FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2021982887> ?p ?o ?g. }

• W2021982887 endingPage "21855" @default.
• W2021982887 startingPage "21846" @default.
• W2021982887 abstract "ERCC1-XPF is a heterodimeric, structure-specific endonuclease that cleaves single-stranded/double-stranded DNA junctions and has roles in nucleotide excision repair (NER), interstrand crosslink (ICL) repair, homologous recombination, and possibly other pathways. In NER, ERCC1-XPF is recruited to DNA lesions by interaction with XPA and incises the DNA 5′ to the lesion. We studied the role of the four C-terminal DNA binding domains in mediating NER activity and cleavage of model substrates. We found that mutations in the helix-hairpin-helix domain of ERCC1 and the nuclease domain of XPF abolished cleavage activity on model substrates. Interestingly, mutations in multiple DNA binding domains were needed to significantly diminish NER activity in vitro and in vivo, suggesting that interactions with proteins in the NER incision complex can compensate for some defects in DNA binding. Mutations in DNA binding domains of ERCC1-XPF render cells more sensitive to the crosslinking agent mitomycin C than to ultraviolet radiation, suggesting that the ICL repair function of ERCC1-XPF requires tighter substrate binding than NER. Our studies show that multiple domains of ERCC1-XPF contribute to substrate binding, and are consistent with models of NER suggesting that multiple weak protein-DNA and protein-protein interactions drive progression through the pathway. Our findings are discussed in the context of structural studies of individual domains of ERCC1-XPF and of its role in multiple DNA repair pathways. ERCC1-XPF is a heterodimeric, structure-specific endonuclease that cleaves single-stranded/double-stranded DNA junctions and has roles in nucleotide excision repair (NER), interstrand crosslink (ICL) repair, homologous recombination, and possibly other pathways. In NER, ERCC1-XPF is recruited to DNA lesions by interaction with XPA and incises the DNA 5′ to the lesion. We studied the role of the four C-terminal DNA binding domains in mediating NER activity and cleavage of model substrates. We found that mutations in the helix-hairpin-helix domain of ERCC1 and the nuclease domain of XPF abolished cleavage activity on model substrates. Interestingly, mutations in multiple DNA binding domains were needed to significantly diminish NER activity in vitro and in vivo, suggesting that interactions with proteins in the NER incision complex can compensate for some defects in DNA binding. Mutations in DNA binding domains of ERCC1-XPF render cells more sensitive to the crosslinking agent mitomycin C than to ultraviolet radiation, suggesting that the ICL repair function of ERCC1-XPF requires tighter substrate binding than NER. Our studies show that multiple domains of ERCC1-XPF contribute to substrate binding, and are consistent with models of NER suggesting that multiple weak protein-DNA and protein-protein interactions drive progression through the pathway. Our findings are discussed in the context of structural studies of individual domains of ERCC1-XPF and of its role in multiple DNA repair pathways. Structure-specific endonucleases are widespread enzymes that incise DNA as components of most DNA repair and recombination pathways. The activity of these enzymes needs to be tightly regulated since they might otherwise inadvertently fragment DNA (1Fagbemi A.F. Orelli B. Schärer O.D. Regulation of endonuclease activity in human nucleotide excision repair.DNA Repair. 2011; 10: 722-729Crossref PubMed Scopus (114) Google Scholar). One of the most important pathways depending on the action of endonucleases is nucleotide excision repair (NER), 3The abbreviations used are: NERnucleotide excision repairICLinterstrand crosslinkHhHhelix-hairpin-helixHLDhelicase like domain. which addresses lesions induced by UV light, environmental mutagens and certain cancer chemotherapeutic agents. In NER, an oligonucleotide of 24–32 nucleotides in length containing the damage is removed and the original DNA sequence restored using the non-damaged strand as a template (2Gillet L.C. Schärer O.D. Molecular mechanisms of mammalian global genome nucleotide excision repair.Chem. Rev. 2006; 106: 