 1 or 2 min. For comparing secondary structure, wavelength scans (180–300 nm) were carried out at 25 °C with protein (0.2–0.3 mg/ml) in a 0.1-cm cell. Estimation of secondary structure content was done with CDNN using ellipticity in the 195- to 300-nm range (17Zhong L. Johnson W.C. Biochemistry. 1994; 33: 2121-2128Crossref PubMed Scopus (31) Google Scholar, 18Bohm G. Muhr R. Jaenicke R. Prot. Eng. 1992; 5: 191-195Crossref PubMed Scopus (1022) Google Scholar, 19Andrade M.A. Chacon P. Merelo J.J. Moran F. Prot. Eng. 1993; 6: 383-390Crossref PubMed Scopus (950) Google Scholar). PI-PLC intrinsic fluorescence spectra were obtained with a Shimadzu RF5000U spectrofluorometer. All fluorescence measurements were carried out at 25 °C with ∼2 μm protein in 50 mm HEPES, pH 7.5, with 1 mm EDTA. The excitation wavelength was 290 nm, with both excitation and emission slit widths set at 5 nm. The wavelength for the maximum in PI-PLC fluorescence was the same, 337 nm, for WT and all the tryptophan mutants. Changes in the fluorescence intensity were expressed as (I −I0)/I0, where I0 is the intensity of protein alone, and I is the intensity in the presence of an additive. PI-PLC activity was assayed by two methods. (i) For long-chain PI as substrate, 200-μl aliquots were removed from the reaction mixture at defined intervals and extracted with 300 μl of CHCl3 (this also stops the reaction). The content of cIP and I1P in the water-soluble phase was determined by 31P NMR (202.3 MHz) spectroscopy as described previously (8Zhou C., Wu, Y. Roberts M.F. Biochemistry. 1997; 36: 347-355Crossref PubMed Scopus (61) Google Scholar, 13Zhou C. Roberts M.F. Biochemistry. 1998; 37: 16430-16439Crossref PubMed Scopus (22) Google Scholar) using a Varian INOVA spectrometer. (ii) For cIP, hydrolysis was monitored by 31P NMR spectroscopy by measuring the decrease of substrate and increase in product (I1P) resonance intensities as a function of incubation time with the enzyme. The amount of protein added was adjusted so that no more than 20% substrate hydrolysis occurred within 2 h. Assays to check for activation by PC typically used 5 mm cIP in the absence or presence of 5 mm diC7PC to probe for PC activation. SDS-PAGE (12% polyacrylamide) was used to quantify free PI-PLC separated (via centrifugation/filtration) from PI-PLC bound to POPC vesicles. A similar method was used to quantify S. chromofuscus phospholipase D partitioning to phospholipid vesicles (20Stieglitz K. Seaton B. Roberts M.F. J. Biol. Chem. 1999; 274: 35367-35374Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). A stock of small unilamellar POPC vesicles (5 mm) with an average diameter ∼300 Å was prepared by sonication in 10 mmTris, pH 7.5. Large unilamellar vesicles were prepared by multiple passages of an aqueous POPC solution through polycarbonate membranes (100-nm pore diameter). Samples for binding assays with SUVs were prepared with 0.03 mg/ml protein in 10 mm Tris, pH 7.5; the bulk POPC concentration was 0, 0.01, 0.02, 0.05, 0.1, and 0.2 mm for WT PI-PLC, W47I, W242I, W47F and 0, 0.02, 0.04, 0.08, 0.15, and 0.3 mm for W47A and W242A. In the POPC binding assay with W47A/W242A (and binding of PI-PLC to LUVs), the bulk POPC concentration was increased to 2 mm. After incubation for 15 min, the samples were applied to 2-ml Amicon Centricon YM10 filters (100-kDa molecular mass cutoff) and centrifuged at 4000 rpm in a DYNAC centrifuge for ∼2 h until all the solution passed through the filter. The protein bound to vesicles was left on the membrane of the filter, while free protein passed through the membrane. The eluant was collected and lyophilized overnight. As a control, enzyme in the absence of vesicles was centrifuged through the filter, and less than 5% of the total protein was lost on the filter. Samples for SDS-PAGE were made by adding 20 μl of water and 15 μl of SDS loading buffer to the dry solid. Gels were stained with Coomassie Blue. After destaining, the gels were imaged using EAGLE EYE from Stratagene, and the PI-PLC intensities were monitored. Comparison of band intensities to a sample incubated without POPC vesicles was used to measure the fraction of free enzyme (Ef/ET, where ET is the total amount of enzyme). The fraction of enzyme bound,Eb/ET, was then evaluated as (1 − Ef/ET). The apparent dissociation constant (KD) was calculated with equation Eb/ET = [POPC]/(KD + [POPC]). With this analysis, 1/KD is the molar partition coefficient for the protein interacting with POPC surfaces. The crystal structure