FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022016504> ?p ?o ?g. }

• W2022016504 endingPage "21659" @default.
• W2022016504 startingPage "21654" @default.
• W2022016504 abstract "The uptake of oxidized low density lipoprotein (OxLDL) by macrophages is a key event implicated in the initiation and development of atherosclerotic lesions. Two macrophage surface receptors, CD36 (a class B scavenger receptor) and the macrophage scavenger receptor (a class A scavenger receptor), have been identified as the major receptors that bind and internalize OxLDL. Expression of CD36 in monocyte/macrophages in tissue culture is dependent both on the differentiation state as well as exposure to soluble mediators (cytokines and growth factors). The regulatory mechanisms of this receptor in vivo are undetermined as is the role of lipoproteins themselves in modulating CD36 expression. We studied the effect of lipoproteins, native LDL and modified LDL (acetylated LDL (AcLDL) and OxLDL) on the expression of CD36 in J774 cells, a murine macrophage cell line. Exposure to lipoproteins resulted in a marked induction of CD36 mRNA expression (4–8-fold). Time course studies showed that maximum induction was observed 2 h after treatment with AcLDL and at 4 h with LDL and OxLDL. Increased expression of CD36 mRNA persisted for 24 h with each treatment group. Induction of CD36 mRNA expression was paralleled by an increase in CD36 protein as determined by Western blot with the greatest induction by OxLDL (4-fold). In the presence of actinomycin D, treatment of macrophages with LDL, AcLDL, or OxLDL did not affect CD36 mRNA stability, implying that CD36 mRNA was transcriptionally regulated by lipoproteins. To determine the mechanism(s) by which lipoproteins increased expression of CD36 we evaluated the effects of lipoprotein components on CD36 mRNA expression. ApoB 100 increased CD36 mRNA expression significantly, whereas phospholipid/cholesterol liposomes had less effect. Incubation of macrophages with bovine serum albumin or HDL reduced expression of CD36 mRNA in a dose-dependent manner. Finally, to evaluate the in vivo relevance of the induction of CD36 mRNA expression by lipoproteins, peritoneal macrophages were isolated from mice following intraperitoneal injection of lipoproteins. Macrophage expression of CD36 mRNA was significantly increased by LDL, AcLDL, or OxLDL in relation to mice infused with phosphate-buffered saline, with OxLDL causing the greatest induction (8-fold). This is the first demonstration that exposure to free and esterified lipids augments functional expression of the class B scavenger receptor, CD36. These data imply that lipoproteins can further contribute to foam cell development in atherosclerosis by up-regulating a major OxLDL receptor. The uptake of oxidized low density lipoprotein (OxLDL) by macrophages is a key event implicated in the initiation and development of atherosclerotic lesions. Two macrophage surface receptors, CD36 (a class B scavenger receptor) and the macrophage scavenger receptor (a class A scavenger receptor), have been identified as the major receptors that bind and internalize OxLDL. Expression of CD36 in monocyte/macrophages in tissue culture is dependent both on the differentiation state as well as exposure to soluble mediators (cytokines and growth factors). The regulatory mechanisms of this receptor in vivo are undetermined as is the role of lipoproteins themselves in modulating CD36 expression. We studied the effect of lipoproteins, native LDL and modified LDL (acetylated LDL (AcLDL) and OxLDL) on the expression of CD36 in J774 cells, a murine macrophage cell line. Exposure to lipoproteins resulted in a marked induction of CD36 mRNA expression (4–8-fold). Time course studies showed that maximum induction was observed 2 h after treatment with AcLDL and at 4 h with LDL and OxLDL. Increased expression of CD36 mRNA persisted for 24 h with each treatment group. Induction of CD36 mRNA expression was paralleled by an increase in CD36 protein as determined by Western blot with the greatest induction by OxLDL (4-fold). In the presence of actinomycin D, treatment of macrophages with LDL, AcLDL, or OxLDL did not affect CD36 mRNA stability, implying that CD36 mRNA was transcriptionally regulated by lipoproteins. To determine the mechanism(s) by which lipoproteins increased expression of CD36 we evaluated the effects of lipoprotein components on CD36 mRNA expression. ApoB 100 increased CD36 mRNA expression significantly, whereas phospholipid/cholesterol liposomes had less effect. Incubation of macrophages with bovine serum albumin or HDL reduced expression of CD36 mRNA in a dose-dependent manner. Finally, to evaluate the in vivo relevance of the induction of