253-276Crossref PubMed Scopus (490) Google Scholar). NER can be initiated in two ways: Transcription coupled NER (TC-NER) is triggered when RNA polymerase II is stalled by a bulky DNA lesion during transcription (3Hanawalt P.C. Spivak G. Transcription-coupled DNA repair: two decades of progress and surprises.Nat. Rev. Mol. Cell Biol. 2008; 9: 958-970Crossref PubMed Scopus (769) Google Scholar); Global genome NER (GG-NER) occurs anywhere in the genome and is initiated by the damage sensor XPC-RAD23B, in some cases with the help of the UV-DDB-ubiquitin ligase complex (4Min J.H. Pavletich N.P. Recognition of DNA damage by the Rad4 nucleotide excision repair protein.Nature. 2007; 449: 570-575Crossref PubMed Scopus (331) Google Scholar, 5Sugasawa K. Ng J.M. Masutani C. Iwai S. van der Spek P.J. Eker A.P. Hanaoka F. Bootsma D. Hoeijmakers J.H. Xeroderma pigmentosum group C protein complex is the initiator of global genome nucleotide excision repair.Mol. Cell. 1998; 2: 223-232Abstract Full Text Full Text PDF PubMed Scopus (742) Google Scholar, 6Sugasawa K. Okuda Y. Saijo M. Nishi R. Matsuda N. Chu G. Mori T. Iwai S. Tanaka K. Tanaka K. Hanaoka F. UV-induced ubiquitylation of XPC protein mediated by UV-DDB-ubiquitin ligase complex.Cell. 2005; 121: 387-400Abstract Full Text Full Text PDF PubMed Scopus (458) Google Scholar). Subsequently, TFIIH verifies the presence of the lesion and opens up the DNA helix, allowing the formation of a pre-incision complex containing the endonuclease XPG, the single-stranded DNA binding protein RPA and the architectural protein XPA (7Riedl T. Hanaoka F. Egly J.M. The comings and goings of nucleotide excision repair factors on damaged DNA.EMBO J. 2003; 22: 5293-5303Crossref PubMed Scopus (345) Google Scholar, 8Tapias A. Auriol J. Forget D. Enzlin J.H. Schärer O.D. Coin F. Coulombe B. Egly J.M. Ordered conformational changes in damaged DNA induced by nucleotide excision repair factors.J. Biol. Chem. 2004; 279: 19074-19083Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar, 9Wakasugi M. Sancar A. Assembly, subunit composition, and footprint of human DNA repair excision nuclease.Proc. Natl. Acad. Sci. U.S.A. 1998; 95: 6669-6674Crossref PubMed Scopus (150) Google Scholar). Finally, the second endonuclease, ERCC1-XPF is recruited to the pre-incision complex (10Tsodikov O.V. Ivanov D. Orelli B. Staresincic L. Shoshani I. Oberman R. Schärer O.D. Wagner G. Ellenberger T. Structural basis for the recruitment of ERCC1-XPF to nucleotide excision repair complexes by XPA.EMBO J. 2007; 26: 4768-4776Crossref PubMed Scopus (117) Google Scholar, 11Volker M. Moné M.J. Karmakar P. van Hoffen A. Schul W. Vermeulen W. Hoeijmakers J.H. van Driel R. van Zeeland A.A. Mullenders L.H. Sequential assembly of the nucleotide excision repair factors in vivo.Mol. Cell. 2001; 8: 213-224Abstract Full Text Full Text PDF PubMed Scopus (650) Google Scholar) and incises the DNA 5′ to the lesion, triggering initiation of repair synthesis, incision 3′ to the lesion by XPG, completion of repair synthesis and ligation (12Moser J. Kool H. Giakzidis I. Caldecott K. Mullenders L.H. Fousteri M.I. Sealing of chromosomal DNA nicks during nucleotide excision repair requires XRCC1 and DNA ligase III α in a cell-cycle-specific manner.Mol. Cell. 2007; 27: 311-323Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar, 13Ogi T. Limsirichaikul S. Overmeer R.M. Volker M. Takenaka K. Cloney R. Nakazawa Y. Niimi A. Miki Y. Jaspers N.G. Mullenders L.H. Yamashita S. Fousteri M.I. Lehmann A.R. Three DNA polymerases, recruited by different mechanisms, carry out NER repair synthesis in human cells.Mol. Cell. 2010; 37: 714-727Abstract Full Text Full Text PDF PubMed Scopus (263) Google Scholar, 14Staresincic L. Fagbemi A.F. Enzlin J.H. Gourdin A.M. Wijgers N. Dunand-Sauthier I. Giglia-Mari G. Clarkson S.G. Vermeulen W. Schärer O.D. Coordination of dual incision and repair synthesis in human nucleotide excision repair.EMBO J. 2009; 28: 1111-1120Crossref PubMed Scopus (187) Google Scholar). nucleotide excision repair interstrand crosslink helix-hairpin-helix helicase like domain. The two structure-specific endonucleases involved in NER, XPG and ERCC1-XPF, are multifunctional proteins, with diverse roles in NER and other pathways. XPG is a latent endonuclease, fulfilling first a structural and subsequently a catalytic role in NER. It has additional roles in transcription in conjunction with TFIIH (1Fagbemi A.F. Orelli B. Schärer O.D. Regulation of endonuclease activity in human nucleotide excision repair.DNA Repair. 