of bacterial PI-PLC enzyme shows a single distorted (βα)6-barrel domain with the active site located at the C-terminal side (as determined by strand orientation) of the β-barrel (Fig. 1). Replacement of tryptophan residues at the mouth of the barrel is unlikely to have a dramatic effect on secondary structure as long as the mutant proteins fold correctly. To check this, CD spectra of WT and mutant PI-PLC proteins were acquired and used to check for overall structural elements. WT and mutant thermostabilities were also measured by monitoring the loss of secondary structure with temperature. As shown in Table I, estimates of WT secondary structure calculated from the CD wavelength spectra by CDNN (17Zhong L. Johnson W.C. Biochemistry. 1994; 33: 2121-2128Crossref PubMed Scopus (31) Google Scholar, 18Bohm G. Muhr R. Jaenicke R. Prot. Eng. 1992; 5: 191-195Crossref PubMed Scopus (1022) Google Scholar, 19Andrade M.A. Chacon P. Merelo J.J. Moran F. Prot. Eng. 1993; 6: 383-390Crossref PubMed Scopus (950) Google Scholar) agreed moderately well with the secondary structure elements in the crystal structure (9Heinz D.W. Ryan M. Bullock T.L. Griffith O.H. EMBO J. 1995; 14: 3855-3863Crossref PubMed Scopus (147) Google Scholar). All the tryptophan mutants except W178A had essentially the same proportion of secondary structure elements. They also had very similar thermal denaturation temperatures (Table I). Thus, any changes in PC binding and kinetics are unlikely to be due to protein that has a significantly altered structure from WT.Table IComparison of secondary structure content of WT and tryptophan mutant PI-PLC enzymesEnzymeSecondary Structure1-aEstimated using the program CDNN and data for the wavelength range 195–300 nm.Tm1-bThe Tm was extrapolated from the loss of negative ellipticity at 222 nm with temperature; Tm is the maximum in the derivative of the temperature dependence of this signal. The error in each Tm is less than 0.4 °C.α-Helixβ-Sheetβ-TurnRandom coil%°CWT22.139.819.818.354.4W47A21.940.219.91853.6W242A23.339.419.517.856.2W47A/W242A21.840.219.818.254.6W178A22.637.219.920.341.5W280A22.839.119.618.547.01-a Estimated using the program CDNN and data for the wavelength range 195–300 nm.1-b The Tm was extrapolated from the loss of negative ellipticity at 222 nm with temperature; Tm is the maximum in the derivative of the temperature dependence of this signal. The error in each Tm is less than 0.4 °C. Open table in a new tab W178A was the least stable mutant (Tm decreased from 54 °C for the WT to 41.5 °C), and it also showed a significant drop in β-sheet and increase in random coil. The side chain of Trp-178, at the bottom of active site, is critical for hydrogen bonding and hydrophobic interactions that stabilize the barrel and active site. Loss of these interactions would be expected to modify secondary structure, destabilize PI-PLC, and possibly reduce the mutant enzyme activity. The only other mutant with a significantly reduced stability was W280A. Trp-280 is positioned at a relatively unstructured region near the C terminus of the protein. Given its position, replacement of the aromatic side chain might not be expected to alter secondary structure elements as reflected in Table I. However, the stability of this mutant is decreased compared with WT, perhaps suggesting that packing of this tryptophan residue does contribute to stabilization of the structure. Replacement of either tryptophan at the barrel rim had minor effects on the protein stability. The Tm of W47A was within the error of the Tm for WT PI-PLC. A large change might not be expected, because Trp-47 is at the middle of helix B. However, the Tm of W242A was increased to 56.2 °C. Replacement of the bulky side chain of the tryptophan in the loop at the opening of the barrel slightly stabilized the protein. This might correlate with a small increase in α-helix (at the expense of random loop structure). It might also reflect a reduced hydrophobicity of the loop that affects its tertiary structure and dynamics; it is this change that leads to a small stabilization of the protein. PI-PLC has seven tryptophan residues that contribute to its fluorescence emission spectrum. Previous studies have shown that the binding of PC activator micelles (12Volwerk J.J. Filthuth E. Griffith O.H. Jain M.K. Biochemistry. 1994; 33: 3464-3474Crossref PubMed Scopus (63) Google Scholar, 21Zhou C. Qian X. Roberts M.F. Biochemistry. 1997; 36: 10089-10097Crossref PubMed Scopus (48) Google Scholar) or vesicles (6Hendrickson H.S. Hendrickson E.K. Johnson J.L. Khan T.H. Chial H.J. Biochemistry. 