CD36 mRNA expression by lipoproteins, peritoneal macrophages were isolated from mice following intraperitoneal injection of lipoproteins. Macrophage expression of CD36 mRNA was significantly increased by LDL, AcLDL, or OxLDL in relation to mice infused with phosphate-buffered saline, with OxLDL causing the greatest induction (8-fold). This is the first demonstration that exposure to free and esterified lipids augments functional expression of the class B scavenger receptor, CD36. These data imply that lipoproteins can further contribute to foam cell development in atherosclerosis by up-regulating a major OxLDL receptor. Oxidation of low density lipoproteins is a critical early event in the pathogenesis of atherosclerosis, and oxidized low density lipoprotein (OxLDL) 1The abbreviations used are: OxLDL, oxidized low density lipoprotein; LDL, low density lipoprotein; AcLDL, acetylated LDL; BSA, bovine serum albumin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; PBS, phosphate-buffered saline; PBS/T, PBS and 0.1% Tween 20; LPS, lipopolysaccharide; M-CSF, macrophage colony-stimulating factor. is the proximal source of lipid that accumulates within cells of the atherosclerotic lesion (1Haberland M. Fong D. Cheng L. Science. 1988; 241: 215-218Crossref PubMed Scopus (610) Google Scholar, 2Steinberg D. Parthasarathy S. Carew T. Khoo J. Witztum J. N. Engl. J. Med. 1989; 320: 915-919Crossref PubMed Google Scholar). Receptors involved in binding and internalizing modified LDL (low density lipoprotein) particles, termed “scavenger receptors”, are thought to play a significant role in atherosclerotic foam cell development (2Steinberg D. Parthasarathy S. Carew T. Khoo J. Witztum J. N. Engl. J. Med. 1989; 320: 915-919Crossref PubMed Google Scholar, 3Steinberg D. Circulation. 1987; 76: 508-514Crossref PubMed Scopus (119) Google Scholar, 4Gown A. Tsukada T. Ross R. Am. J. Pathol. 1986; 125: 191-207PubMed Google Scholar, 5Fogelman A. Van Lenten B. Warden C. Haberland M. Edwards P. J. Cell Sci. 1988; Suppl (135–149): 9Google Scholar). The first macrophage scavenger receptor identified, isolated, and cloned (type A scavenger receptor) was identified as a receptor for AcLDL (6Kodama T. Reddy P. Kishamoto C. Krieger M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 9238-9242Crossref PubMed Scopus (221) Google Scholar, 7Via D.P. Dresel H.A. Cheng S.-L. Gotto Jr., A.M. J. Biol. Chem. 1985; 260: 7379-7386Abstract Full Text PDF PubMed Google Scholar, 8Kodama T. Freeman M. Rohrer L. Zabrecky J. Matsudaira P. Krieger M. Nature. 1990; 343: 531-535Crossref PubMed Scopus (846) Google Scholar, 9Rohrer L. Freeman M. Kodama T. Penman M. Krieger M. Nature. 1990; 343: 570-572Crossref PubMed Scopus (374) Google Scholar). However, since acetylation of LDL does not occur under physiological conditions, the natural ligand for this receptor was unclear until it was demonstrated that OxLDL partially competes for the binding of acetylated LDL to macrophages (10Parthasarathy S. Printz D. Boyd D. Joy L. Steinberg D. Arteriosclerosis. 1986; 6: 505-510Crossref PubMed Google Scholar). CD36 has now been classified as the defining member of a second class of scavenger receptors, type “B”, which is distinct from the type A (I/II) receptors. It was identified using an expression-cloning strategy to isolate murine macrophage receptors that recognized OxLDL but not AcLDL (11Endemann G. Stanton L.W. Madden K.S. Bryant C.M. White R.T. Protter A.A. J. Biol. Chem. 1993; 268: 11811-11816Abstract Full Text PDF PubMed Google Scholar). CD36 cDNA-transfected cells bind and internalize OxLDL, and binding of OxLDL to human macrophages is blocked by 50% by antibodies to CD36 (12Nicholson A. Pearce S.F.A. Silverstein R. Arterioscler. Thromb. 1995; 15: 269-275Crossref Scopus (223) Google Scholar, 13Nicholson A.C. Hajjar D.P. Silverstein R.L. Schlossman S.F. Boumsell L. Gilks W. Harlan J.M. Kishimoto T. Morimoto C. Ritz J. Silverstein R.L. Springer T.A. Tedder T.F. Todd R.F. Leukocyte Typing V: White Cell Differentiation Antigens. Oxford University Press, Oxford, UK1995: 1278-1280Google Scholar). CD36 is an 88-kDa transmembrane glycoprotein expressed on monocyte/macrophages (14Talle M. Rao P. Westberg E. Allegar N. Makowski M. Mittler R. Goldstein G. Cell. Immunol. 1983; 78: 83-99Crossref PubMed Scopus (131) Google Scholar), platelets (15Li Y.S. Shyy Y.J. Wright J.G. Valente A.J. Cornhill J.F. Kolattukudy P.E. Mol. Cell. Biochem. 1993; 126: 61-68Crossref PubMed Scopus (71) Google Scholar), certain microvascular endothelium (16Knowles D. Tolidijian B. Marboe C. Agati V. Grimes J. Chass L. J. Immunol. 1984; 132: 2170-2173PubMed Google Scholar), erythroid precursors (17Edelman E. Vinci G. Villeval J. Vainchender W. Henri A. Miglierina R. Rouger P. Reviron J. Breton-Groius J. Sereau C. Edelman L. Blood. 