2011; 10: 722-729Crossref PubMed Scopus (114) Google Scholar). The roles of XPG outside of NER are manifest in the severe phenotypes of many XP-G patients (15Lehmann A.R. DNA repair-deficient diseases, Xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy.Biochimie. 2003; 85: 1101-1111Crossref PubMed Scopus (407) Google Scholar, 16Schärer O.D. XPG: its products and biological roles.Adv. Exp. Med. Biol. 2008; 637: 83-92Crossref PubMed Scopus (52) Google Scholar). By contrast, most of the known XP-F patients present with a mild XP phenotype and have significant residual NER activity due to the presence of low levels of active XPF protein (17Ahmad A. Enzlin J.H. Bhagwat N.R. Wijgers N. Raams A. Appledoorn E. Theil A.F. JH J.H. Vermeulen W. NG J.J. Schärer O.D. Niedernhofer L.J. Mislocalization of XPF-ERCC1 nuclease contributes to reduced DNA repair in XP-F patients.PLoS Genet. 2010; 6: e1000871Crossref PubMed Scopus (55) Google Scholar). However, a subset of patients and mice with deficiencies in XPF or ERCC1 are much more severely affected and suffer symptoms not caused by NER deficiency alone including developmental abnormalities, premature aging and early death, (18Niedernhofer L.J. Garinis G.A. Raams A. Lalai A.S. Robinson A.R. Appeldoorn E. Odijk H. Oostendorp R. Ahmad A. van Leeuwen W. Theil A.F. Vermeulen W. van der Horst G.T. Meinecke P. Kleijer W.J. Vijg J. Jaspers N.G. Hoeijmakers J.H. A new progeroid syndrome reveals that genotoxic stress suppresses the somatotroph axis.Nature. 2006; 444: 1038-1043Crossref PubMed Scopus (526) Google Scholar, 19Jaspers N.G. Raams A. Silengo M.C. Wijgers N. Niedernhofer L.J. Robinson A.R. Giglia-Mari G. Hoogstraten D. Kleijer W.J. Hoeijmakers J.H. Vermeulen W. First reported patient with human ERCC1 deficiency has cerebro-oculo-facio-skeletal syndrome with a mild defect in nucleotide excision repair and severe developmental failure.Am. J. Hum. Genet. 2007; 80: 457-466Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar, 20Weeda G. Donker I. de Wit J. Morreau H. Janssens R. Vissers C.J. Nigg A. van Steeg H. Bootsma D. Hoeijmakers J.H. Disruption of mouse ERCC1 results in a novel repair syndrome with growth failure, nuclear abnormalities and senescence.Curr. Biol. 1997; 7: 427-439Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar, 21McWhir J. Selfridge J. Harrison D.J. Squires S. Melton D.W. Mice with DNA repair gene (ERCC-1) deficiency have elevated levels of p53, liver nuclear abnormalities and die before weaning.Nat. Genet. 1993; 5: 217-224Crossref PubMed Scopus (280) Google Scholar, 22Tian M. Shinkura R. Shinkura N. Alt F.W. Growth retardation, early death, and DNA repair defects in mice deficient for the nucleotide excision repair enzyme XPF.Mol. Cell. Biol. 2004; 24: 1200-1205Crossref PubMed Scopus (131) Google Scholar). It is believed that these additional symptoms are due to the roles of ERCC1-XPF in interstrand crosslink (ICL) repair, homologous recombination, and possibly telomere maintenance (23Niedernhofer L.J. Odijk H. Budzowska M. van Drunen E. Maas A. Theil A.F. de Wit J. Jaspers N.G. Beverloo H.B. Hoeijmakers J.H. Kanaar R. The structure-specific endonuclease Ercc1-Xpf is required to resolve DNA interstrand cross-link-induced double-strand breaks.Mol. Cell. Biol. 2004; 24: 5776-5787Crossref PubMed Scopus (428) Google Scholar, 24Ahmad A. Robinson A.R. Duensing A. van Drunen E. Beverloo H.B. Weisberg D.B. Hasty P. Hoeijmakers J.H. Niedernhofer L.J. ERCC1-XPF endonuclease facilitates DNA double-strand break repair.Mol. Cell. Biol. 2008; 28: 5082-5092Crossref PubMed Scopus (234) Google Scholar, 25Bhagwat N. Olsen A.L. Wang A.T. Hanada K. Stuckert P. Kanaar R. D'Andrea A. Niedernhofer L.J. McHugh P.J. XPF-ERCC1 participates in the Fanconi anemia pathway of cross-link repair.Mol. Cell. Biol. 2009; 29: 6427-6437Crossref PubMed Scopus (112) Google Scholar, 26Zhu X.D. Niedernhofer L. Kuster B. Mann M. Hoeijmakers J.H. de Lange T. ERCC1/XPF removes the 3′ overhang from uncapped telomeres and represses formation of telomeric DNA-containing double minute chromosomes.Mol. Cell. 2003; 12: 1489-1498Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar, 27Gregg S.Q. Robinson A.R. Niedernhofer L.J. Physiological consequences of defects in ERCC1-XPF DNA repair endonuclease.DNA Repair. 