1992; 31: 12169-12172Crossref PubMed Scopus (49) Google Scholar, 12Volwerk J.J. Filthuth E. Griffith O.H. Jain M.K. Biochemistry. 1994; 33: 3464-3474Crossref PubMed Scopus (63) Google Scholar) causes an increase in PI-PLC intrinsic fluorescence intensity, whereas molecules that bind to the active site (PA, PME, PG) cause a decrease in fluorescence (12Volwerk J.J. Filthuth E. Griffith O.H. Jain M.K. Biochemistry. 1994; 33: 3464-3474Crossref PubMed Scopus (63) Google Scholar,13Zhou C. Roberts M.F. Biochemistry. 1998; 37: 16430-16439Crossref PubMed Scopus (22) Google Scholar). Mutants where a specific tryptophan has been replaced by alanine should lose some or all of this sensitivity if, indeed, that particular tryptophan were responsible for much of the spectral change upon interfacial binding. W47A, W242A, W178A, W280A, and W47A/W280A were examined as a function of added diC6PC and diC7PC and compared with WT PI-PLC. The emission maximum, 337 nm, was the same for all unliganded proteins and unshifted by the addition of PC micelles (up to 35 mm diC6PC or 4.0 mm diC7PC). As shown in Fig. 2A, the change in fluorescence intensity of WT at 337 nm showed a small increase below the diC6PC CMC (14 mm), then increased dramatically once micelles were formed and bound to the WT protein. Three of the tryptophan mutants, W47A, W178A, and W280A, exhibited similar behavior (Fig. 2). However, W242A showed significantly reduced sensitivity to diC6PC micelle binding. The fluorescence intensity still increased slightly with micelle formation but the enhancement of fluorescence was roughly one-third that of WT. The double mutant, missing the tryptophan in helix B and the 237–243 loop, showed no change in intrinsic fluorescence upon micelle binding (Fig. 2B). The effect of diC7PC micelles on PI-PLC intrinsic fluorescence was similar to that for diC6PC (increase in fluorescence around the diC7PC CMC of 1.5 mm) with the exception that now W47A as well as W242A also showed a significantly lower fractional increase in fluorescence (Fig. 3). However, the fractional increase in fluorescence upon micelle binding was still the least for W242A. Again, the double mutant displayed no sensitivity to PC micelle binding. Micellar diC6PA inhibits PI-PLC hydrolysis of cIP whereas monomeric diC6PA can partially activate the enzyme (13Zhou C. Roberts M.F. Biochemistry. 1998; 37: 16430-16439Crossref PubMed Scopus (22) Google Scholar). Binding of monomeric diC6PA caused a decrease in WT PI-PLC fluorescence that correlates with binding of this molecule to the active site; as PA micelles formed, the intrinsic fluorescence increased. As shown in Fig. 4, low concentrations of diC6PA decreased PI-PLC fluorescence for all the PI-PLC mutants indicating active site binding of this molecule is not abolished by the tryptophan substitutions. The decrease in fluorescence was the least for W242A and the double mutant. Upon micelle formation of diC6PA (the CMC depends on the ionic strength and pH of the medium and is likely to be 5–7 mm under these buffer conditions (22Garigapatic V.R. Bian J. Roberts M.F. J. Coll. Int. Sci. 1995; 169: 486-492Crossref Scopus (12) Google Scholar)), all proteins except W242A and the double mutant showed large increases in fluorescence consistent with micelle binding as well as active site binding of the PA molecule. This could suggest that Trp-242 not only senses micelle binding but contributes to the decrease in fluorescence as lipids bind to the active site. myo-Inositol is a poor competitive inhibitor of PI-PLC (23Shashidhar M.S. Volwerk J.J. Keena J.F.W. Griffith O.H. Biochim. Biophys. Acta. 1990; 1042: 410-412Crossref PubMed Scopus (24) Google Scholar). Because it is not amphiphilic it has no tendency to form interfaces. Like other molecules that bind to the PI-PLC active site,myo-inositol caused a decrease in the fluorescence intensity of WT PI-PLC (Fig. 5). Tryptophan mutants that required more myo-inositol added to exhibit a decreased fluorescence also exhibited a reduced sensitivity to short-chain PC micelles. That the fractional decrease in fluorescence for W47A, W242A, and the double mutant was less than that observed with WT PI-PLC, might suggest that the interfacial site is coupled to substrate binding. Interestingly, the double mutant showed a more pronounced decrease in fluorescence with increasing myo-inositol than both W47A and W242A. If the decreased fluorescence is correlated