1986; 67: 56-63Crossref PubMed Google Scholar), adipocytes (18Abumrad N.A. El-Maghrabi M.R. Amri E.-Z. Lopez E. Grimaldi P.A. J. Biol. Chem. 1993; 268: 17665-17668Abstract Full Text PDF PubMed Google Scholar), and breast and retinal pigment epithelium (19Greenwalt D. Watt K. So O. Jiwani N. Biochemistry. 1990; 29: 7054-7058Crossref PubMed Scopus (80) Google Scholar). CD36 belongs to a small gene family that is highly conserved and includes at least 3 members: CD36, LIMP2 (a lysosomal membrane protein with >60% sequence homology to CD36 (20Vega M.A. Segui-Real B. Garcia J. Cales C. Rodriguez F. Vanderkerckhove J. Sandoval I. J. Biol. Chem. 1994; 266: 16818-16824Abstract Full Text PDF Google Scholar)), and CLA-1 (21Calvo D. Vega M.A. J. Biol. Chem. 1993; 268: 18929-18935Abstract Full Text PDF PubMed Google Scholar). Hamster CLA-1 homologue (SR-B1) also binds OxLDL (22Acton S.L. Scherer P.E. Lodish H.F. Krieger M. J. Biol. Chem. 1994; 269: 21003-21009Abstract Full Text PDF PubMed Google Scholar) and HDL (23Acton S. Attilio R. Landschultz K. Xu S. Hobbs H. Krieger M. Science. 1996; 271: 518-520Crossref PubMed Scopus (2011) Google Scholar). Both SR-BI and CD36 cDNA-transfected cells can bind anionic phospholipid liposomes (24Rigotti A. Acton S.L. Krieger M. J. Biol. Chem. 1995; 270: 16221-16224Abstract Full Text Full Text PDF PubMed Scopus (492) Google Scholar) and CD36 on adipocytes functions to bind free fatty acids (18Abumrad N.A. El-Maghrabi M.R. Amri E.-Z. Lopez E. Grimaldi P.A. J. Biol. Chem. 1993; 268: 17665-17668Abstract Full Text PDF PubMed Google Scholar). The aim of this study was to determine the impact of native and modified lipids on the expression of CD36. Although macrophage expression of CD36 can be modulated by cytokines (25Yesner L. Huh H. Pearce S.F.A. Silverstein R. Arterioscler. Thromb. 1996; 16: 1019-1025Crossref Scopus (151) Google Scholar) and by adhesion to tumor necrosis factor-α-activated endothelial cells (26Huh H.Y. Lo S.K. Yesner L.M. Silverstein R.L. J. Biol. Chem. 1995; 270: 6267-6271Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), the effect of lipid on CD36 expression is unknown. Modulation of scavenger receptors by lipids may potentially impact on the accumulation of cholesteryl esters in macrophages during atherosclerosis. J774A.1 cells (ATCC, Rockville, MD), a murine macrophage cell line, were cultured in T25 flasks with RPMI 1640 medium containing 10% fetal calf serum, 50 μg/ml each of penicillin and streptomycin, and 2 mm glutamine. Experiments were performed when cells were about 90% confluent. LDL (1.019–1.063 g/ml) was isolated from normal human plasma by sequential ultracentrifugation, dialyzed with phosphate-buffered saline (PBS) containing 0.3 mm EDTA, sterilized by filtration through a 0.22-μm filter (Millipore), and stored under nitrogen at 4 °C. Protein content was determined by the method of Lowry et al.(27Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). AcLDL was prepared by the method of Goldstein et al.(28Goldstein J. Ho Y. Basu S. Brown M. Proc. Natl. Acad. Sci. U. S. A. 1979; 76: 333-337Crossref PubMed Scopus (1952) Google Scholar). LDL was oxidized by dialysis against PBS with 5 μmCuSO4 for 10 h at 37 °C. The purity and charge of both native and AcLDL were evaluated by examining electrophoretic mobility in agarose gel. The degree of oxidation of LDL and OxLDL was determined by measuring the amount of thiobarbituric acid reactive substances (29Liao J.K. Shin W.S. Lee W.Y. Clark S.L. J. Biol. Chem. 1995; 270: 319-324Abstract Full Text Full Text PDF PubMed Scopus (534) Google Scholar). LDL had thiobarbituric acid reactive values of <1 nmol/mg. Oxidized LDL had thiobarbituric acid reactive values of >10 and <30 nmol/mg. All lipoproteins were used for experiments within 3 weeks after preparation. Cells were lysed in RNAzolTM B (Tel-Test, Inc., TX). Chloroform was extracted, and total cellular RNA was precipitated in isopropanol. Total RNA (20 μg) from each sample was loaded on 1% formaldehyde-agarose gels. After electrophoresis, RNA was transferred to a Zeta-probe® GT genomic tested blotting membrane (Bio-Rad). The blot was UV cross-linked and prehybridized with HybrisolTMI (Oncor, Inc., Gaithersburg, MD) before the addition of32P random prime labeling probe for CD36. The probe is aNsiI-BglII digest (base pairs 193–805) of murine CD36. The original murine CD36 cDNA was obtained from Dr. Gerda Endemann (11Endemann G. Stanton L.W. Madden K.S. Bryant C.M. White R.T. Protter A.A. J. Biol. Chem. 1993; 268: 11811-11816Abstract Full Text PDF PubMed Google Scholar). The cDNA probe for the murine LDL receptor was prepared by reverse transcription-polymerase chain reaction with primers generated from published sequences (30Hoffer M. van Eck M. Petrij F. van der Zee A. de Wit E. Meijer D. Grosveld G. Havekes L. Hofker M. Frants R. Biochem. Biophys. Res Commun. 