2011; 10: 781-791Crossref PubMed Scopus (107) Google Scholar). ERCC1-XPF forms an obligate heterodimer and contains a number of distinct domains that contribute to various aspects of its function (Fig. 1). Both proteins contain helix-hairpin-helix (HhH) domains at their C termini that are required for heterodimer formation (28de Laat W.L. Sijbers A.M. Odijk H. Jaspers N.G. Hoeijmakers J.H. Mapping of interaction domains between human repair proteins ERCC1 and XPF.Nucleic Acids Res. 1998; 26: 4146-4152Crossref PubMed Scopus (93) Google Scholar, 29Tsodikov O.V. Enzlin J.H. Schärer O.D. Ellenberger T. Crystal structure and DNA binding functions of ERCC1, a subunit of the DNA structure-specific endonuclease XPF-ERCC1.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 11236-11241Crossref PubMed Scopus (137) Google Scholar). The active site with the conserved nuclease motif is located adjacent to the HhH domain in XPF (30Enzlin J.H. Schärer O.D. The active site of the DNA repair endonuclease XPF-ERCC1 forms a highly conserved nuclease motif.EMBO J. 2002; 21: 2045-2053Crossref PubMed Scopus (161) Google Scholar). The central domain of ERCC1 is structurally homologous to the XPF nuclease domain (29Tsodikov O.V. Enzlin J.H. Schärer O.D. Ellenberger T. Crystal structure and DNA binding functions of ERCC1, a subunit of the DNA structure-specific endonuclease XPF-ERCC1.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 11236-11241Crossref PubMed Scopus (137) Google Scholar, 31Nishino T. Komori K. Ishino Y. Morikawa K. X-ray and biochemical anatomy of an archaeal XPF/Rad1/Mus81 family nuclease: similarity between its endonuclease domain and restriction enzymes.Structure. 2003; 11: 445-457Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), however, instead of the active site rich in acidic residues, it contains a groove lined with basic and aromatic residues that interact with the XPA protein, connecting ERCC1-XPF to the NER machinery (10Tsodikov O.V. Ivanov D. Orelli B. Staresincic L. Shoshani I. Oberman R. Schärer O.D. Wagner G. Ellenberger T. Structural basis for the recruitment of ERCC1-XPF to nucleotide excision repair complexes by XPA.EMBO J. 2007; 26: 4768-4776Crossref PubMed Scopus (117) Google Scholar, 32Li L. Peterson C.A. Lu X. Legerski R.J. Mutations in XPA that prevent association with ERCC1 are defective in nucleotide excision repair.Mol. Cell Biol. 1995; 15: 1993-1998Crossref PubMed Scopus (114) Google Scholar, 33Orelli B. McClendon T.B. Tsodikov O.V. Ellenberger T. Niedernhofer L.J. Schärer O.D. The XPA-binding domain of ERCC1 is required for nucleotide excision repair but not other DNA repair pathways.J. Biol. Chem. 2010; 285: 3705-3712Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 34Tripsianes K. Folkers G.E. Zheng C. Das D. Grinstead J.S. Kaptein R. Boelens R. Analysis of the XPA and ssDNA-binding surfaces on the central domain of human ERCC1 reveals evidence for subfunctionalization.Nucleic Acids Res. 2007; 35: 5789-5798Crossref PubMed Scopus (37) Google Scholar). XPF, the larger of the two proteins, contains an N-terminal SF2-helicase like domain (HLD), which has lost the ability to bind ATP and to unwind duplex DNA (35Sgouros J. Gaillard P.H. Wood R.D. A relationship betweena DNA-repair/recombination nuclease family and archaeal helicases.Trends Biochem. Sci. 1999; 24: 95-97Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). This domain has been implicated in DNA binding and protein-protein interactions, possibly mediating an interaction with SLX4 in ICL repair and other pathways (36Fekairi S. Scaglione S. Chahwan C. Taylor E.R. Tissier A. Coulon S. Dong M.Q. Ruse C. Yates 3rd, J.R. Russell P. Fuchs R.P. McGowan C.H. Gaillard P.H. Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/recombination endonucleases.Cell. 2009; 138: 78-89Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar, 37Muñoz I.M. Hain K. Déclais A.C. Gardiner M. Toh G.W. Sanchez-Pulido L. Heuckmann J.M. Toth R. Macartney T. Eppink B. Kanaar R. Ponting C.P. Lilley D.M. Rouse J. Coordination of structure-specific nucleases by human SLX4/BTBD12 is required for DNA repair.Mol. Cell. 2009; 35: 116-127Abstract Full Text Full Text PDF PubMed Scopus (267) Google Scholar, 38Svendsen J.M. Smogorzewska A. Sowa M.E. O'Connell B.C. Gygi S.P. Elledge S.J. Harper J.W. Mammalian BTBD12/SLX4 assembles a Holliday junction resolvase and is required for DNA repair.Cell. 2009; 138: 63-77Abstract Full Text Full Text PDF PubMed Scopus (356) Google Scholar, 39Andersen S.L. Bergstralh D.T. Kohl K.P. LaRocque J.R. Moore C.B. Sekelsky J. Drosophila MUS312 and the vertebrate ortholog BTBD12 interact with DNA structure-specific endonucleases in DNA repair and recombination.Mol. Cell. 2009; 35: 128-135Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). Interestingly, these five domains have been implicated in DNA binding, but evidence to date has been based on analysis of individual domains or on studies of archaeal XPF proteins (10Tsodikov O.V. Ivanov D. Orelli B. Staresincic L. Shoshani I. Oberman R. Schärer O.D. Wagner G. Ellenberger T. Structural basis for the recruitment of ERCC1-XPF to nucleotide excision repair complexes by XPA.EMBO J. 2007; 26: 4768-4776Crossref PubMed Scopus (117) Google Scholar, 29Tsodikov O.V. Enzlin J.H. Schärer O.D. Ellenberger T. Crystal structure and DNA binding functions of ERCC1, a subunit of the DNA structure-specific endonuclease XPF-ERCC1.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 11236-11241Crossref PubMed Scopus (137) Google Scholar, 34Tripsianes K. Folkers G.E. Zheng C. Das D. Grinstead J.S. Kaptein R. Boelens R. Analysis of the XPA and ssDNA-binding surfaces on the central domain of human ERCC1 reveals evidence for subfunctionalization.Nucleic Acids Res. 2007; 35: 5789-5798Crossref PubMed Scopus (37) Google Scholar, 40Newman M. Murray-Rust J. Lally J. Rudolf J. Fadden A. Knowles P.P. White M.F. McDonald N.Q. Structure of an XPF endonuclease with and without DNA suggests a model for substrate recognition.EMBO J. 2005; 24: 895-905Crossref PubMed Scopus (99) Google Scholar, 41Nishino T. Komori K. Ishino Y. Morikawa K. Structural and functional analyses of an archaeal XPF/Rad1/Mus81 nuclease: asymmetric DNA binding and cleavage mechanisms.Structure. 2005; 13: 1183-1192Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 42Nishino T. Komori K. Tsuchiya D. Ishino Y. Morikawa K. Crystal structure and functional implications of Pyrococcus furiosus hef helicase domain involved in branched DNA processing.Structure. 2005; 13: 143-153Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 43Tripsianes K. Folkers G. Ab E. Das D. Odijk H. Jaspers N.G. Hoeijmakers J.H. Kaptein R. Boelens R. The structure of the human ERCC1/XPF interaction domains reveals a complementary role for the two proteins in nucleotide excision repair.Structure. 2005; 13: 1849-1858Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). We investigated the role of four C-terminal DNA binding domains by mutational analysis in the context of full-length ERCC1-XPF. Our studies show that DNA binding mutations in any single domain are insufficient to abolish NER in vitro and in vivo. Instead, we report that mutations in multiple domains are necessary to disrupt NER and that there is a hierarchy of importance of the individual domains. Our studies are consistent with the notion that multiple weak interactions among proteins and DNA substrates drive progress through the NER reaction (2Gillet L.C. Schärer O.D. Molecular mechanisms of mammalian global genome nucleotide excision repair.Chem. Rev. 2006; 106: 253-276Crossref PubMed Scopus (490) Google Scholar, 44Stauffer M.E. Chazin W.J. Structural mechanisms of DNA replication, repair, and recombination.J. Biol. Chem. 2004; 279: 30915-30918Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). Site-directed mutagenesis of pFastBac-XPF and pFastBac-ERCC1-His (30Enzlin J.H. Schärer O.D. The active site of the DNA repair endonuclease XPF-ERCC1 forms a highly conserved nuclease motif.EMBO J. 2002; 21: 2045-2053Crossref PubMed Scopus (161) Google Scholar) was performed using the QuikChange site-directed mutagenesis kit (Stratagene) to generate the following mutations: XPFR678A, XPFK850A/R853A, XPFR678A/K850A/K853A, ERCC1K247A/K281A, ERCC1N110A, and ERCC1N110A/K247A/K281A. Bacmid DNA was generated in DH10Bac