with binding, this would indicate that removal of both tryptophan residues may actually enhance the binding of small water-soluble inositol compounds at the active site. However, the altered changes in fluorescence with myo-inositol could also reflect changes in the disposition of the fluorophores or removal of ones that are the major reporters of this small molecule binding to the active site. To investigate the role, if any, of the different tryptophans in the interfacial activation of PI-PLC, cIP hydrolysis (phosphodiesterase) and PI cleavage (phosphotransferase) were examined for WT and mutant proteins with and without PC activator (diC7PC). As summarized in Table II, removing either Trp-47 or Trp-242, which reside at the rim of the barrel, reduced the PI-PLC specific activity toward cIP to 60 and 82% of WT, respectively. Both single mutants exhibited kinetic activation by micellar diC7PC (5 mm), but not to the same extent as WT (Table II). That the reduction in the extent of PC activation is real was provided by measuring diC7PC activation of W280A, which was essentially the same as WT. Trp-280 is near the C-terminal end of the protein and far away from the active site and interfacial activation site (if it is near the mouth of the barrel). In the absence of an interface, the specific activity of the double mutant, where both Trp-47 and Trp-242 have been removed, toward cIP was 53% that of the WT. However, instead of the 6- to 9-fold increase observed with diC7PC added, this mutant showed only a 1.5-fold increase. The lack of kinetic activation of W47A/W242A by PC micelles suggests that the two tryptophan residues are key players in the interfacial binding site of the enzyme. Interaction of these bulky side chains with the phospholipid surface may be key to anchoring the protein to a surface. Furthermore, the lack of significant PC activation for W47A/W242A explains the lack of change in the intrinsic fluorescence when diC7PC was titrated into the double mutant. There was no fluorescence change, because the micelle binding site was perturbed.Table IISpecific activity (S.A.) of PI-PLC and mutants toward cIP (5 mm) and the effect of different activatorsEnzymeSpecific activityS.A. (+PC)/S.A. (control)Specific activityControl+ diC7PC (5 mm)+ myo-Inositol (75 mm)+ iPrOH (30%)μmol min−1 mg−1μmol min−1mg−1WT8.4172.98.70.3446.1W47A5.0532.86.50.2222.5W242A6.9341.25.90.2432.2W47A/W242A4.436.61.50.1611.4W178A0.514.238.3<0.001W280A8.1671.68.80.33 Open table in a new tab Of all the tryptophan mutants, the one with the most altered specific activity toward cIP was W178A. Trp-178 is at the bottom of the active site where its side chain forms a hydrogen bond with the side chain of Asp-198, a residue shown to be critical for substrate binding. Replacement of Trp-178 with alanine would significantly alter the disposition of Asp-198, and this in turn could reduce the ability of the mutant to bind substrates. The specific activity of W178A toward cIP is 6% of WT; with PI solubilized in Triton X-100, the activity is 9.5% that of WT. A previous mutation of this residue to tyrosine showed a similarly reduced activity toward substrates. Although it is a less efficient enzyme, W178A can still be activated by diC7PC (Table II). The ratio of specific activity of W178A with and without activator is essentially the same as WT PI-PLC for both cIP hydrolysis and PI cleavage. Thus, of the four tryptophans examined, only Trp-47 and Trp-242 appear to have roles in activator binding. Although myo-inositol is a poor competitive inhibitor of PI-PLC, the effectiveness of it as an inhibitor can be used to monitor how mutants bind this portion of the substrate. With 5 mmcIP as substrate and no activating diC7PC, 75 mmm" @default.
• W2020994777 created "2016-06-24" @default.
• W2020994777 creator A5013894021 @default.
• W2020994777 creator A5014679061 @default.
• W2020994777 creator A5047196423 @default.
• W2020994777 date "2002-05-01" @default.
• W2020994777 modified "2023-09-30" @default.
• W2020994777 title "Role of Tryptophan Residues in Interfacial Binding of Phosphatidylinositol-specific Phospholipase C" @default.
• W2020994777 cites W16780149 @default.
• W2020994777 cites W1964839077 @default.
• W2020994777 cites W1975019334 @default.
• W2020994777 cites W1979740497 @default.
• W2020994777 cites W1987075231 @default.
• W2020994777 cites W1987713423 @default.
• W2020994777 cites W2001102262 @default.
• W2020994777 cites W2003185147 @default.
• W2020994777 cites W2010026751 @default.