1993; 191: 880-886Crossref PubMed Scopus (32) Google Scholar). The sequences of 5′- and 3′-oligonucleotides used were GACTGCAAGGACATGAGCGA (781–801) and CGGTTGGTGAAGAGCAGATA (1201–1221), respectively. Membranes were hybridized overnight, washed, and exposed to x-ray film (X-Omat AR, Eastman Kodak Co.). Autoradiograms were quantified by densitometric scanning using a UMAX (Santa Clara, CA) UC630 flatbed scanner attached to a Macintosh IIci computer running NIH Image software (Bethesda, MD). The same blot was used to rehybridize with 32P-labeled probe for glyceraldehyde phosphate dehydrogenase (GAPDH) to verify the amount of total RNA loaded. Cells in a T25 flask were released by a rubber scraper, pelleted by sedimentation for 5 min at 500 × g, and washed twice with PBS. After lysis with lysis buffer (20 mm Tris, pH 7.5, 137 mm NaCl, 2 mm EDTA, 1% Triton X-100, 25 mmβ-glycerophosphate, 2 mm sodium pyrophosphate, 1 mm phenylmethylsulfonyl fluoride, 10 μg/ml of aprotinin, and 100 mm NaVO4), the lysate was microcentrifuged for 10 min at 4 °C, and the supernatant was transferred to a new test tube. Protein (100 μg) from each sample was loaded and separated on a 15% SDS-polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with a solution of 0.1% Tween 20/PBS (PBS-T) containing 1% BSA for 2 h, and then incubated with rabbit polyclonal anti-FAT (the rat homologue of CD36) antibody (31Ryeom S. Sparrow J. Silverstein R. J. Cell Sci. 1996; 109: 387-395Crossref PubMed Google Scholar) at 2 μg/ml in PBS-T/BSA for 1 h at room temperature followed by washing 3 times for 10 min with PBS-T buffer. The blot was reblocked with PBS-T/BSA for an additional hour before adding horseradish peroxidase conjugated goat anti-rabbit IgG (1:400 dilution) for another hour at room temperature. After washing 3 times for 10 min with PBS-T the membrane was incubated for 1 min in a mixture of equal volumes of Western blot chemiluminescence reagents 1 and 2 (Renaissance®, NEN Life Science Products). The membrane was then exposed to film for 2 min before development. Unilamellar phospholipid liposomes were prepared by extrusion through polycarbonate membranes (24Rigotti A. Acton S.L. Krieger M. J. Biol. Chem. 1995; 270: 16221-16224Abstract Full Text Full Text PDF PubMed Scopus (492) Google Scholar). Phosphatidylcholine liposomes contained a 2:1 molar ratio of phosphatidylcholine to cholesterol whereas phosphatidylcholine/phosphatidylinositol liposomes had a 1:1:1 ratio of phosphatidylinositol, phosphatidylcholine, and cholesterol. Liposomes were used within 1 week of preparation. Apoprotein B100 was obtained from Sigma. The effect of native LDL (LDL) and modified LDL (AcLDL and OxLDL) on CD36 mRNA expression was evaluated in a murine macrophage cell line, J774 cells. The cells were cultured overnight in serum-free medium and then treated for 12 h with LDL, AcLDL, or OxLDL (each at 12.5, 25, 50, and 100 μg/ml protein). Changes in cell morphology and viability were not observed. As shown in Fig. 1, native LDL significantly increased (8-fold) CD36 mRNA expression at an LDL concentration of 25 μg/ml. AcLDL induced CD36 mRNA expression by 5-fold with peak expression induced at a concentration of 50 μg/ml. OxLDL increased CD36 mRNA expression (maximal induction of 6-fold) at a concentration of 25 μg/ml. To study the kinetics of induction of CD36 mRNA expression by lipoproteins, we carried out the time course study as shown in Fig. 2. Maximum induction was observed about 2 h after treatment with AcLDL and 4 h with LDL and OxLDL. Increased expression of CD36 mRNA persisted through 24 h with each treatment group. To investigate if the induction of CD36 mRNA expression by lipoproteins was associated with an increase of CD36 protein, macrophages were treated with either LDL, AcLDL, or OxLDL (50 μg/ml protein) for 6 h. As seen in Fig. 3, CD36 protein is detected at two major bands of approximately 53 kDa and 88 kDa, which represent the non-glycosylated form and glycosylated form of the protein. CD36 protein was increased significantly by LDL, AcLDL, and OxLDL by 2-, 3-, and 4-fold, respectively. Only OxLDL significantly increased the glycosylated (88 kDa) form of the protein. Because alterations in steady-state mRNA can reflect changes in either transcription rates or mRNA stability, we studied the effect of lipoproteins on the half-life of CD36 mRNA. In the absence of actinomycin D, CD36 mRNA steady-state levels were increased in response to LDL, AcLDL, or OxLDL (Figs. 1 and4). In the presence of actinomycin D, CD36 mRNA