cells and transfected into the Sf9 insect cells to obtain baculoviruses according to a standard protocol (Bac-to-Bac, Invitrogen). The following combination of ERCC1 and XPF proteins were co-expressed in Sf9 cells for 60 to 65 h with an MOI of 5: ERCC1-XPF, ERCC1-XPFR678A, ERCC1-XPFK850A/R853A, ERCC1-XPFR678A/K850A/R853A, ERCC1K247A/K281A-XPF, ERCC1N110A-XPF, ERCC1N110A/K247A/K281A-XPF, ERCC1K247A/K281A-XPFR678A, ERCC1N110A-XPFR678A, and ERCC1K247A/K281A-XPFK850A/K853A. Cells were lysed and proteins purified over a 1 ml Nickel (His Trap) column (Amersham Biosciences), a HiLoad 16/60 Superdex 200 column (Amersham Biosciences) and a 1 ml Hitrap Heparin column (Amersham Biosciences) as described in (30Enzlin J.H. Schärer O.D. The active site of the DNA repair endonuclease XPF-ERCC1 forms a highly conserved nuclease motif.EMBO J. 2002; 21: 2045-2053Crossref PubMed Scopus (161) Google Scholar). The proteins eluted at 650 mm NaCl from the Heparin column and were in some cases concentrated on an Amicon Ultra-4 Centrifugal Filter (Millipore). Proteins were frozen in aliquots in liquid N2 and stored at −80 °C. 10 pmol of a stem-loop oligonucleotide (GCCAGCGCTCGG(T)22CCGAGCGCTGGC) labeled with fluorescent dye Cy5 at the 3′-end (IDT) were annealed in 200 μl solution (10 mm Tris, pH 8.0, 50 mm NaCl, 1 mm MgCl2) by heating at 90 °C for 10 min and allowing to cool at room temperature for 2 h. 100 fmol of the substrate were incubated in 25 mm Tris, pH 8.0, 2 mm MgCl2, 10% glycerol, 0.5 mm β-mercaptoethanol, 0.1 mg/ml BSA, 40 mm NaCl with various amounts of protein in a volume of 15 μl. The reactions were incubated at 30 °C for 30 min and quenched by adding 10 μl of 80% formamide/10 mm EDTA. After heating at 95 °C for 5 min and cooling on ice, 3 μl of each sample were analyzed on a 12% denaturing polyacrylamide gel. Bands were visualized by fluorescence imaging on a Typhoon 9400 imaging system (Amersham Biosciences). Extracts derived from XPF-deficient XP2YO cells and plasmids containing dG-acetylaminofluorene (dG-AAF) or 1,3-intrastrand cisplatin (cis-Pt) lesions were prepared as described previously (45Shivji M.K. Moggs J.G. Kuraoka I. Wood R.D. Dual-incision assays for nucleotide excision repair using DNA with a lesion at a specific site.Methods Mol. Biol. 1999; 113: 373-392PubMed Google Scholar, 46Gillet L.C. Alzeer J. Schärer O.D. Site-specific incorporation of N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF) into oligonucleotides using modified ultra-mild DNA synthesis.Nucleic Acids Res. 2005; 33: 1961-1969Crossref PubMed Scopus (52) Google Scholar, 47Biggerstaff M. Wood R.D. Assay for nucleotide excision repair protein activity using fractionated cell extracts and UV-damaged plasmid DNA.Methods Mol. Biol. 1999; 113: 357-372PubMed Google Scholar). For each reaction, 2 μl of repair buffer (200 mm Hepes-KOH (pH 7.8), 25 mm MgCl2, 2.5 mm DTT, 10 mm ATP, 110 mm phosphocreatine (di-Tris salt, Sigma), and 1.8 mg/ml BSA), 0.2 μl of creatine phosphokinase (2.5 mg/ml, sigma), 3 μl of XPF-deficient cell extract (about 10 mg/ml), NaCl (to a final concentration of 70 mm), and different amounts of purified ERCC1-XPF in a total volume of 9 μl were pre-warmed at 30 °C for 10 min. 1 μl plasmid containing dG-AAF or cis-Pt (50 ng/μl) was added to each reaction, and the samples were incubated at 30 °C for 45 min. After adding 0.5 μl of 1 μm of an oligonucleotide complementary to the excision product with a 4G overhang for either dG-AAF (5′ GGGGCATGTGGCGCCGGTAATAGCTACGTAGCTCp-3′) or cis-Pt (5′-GGGGGAAGAGTGCACAGAAGAAGACCTGGTCGACCp-3′), the mixtures were denatured by heating at 95 °C for 5 min. After cooling at room temperature for 15 min, 1 μl of sequenase mixture (0.13 units of sequenase (USB), and 2.0 μCi [α-32P]dCTP for each reaction) was added and incubated at 37 °C for 3 min, followed by addition of 1.2 μl dNTP mixture (50 μm dCTP, 100 μm dTTP, 100 μm dATP, and 100 μm dGTP). The reactions were incubated at 37 °C for 12 min and stopped by addition of 8 μl of 80% formamide/10 mm EDTA. After heating to 95 °C for 5 min, samples were placed on ice and analyzed on a 14% denaturing polyacrylamide gel. Gels were exposed to a phosphor screen and visualized by Phosphorimager (Typhoon 9400, Amersham Biosciences Biosciences). For the anisotropy experiments, the protein storage buffer was exchanged to 25 mm KH2PO4 pH 7.6, 5 mm β-mercaptoethanol, 10% glycerol, 150 mm NaCl. Increasing concentrations of protein were incubated with the splayed arm substrate (10 nm) which was made by annealing the following oligonucleotides: 5′-CTTTCGAACATCCAGGAGAGCACGGCCTTTTTTTTTTTTTTTTTTTT with an FAM label at the 3′-end and 5′-TTTTTTTTTTTTTTTTTTTTGGCCGTGCTCTCCTGGATGTTCGAAAG. 