• W2020994777 cites W2015096311 @default.
• W2020994777 cites W2018002844 @default.
• W2020994777 cites W2019704247 @default.
• W2020994777 cites W2019878495 @default.
• W2020994777 cites W2026593599 @default.
• W2020994777 cites W2027704731 @default.
• W2020994777 cites W2034366889 @default.
• W2020994777 cites W2039391510 @default.
• W2020994777 cites W2041389129 @default.
• W2020994777 cites W2043756754 @default.
• W2020994777 cites W2045194116 @default.
• W2020994777 cites W2052749821 @default.
• W2020994777 cites W2053166689 @default.
• W2020994777 cites W2058628523 @default.
• W2020994777 cites W2058969554 @default.
• W2020994777 cites W2059650696 @default.
• W2020994777 cites W2064262345 @default.
• W2020994777 cites W2078470147 @default.
• W2020994777 cites W2081164763 @default.
• W2020994777 cites W2081817480 @default.
• W2020994777 cites W2090747098 @default.
• W2020994777 cites W2093063929 @default.
• W2020994777 cites W2095039779 @default.
• W2020994777 cites W2099868625 @default.
• W2020994777 cites W2112397485 @default.
• W2020994777 cites W2418361432 @default.
• W2020994777 cites W596271391 @default.
• W2020994777 doi "https://doi.org/10.1074/jbc.m200938200" @default.
• W2020994777 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11912206" @default.
• W2020994777 hasPublicationYear "2002" @default.
• W2020994777 type Work @default.
• W2020994777 sameAs 2020994777 @default.
• W2020994777 citedByCount "54" @default.
• W2020994777 countsByYear W20209947772012 @default.
• W2020994777 countsByYear W20209947772013 @default.
• W2020994777 countsByYear W20209947772014 @default.
• W2020994777 countsByYear W20209947772015 @default.
• W2020994777 countsByYear W20209947772016 @default.
• W2020994777 countsByYear W20209947772018 @default.
• W2020994777 countsByYear W20209947772019 @default.
• W2020994777 countsByYear W20209947772020 @default.
• W2020994777 countsByYear W20209947772022 @default.
• W2020994777 countsByYear W20209947772023 @default.
• W2020994777 crossrefType "journal-article" @default.
• W2020994777 hasAuthorship W2020994777A5013894021 @default.
• W2020994777 hasAuthorship W2020994777A5014679061 @default.
• W2020994777 hasAuthorship W2020994777A5047196423 @default.
• W2020994777 hasBestOaLocation W20209947771 @default.
• W2020994777 hasConcept C181199279 @default.
• W2020994777 hasConcept C185592680 @default.
• W2020994777 hasConcept C2776706248 @default.
• W2020994777 hasConcept C2778597717 @default.
• W2020994777 hasConcept C2780610907 @default.
• W2020994777 hasConcept C515207424 @default.
• W2020994777 hasConcept C55493867 @default.
• W2020994777 hasConcept C62478195 @default.
• W2020994777 hasConcept C78297661 @default.
• W2020994777 hasConceptScore W2020994777C181199279 @default.
• W2020994777 hasConceptScore W2020994777C185592680 @default.
• W2020994777 hasConceptScore W2020994777C2776706248 @default.
• W2020994777 hasConceptScore W2020994777C2778597717 @default.
• W2020994777 hasConceptScore W2020994777C2780610907 @default.
• W2020994777 hasConceptScore W2020994777C515207424 @default.
• W2020994777 hasConceptScore W2020994777C55493867 @default.
• W2020994777 hasConceptScore W2020994777C62478195 @default.
• W2020994777 hasConceptScore W2020994777C78297661 @default.
• W2020994777 hasIssue "22" @default.
• W2020994777 hasLocation W20209947771 @default.
• W2020994777 hasOpenAccess W2020994777 @default.
• W2020994777 hasPrimaryLocation W20209947771 @default.
• W2020994777 hasRelatedWork W1763215782 @default.
• W2020994777 hasRelatedWork W2020994777 @default.
• W2020994777 hasRelatedWork W2030973035 @default.
• W2020994777 hasRelatedWork W2055617588 @default.
• W2020994777 hasRelatedWork W2081610379 @default.
• W2020994777 hasRelatedWork W2094178034 @default.
• W2020994777 hasRelatedWork W2103105023 @default.
• W2020994777 hasRelatedWork W2109448032 @default.
• W2020994777 hasRelatedWork W2171787368 @default.
• W2020994777 hasRelatedWork W2410779175 @default.
• W2020994777 hasVolume "277" @default.

• next