decreased with time (Fig. 4). The half-life of CD36 mRNA was estimated to be approximately 5 h based on the densitometric scanning. Lipoproteins did not increase CD36 mRNA expression in the presence of actinomycin D, and the decrease in the CD36 message, measured as the ratio of CD36 mRNA to GAPDH mRNA, was similar to cells treated with actinomycin D alone. These data demonstrate that lipoproteins do not alter CD36 mRNA stability and imply that regulation of CD36 by lipoproteins is at the level of transcription. To rule out the possibility of nonspecific membrane effects arising from the loading of macrophages with sterols as a cause of CD36 induction, we evaluated the effect of lipoproteins on the expression of another lipoprotein receptor, the LDL receptor. Native, acetylated, and oxidized LDL all down-regulate this receptor (Fig. 5), as would be expected, because of its sterol response element (32Brown M. Goldstein J. Science. 1986; 232: 34-47Crossref PubMed Scopus (4383) Google Scholar). To determine if CD36 induction resulted from uptake of component lipids of the lipoproteins or binding of apoB 100, we evaluated the effects of the components of LDL on the expression of CD36 mRNA. Macrophages were treated with apoB 100 (1 μg/ml) or unilamellar phospholipid/cholesterol liposomes (150 μg/ml) or a combination of both for 20 h. As seen in Fig. 6, apoB either alone or in combination with liposomes induced CD36 mRNA expression remarkably (>4-fold). Phospholipid/cholesterol liposomes alone had a less significant effect (∼2-fold). Incubation with 25-hydroxycholesterol or cholesterol caused a similar increase of CD36 expression to that by liposomes; however, results were difficult to interpret because of the inhibitory effects of ethanol in which they were dissolved (data not shown). Since addition of lipoproteins to macrophages induced CD36 mRNA, we next evaluated the effect of cholesterol acceptors on CD36 expression. Both HDL and BSA can act as cholesterol acceptors and facilitate the efflux of cholesterol from cultured cells (33Phillips M. McClean L. Stoudt G. Rothblat G. Atherosclerosis. 1980; 36: 409-422Abstract Full Text PDF Scopus (79) Google Scholar). We demonstrate in Fig. 7 that incubation of macrophages with BSA (0.5–5%) causes a dose-dependent reduction in the expression of CD36 mRNA. HDL at a concentration of 25–50 μg/ml had a similar effect (data not shown). To exclude the possibility that the inhibitory effects of BSA or HDL on expression of CD36 mRNA might be due to a contaminating endotoxin (LPS), two experiments were performed. First, experiments were performed with certified endotoxin free (<0.1 ng/mg) BSA with similar results. Second, macrophages were treated with a broad range concentration of LPS (0.1–20 μg/ml). LPS had no effect on CD36 mRNA expression. To investigate if the induction of CD36 in vitrocould be mimicked in an in vivo system and in primary (i.e. non-cell line) cells, mice were injected intraperitoneally with lipoproteins. Four mice were injected with either 1 ml of PBS (control) or lipoproteins (LDL, AcLDL, or OxLDL, 200 μg/ml) in PBS. Peritoneal macrophages were collected by lavage, centrifuged, and plated in Petri dishes for 30 min at 37 °C. After removal of non-adherent cells, RNA was isolated from adherent macrophages. Whereas LDL and AcLDL treatment modestly increased CD36 expression by 2- and 3-fold, respectively, OxLDL increased CD36 expression by 8-fold relative to macrophages isolated from control (PBS-treated) mice (Fig. 8). Scavenger receptors are a family of cell surface receptors expressed by macrophages that are believed to mediate the binding and uptake of modified lipids in atherosclerotic lesions. Therefore, regulation of scavenger receptor expression is thought to be a critical determinant of lipid accumulation at these sites. Cytokines produced by cells comprising the atheroma (macrophages, endothelial cells, smooth muscle cells, and lymphocytes) modulate macrophage scavenger receptor expression in vitro and are thought to participate in modulating expression in vivo. Although the role of lipid accumulation on expression of class A scavenger receptors has been evaluated in one study (34Geng Y. Kodama T. Hansson G. Arterioscler. Thromb. 