100 nm of competitor double-stranded DNA (5′-TCAAAGTCACGACCTAGACACTGCGAGCTCGAATTCACTGGAGTGACCTC and 5′-GAGGTCACTCCAGTGAATTCGAGCTCGCAGTGTCTAGGTCGTGACTTTGA) were used in each reaction. Each reaction was incubated in 20 μl of buffer (25 mm Hepes-KOH (pH 8.0), 15% glycerol, 0.1 mg/ml BSA, 2 mm CaCl2, 0.5 mm β -mercaptoethanol, and 40 mm NaCl) at 30 °C for 5 min. The experiments were conducted at least four times and measured on Infinite M1000 plate reader (Tecan). The data were fitted using the grafit4 program to the equation f = y + a × x^b/(c^b + x^b), where x is the protein concentration, f is the fluorescent anisotropy and c is the Kd value. Human XP-F mutant fibroblasts XP2YO, Chinese hamster ovary cells UV20 (with a mutation in ERCC1), and 293T cells were cultured in Dulbecco's modified Eagle's medium high glucose 1× (GIBCO), 10% fetal bovine serum, 100 units/ml penicillin, and 0.1 mg/ml streptomycin at 37 °C in a 5% CO2 humid incubator. Wild-type or mutant XPF cDNA with an hemaglutinin (HA) tag at C-terminal was inserted into the pWPXL vector, which was co-transfected with the packaging plasmid psPAX2 and the envelop plasmid pMD2G into 293T cells to generate lentiviral particles. The particles were transduced into XP2YO cells to produce cell lines stably expressing wild-type or mutant XPF proteins according to established procedures (48Salmon P. Kindler V. Ducrey O. Chapuis B. Zubler R.H. Trono D. High-level transgene expression in human hematopoietic progenitors and differentiated blood lineages after transduction with improved lentiviral vectors.Blood. 2000; 96: 3392-3398Crossref PubMed Google Scholar, 49Salmon P. Trono D. Current Protocols in Neuroscience. 2006; (Chapter 4, Unit 4, page 21)PubMed Google Scholar). The same procedure was applied to generate cell lines expressing wild-type or mutant ERCC1 in UV20 cells. About 50,000 cells were plated on a coverslip in 6-well plates, grown for 2–3 days and irradiated through a polycarbonate membrane with 5 μm pores (Millipore) with UV light (254 nm) with a dose of 150 J/m2 (XP2YO cells) or 120 J/m2 (UV20 cells). Cells were incubated at 37 °C, 5% CO2 for 30 min to 24 h. They were washed first with PBS and then with PBS plus 0.05% Triton X-100 and fixed with 3% paraformaldehyde plus 0.1% Triton X-100 (XP2YO cells) or washed first with PBS and then with PBS plus 0.1% triton X-100, and fixed by 3% paraformaldehyde plus 0.2% triton X-100 (UV20 cells). After fixation, cells were washed with PBS containing 0.2% Triton X-100. To stain for (6–4)PPs, cells were treated with 0.07 m NaOH in PBS for 5 min, followed by washing with PBS plus 0.2% Triton X-100. After blocking with PBS plus 5 mg/ml BSA and 1.5 mg/ml glycine, cells were stained with mouse monoclonal anti-(6–4)PP antibody (Cosmo Bio) 1:400, rabbit polyclonal anti-ERCC1 antibody (FL-297, Santa Cruz Biotechnology) 1:100, or rabbit polyclonal anti-HA antibody (ChIP grade, Abcam) 1:2000 for 1.5 h, and washed with PBS containing 0.2% Triton X-100. Cells were then incubated with secondary antibodies: Cy3-conjugated affinipure goat anti-mouse IgG(H+L) (Jackson ImmunoResearch) 1:1000 and Alexa Fluor 488-labeled F(ab′)2 fragment of goat anti-rabbit IgG (H+L) (Invitrogen) 1:800 for 1 h, followed by washing with PBS with 0.2% Triton X-100. Samples were washed with PBS, embedded in Vectashield Mounting Medium with 1.5 μg/ml of DAPI (Vector Laboratories) and analyzed using a confocal microscope (Zeiss LSM 510). About 100 cells were counted in at least three independent experiments for quantification. Exponentially growing cells were plated in 6 cm dishes in triplicate at a density of 1–20 × 103-cells/plate for human cells or 250–5,000 cells/plate for Chinese hamste" @default.
• W2021982887 created "2016-06-24" @default.
• W2021982887 creator A5024484224 @default.
• W2021982887 creator A5043039694 @default.
• W2021982887 creator A5043175949 @default.
• W2021982887 creator A5083489177 @default.
• W2021982887 creator A5091023110 @default.
• W2021982887 date "2012-06-01" @default.
• W2021982887 modified "2023-10-16" @default.
• W2021982887 title "Multiple DNA Binding Domains Mediate the Function of the ERCC1-XPF Protein in Nucleotide Excision Repair" @default.
• W2021982887 cites W136476865 @default.
• W2021982887 cites W1964616851 @default.
• W2021982887 cites W1974691766 @default.
• W2021982887 cites W1975365355 @default.
• W2021982887 cites W1980819419 @default.
• W2021982887 cites W1981148605 @default.
• W2021982887 cites W1989208996 @default.
• W2021982887 cites W1990294201 @default.
• W2021982887 cites W1990849368 @default.
• W2021982887 cites W1992129085 @default.
• W2021982887 cites W1996372461 @default.
• W2021982887 cites W1996516839 @default.
• W2021982887 cites W2006338892 @default.
• W2021982887 cites W2007988428 @default.
• W2021982887 cites W2016648136 @default.
• W2021982887 cites W2024073282 @default.
• W2021982887 cites W2032471242 @default.
• W2021982887 cites W2033361357 @default.
• W2021982887 cites W2036680792 @default.
• W2021982887 cites W2037936898 @default.
• W2021982887 cites W2043051674 @default.
• W2021982887 cites W2044346962 @default.
• W2021982887 cites W2044357207 @default.
• W2021982887 cites W2046082575 @default.
• W2021982887 cites W2048906582 @default.
• W2021982887 cites W2054693978 @default.
• W2021982887 cites W2059186992 @default.
• W2021982887 cites W2061353549 @default.
• W2021982887 cites W2061545358 @default.
• W2021982887 cites W2063260609 @default.
• W2021982887 cites W2070821144 @default.
• W2021982887 cites W2079185082 @default.
• W2021982887 cites W2080605611 @default.
• W2021982887 cites W2080726979 @default.
• W2021982887 cites W2082398105 @default.
• W2021982887 cites W2083231946 @default.
• W2021982887 cites W2087954689 @default.
• W2021982887 cites W2090441795 @default.
• W2021982887 cites W2099613936 @default.
• W2021982887 cites W2106515413 @default.
• W2021982887 cites W2106848851 @default.
• W2021982887 cites W2109113345 @default.
• W2021982887 cites W2109816131 @default.
• W2021982887 cites W2118619700 @default.
• W2021982887 cites W2120453274 @default.
• W2021982887 cites W2121909403 @default.
• W2021982887 cites W2128552081 @default.
• W2021982887 cites W2132438813 @default.
• W2021982887 cites W2142587778 @default.
• W2021982887 cites W2144222655 @default.
• W2021982887 cites W2146789449 @default.
• W2021982887 cites W2149940457 @default.
• W2021982887 cites W2150072036 @default.
• W2021982887 cites W2155447972 @default.
• W2021982887 cites W2157004858 @default.
• W2021982887 cites W2157811245 @default.
• W2021982887 cites W2162551655 @default.
• W2021982887 cites W2166424758 @default.
• W2021982887 cites W32490452 @default.
• W2021982887 cites W4249296576 @default.
• W2021982887 doi "https://doi.org/10.1074/jbc.m111.337899" @default.
• W2021982887 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3381147" @default.
• W2021982887 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/22547097" @default.
• W2021982887 hasPublicationYear "2012" @default.
• W2021982887 type Work @default.
• W2021982887 sameAs 2021982887 @default.
• W2021982887 citedByCount "32" @default.
• W2021982887 countsByYear W20219828872012 @default.
• W2021982887 countsByYear W20219828872013 @default.
• W2021982887 countsByYear W20219828872014 @default.
• W2021982887 countsByYear W20219828872015 @default.
• W2021982887 countsByYear W20219828872016 @default.
• W2021982887 countsByYear W20219828872017 @default.
• W2021982887 countsByYear W20219828872018 @default.
• W2021982887 countsByYear W20219828872019 @default.
• W2021982887 countsByYear W20219828872021 @default.
• W2021982887 countsByYear W20219828872022 @default.
• W2021982887 crossrefType "journal-article" @default.
• W2021982887 hasAuthorship W2021982887A5024484224 @default.
• W2021982887 hasAuthorship W2021982887A5043039694 @default.
• W2021982887 hasAuthorship W2021982887A5043175949 @default.
• W2021982887 hasAuthorship W2021982887A5083489177 @default.
• W2021982887 hasAuthorship W2021982887A5091023110 @default.
• W2021982887 hasBestOaLocation W20219828871 @default.
• W2021982887 hasConcept C104317684 @default.
• W2021982887 hasConcept C104451858 @default.
• W2021982887 hasConcept C134935766 @default.
• W2021982887 hasConcept C14036430 @default.

• next