1994; 14: 798-806Crossref PubMed Google Scholar), their effect on the expression on CD36, a class B scavenger receptor, has not been addressed. The LDL receptor, which contains a sterol regulatory element in the 5′ region of the gene, is down-regulated by high intracellular cholesterol levels and for this reason is not likely to be involved in the foam cell development (35Dawson P.A. Hofmann S.L. van der Westhuyzen D.R. Sudhof T.C. Brown M.S. Goldstein J.L. J. Biol. Chem. 1988; 263: 3372-3379Abstract Full Text PDF PubMed Google Scholar). However, scavenger receptors, which do not contain sterol regulatory elements, are constitutively expressed in the presence of high intracellular cholesterol/cholesteryl ester levels. Expression of the class A (type I/II) scavenger receptor was shown to be increased in macrophages and macrophage-derived foam cells relative to freshly isolated monocytes, but expression of the receptor in foam cells was equivalent to differentiated macrophages (34Geng Y. Kodama T. Hansson G. Arterioscler. Thromb. 1994; 14: 798-806Crossref PubMed Google Scholar). In addition, expression of the class A scavenger receptor is increased in monocytes from hyperlipidemic patients (36Villanova J.G. Lucenda J. Arcas N. Engel A. Biochim. Biophys. Acta. 1996; 1300: 135-141Crossref PubMed Scopus (13) Google Scholar). To the best of our knowledge, this is the first demonstration of increased macrophage CD36 expression by exposure to lipoproteins. These findings are important since they demonstrate for the first time that a macrophage scavenger receptor can be up-regulated by both native and modified lipoproteins. CD36 expression is increased in murine heart tissue in mice fed a high fat diet (37Greenwalt D. Scheck S. Rhinehart-Jones T. J. Clin. Invest. 1995; 96: 1380-1388Crossref Scopus (160) Google Scholar). Immunohistochemical evaluation of heart tissue demonstrated that CD36 expression was limited to microvascular endothelial cells. In monocytes, CD36 expression is increased by M-CSF, phorbol 12-myristate 13-acetate, interleukin-4 (25Yesner L. Huh H. Pearce S.F.A. Silverstein R. Arterioscler. Thromb. 1996; 16: 1019-1025Crossref Scopus (151) Google Scholar,38Huh H.-Y. Pearce S.F.A. Yesner L. Silverstein R.L. Blood. 1996; 87: 2020-2028Crossref PubMed Google Scholar), and adhesion to tumor necrosis factor-activated endothelium (26Huh H.Y. Lo S.K. Yesner L.M. Silverstein R.L. J. Biol. Chem. 1995; 270: 6267-6271Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar) and is reduced by treatment with LPS (25Yesner L. Huh H. Pearce S.F.A. Silverstein R. Arterioscler. Thromb. 1996; 16: 1019-1025Crossref Scopus (151) Google Scholar). For this reason, it is unlikely that our results can be explained by LPS (endotoxin) contamination of our lipoproteins. Lipoproteins (particularly minimally modified LDL and oxidized LDL) can modulate signal transduction and gene expression in macrophages and other cells (39Lusis A.J. Navab M. Biochem. Pharmacol. 1993; 46: 2119-2126Crossref PubMed Scopus (53) Google Scholar). LDL stimulates phosphoinositide turnover and elevates cytosolic calcium levels in vascular smooth muscle cells (40Bochkov V.N. Tkachuk V.A. Hahn A.W.A. Bernhardt J. Buhler F.R. Resink T.J. Arterioscler. Thromb. 1993; 13: 1261-1269Crossref PubMed Google Scholar). Minimally modified LDL induces the expression of monocyte adhesion molecules (41Berliner J. Territo M. Sevanian A. Ramin S. Kim J. Bamshad B. Esterson M. Fogelman A. J. Clin. Invest. 1990; 85: 1260-1266Crossref PubMed Scopus (769) Google Scholar), tissue factor (42Fei H.H. Berliner J.A. Parhami F. Drake T.A. Arterioscler. Thromb. 1993; 13: 1711-1717Crossref PubMed Google Scholar), MCP-1 (monocyte chemoattractant protein-1) (43Cushing S. Berliner J. Valente A. Territo M. Navab M. Parhami F. Gerrity R. Schwartz C. Fogelman A. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 5134-5138Crossref PubMed Scopus (977) Google Scholar), and M-CSF (44Parhami F. Fang Z.T. Fogelman A.M. Andalibi A. Territo M.C. Berliner J.A. J. Clin. Invest. 1993; 92: 471-478Crossref PubMed Scopus (207) Google Scholar) in endothelial cells. Induction of MCP-1 and M-CSF is cyclic AMP dependent (44Parhami F. Fang Z.T. Fogelman A.M. Andalibi A. Territo M.C. Berliner J.A. J. Clin. Invest. 1993; 92: 471-478Crossref PubMed Scopus (207) Google Scholar). Oxidized LDL induces expression of interleukin-8 in monocytes (45Terkeltaub R. Banka C.L. Solan J. Santoro D. Brand K. Curtiss L.K. Arterioscler. Thromb. 1994; 14: 47-53Crossref PubMed Google Scholar). Some of the effects of modified LDL can be mimicked by its constituent lipids. For example, the mitogenic effects of oxidized LDL can be mimicked by lysophosphatidylcholine (46Sakai M. Miyazaki A. Hakamata H. Sasaki T. Yui S. Yamazaki M. Shichiri M. Horiuchi S. J. Biol. Chem. 1994; 269: 31430-31435Abstract Full Text PDF PubMed Google Scholar), and oxidized phospholipid appears to be the lipid constituent in oxidized LDL that induces endothelial cell expression of MCP-1 (47Watson A. Navab M. Hama S. Sevanian A. Prescott S. Stafforini D. McIntyre T. Du B. Fogelman A. Berliner J. J. Clin. Invest. 1995; 95: 774-782Crossref PubMed Google Scholar) and adhesion molecules (48Kume N. Cybulsky M. Gimbrone M. J. Clin. Invest. 1992; 90: 1138-1144Crossref PubMed Scopus (724) Google Scholar). The effects of oxidized LDL on gene expression are gene- and stimulus-dependent (49Hamilton T. Major J. Chisolm G. J. Clin. Invest. 1995; 95: 2020-2027Crossref PubMed Scopus (54) Google Scholar). The mechanism(s) by which lipoproteins induce expression of CD36 remain unclear. Although apoB alone induced CD36 expression, it was not induced to the same degree by the intact lipoprotein. The slight induction of CD36 by phospholipid/cholesterol liposomes does not rule out cholesterol enrichment or delivery in mediating CD36 expression since the degree of uptake and alterations of cholesterol content were not verified. However, the dose dependent reduction of CD36 mRNA expression in response to BSA is consistent with the possibility that alterations in cellular cholesterol levels are modulating CD36 expression. Cholesterol has been shown to increase expression of macrophage apolipoprotein E (50Mazzone T. Basheeruddin K. Poulos C. J. Lipid Res. 1989; 30: 1055-1063Abstract Full Text PDF PubMed Google Scholar) and sterol carrier protein 2 (51Harai A. Kino T. Tokinagra K. Tahara K. Tamura Y. Yoshida S. J. Clin. Invest. 1994; 94: 2215-2223Crossref PubMed Scopus (35) Google Scholar). Cholesterol inhibits the expression of HMG-CoA reductase and the LDL receptor, which contains sterol response elements (35Dawson P.A. Hofmann S.L. van der Westhuyzen D.R. Sudhof T.C. Brown M.S. Goldstein J.L. J. Biol. Chem. 1988; 263: 3372-3379Abstract Full Text PDF PubMed Google Scholar). Alternatively, delivery of other bioactive lipids present in both native and modified lipoproteins may modulate expression of CD36. In support of this hypothesis, it has been shown that fatty acids can modulate CD36 expression. N-3 fatty acids (eicosapentaenoic acid and docosahexaenoic acid) inhibited CD36 expression in human monocytic cells while N-6 fatty acids (arachidonic acid and linoleic acid) tended to increase expression of CD36 (52Pietsch A. Weber C. Goretzki M. Weber P.C. Lorenz R.L. Cell Biochem. Funct. 1995; 13: 211-216Crossref PubMed Scopus (47) Google Scholar). Our results demonstrate that increased CD36 steady-state levels are not the result of alterations in message stability (Fig. 4) and therefore most likely involve increased transcription of CD36. Whether this is directly through a lipoprotein effect on the CD36 promoter or indirectly through the induction of other mediators or transcriptional factors is unknown. In this regard, it has been shown that oxidized lipoproteins can influence gene expression by causing oxidative stress and activating the transcription factor NF-κB (53Andalibi A. Liao F. Imes S. Fogelman A. Lusis A. Biochem. Soc. Trans. 1993; 21: 651-655Crossref PubMed Scopus (34) Google Scholar). The promoter of the CD36 gene has been isolated and partially sequenced (54Armesilla A.L. Vega M.A. J. Biol. Chem. 1994; 269: 18985-18991Abstract Full Text PDF PubMed Google Scholar, 55Armesilla A.L. Calvo D. Vega M.A. J. Biol. Chem. 1996; 271: 7781-7787Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar), but the role of NF-κB in the transcription of CD36 has not been determined. The relative role of CD36 and the type A scavenger receptors in terms of their contribution to lipid accumulation in the atherosclerotic lesion is undetermined. The use of knockout mice that lack the expression of these receptors may shed some light on the in vivo function of these scavenger receptors. A “natural knockout” gives some indication that CD36 is likely to be an important receptor for oxidized LDL in vivo. A genetic polymorphism in the CD36 gene has been identified in an Asian population (56Kashiwagi H. Tomiyama Y. Kosugi Y. Shiraga M. Lipsky R. Kanayama Y. Kurata Y. Matsuzawa Y. Blood. 1994; 83: 3545-3552Crossref PubMed Google Scholar) and shown to result in deficient expression of CD36 (NAKa- phenotype). Monocyte-derived macrophages isolated from these patients bound 40% less OxLDL and accumulated 40% less cholesterol ester than cells derived from normal controls (57Nozaki S. Kashiwagi H. Yamashita S. Nakagawa T. Kostner B. Tomiyama Y. Nakata A. Ishigami M. Miyagawa J. Kameda-Takemura K. Kurata Y. Matsuzawa Y. J. Clin. Invest. 1995; 96: 1859-1865Crossref PubMed Scopus (285) Google Scholar), further implicating CD36 as a physiological OxLDL receptor. In summary, we have shown for the first time that both native LDL and modified LDL (AcLDL and OxLDL) can up-regulate expression of the macrophage class B scavenger receptor, CD36. Our results imply that exposure to, or cellular accumulation of, free and esterified lipids may augment the expression of CD36 and further contribute to foam cell development in atherosclerosis." @default.
• W2022016504 created "2016-06-24" @default.
• W2022016504 creator A5007205089 @default.
• W2022016504 creator A5029645367 @default.
• W2022016504 creator A5061554211 @default.
• W2022016504 creator A5087206504 @default.
• W2022016504 date "1997-08-01" @default.
• W2022016504 modified "2023-09-27" @default.
• W2022016504 title "Native and Modified Low Density Lipoproteins Increase the Functional Expression of the Macrophage Class B Scavenger Receptor, CD36" @default.
• W2022016504 cites W104029063 @default.
• W2022016504 cites W1512516272 @default.
• W2022016504 cites W1529376098 @default.
• W2022016504 cites W1547338001 @default.
• W2022016504 cites W1558637003 @default.
• W2022016504 cites W1562774051 @default.
• W2022016504 cites W1566477377 @default.
• W2022016504 cites W1568755186 @default.
• W2022016504 cites W1574380753 @default.
• W2022016504 cites W1581806217 @default.
• W2022016504 cites W1596816338 @default.
• W2022016504 cites W1653408396 @default.
• W2022016504 cites W1775749144 @default.
• W2022016504 cites W1973979172 @default.
• W2022016504 cites W1977778060 @default.
• W2022016504 cites W1985170971 @default.
• W2022016504 cites W1992348370 @default.
• W2022016504 cites W2004657626 @default.
• W2022016504 cites W2005175065 @default.
• W2022016504 cites W2006738360 @default.
• W2022016504 cites W2024131238 @default.
• W2022016504 cites W2036852690 @default.
• W2022016504 cites W2037599912 @default.
• W2022016504 cites W2038484123 @default.
• W2022016504 cites W2040219415 @default.
• W2022016504 cites W2043713555 @default.
• W2022016504 cites W2046181597 @default.
• W2022016504 cites W2049401036 @default.
• W2022016504 cites W2050705339 @default.
• W2022016504 cites W2051048068 @default.
• W2022016504 cites W2051825180 @default.
• W2022016504 cites W2063813098 @default.
• W2022016504 cites W2065766518 @default.
• W2022016504 cites W2069558 @default.
• W2022016504 cites W2072764799 @default.
• W2022016504 cites W2080486016 @default.
• W2022016504 cites W2084744450 @default.
• W2022016504 cites W2093782393 @default.
• W2022016504 cites W2099992849 @default.
• W2022016504 cites W2107953123 @default.
• W2022016504 cites W2112807003 @default.
• W2022016504 cites W2113682801 @default.
• W2022016504 cites W2117864941 @default.
• W2022016504 cites W2119432184 @default.
• W2022016504 cites W2136572409 @default.
• W2022016504 cites W2146675158 @default.
• W2022016504 cites W2153041000 @default.
• W2022016504 cites W2161165626 @default.
• W2022016504 cites W2170564808 @default.
• W2022016504 cites W2326202471 @default.
• W2022016504 cites W2396195587 @default.
• W2022016504 cites W3139808032 @default.
• W2022016504 cites W317487423 @default.
• W2022016504 cites W4318972697 @default.
• W2022016504 cites W4376600567 @default.
• W2022016504 doi "https://doi.org/10.1074/jbc.272.34.21654" @default.
• W2022016504 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9261189" @default.
• W2022016504 hasPublicationYear "1997" @default.
• W2022016504 type Work @default.
• W2022016504 sameAs 2022016504 @default.
• W2022016504 citedByCount "254" @default.
• W2022016504 countsByYear W20220165042012 @default.
• W2022016504 countsByYear W20220165042013 @default.
• W2022016504 countsByYear W20220165042014 @default.
• W2022016504 countsByYear W20220165042015 @default.
• W2022016504 countsByYear W20220165042016 @default.
• W2022016504 countsByYear W20220165042017 @default.
• W2022016504 countsByYear W20220165042018 @default.
• W2022016504 countsByYear W20220165042019 @default.
• W2022016504 countsByYear W20220165042020 @default.
• W2022016504 countsByYear W20220165042021 @default.
• W2022016504 countsByYear W20220165042022 @default.
• W2022016504 crossrefType "journal-article" @default.
• W2022016504 hasAuthorship W2022016504A5007205089 @default.
• W2022016504 hasAuthorship W2022016504A5029645367 @default.
• W2022016504 hasAuthorship W2022016504A5061554211 @default.
• W2022016504 hasAuthorship W2022016504A5087206504 @default.
• W2022016504 hasBestOaLocation W20220165041 @default.
• W2022016504 hasConcept C139066938 @default.
• W2022016504 hasConcept C170493617 @default.
• W2022016504 hasConcept C185592680 @default.
• W2022016504 hasConcept C202751555 @default.
• W2022016504 hasConcept C2778163477 @default.
• W2022016504 hasConcept C2779244956 @default.
• W2022016504 hasConcept C2779828298 @default.
• W2022016504 hasConcept C2780072125 @default.
• W2022016504 hasConcept C41443022 @default.
• W2022016504 hasConcept C55493867 @default.
• W2022016504 hasConcept C56783068 @default.

• next