FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022075894> ?p ?o ?g. }

• W2022075894 endingPage "34831" @default.
• W2022075894 startingPage "34823" @default.
• W2022075894 abstract "The distribution of folates in plant cells suggests a complex traffic of the vitamin between the organelles and the cytosol. The Arabidopsis thaliana protein AtFOLT1 encoded by the At5g66380 gene is the closest homolog of the mitochondrial folate transporters (MFTs) characterized in mammalian cells. AtFOLT1 belongs to the mitochondrial carrier family, but GFP-tagging experiments and Western blot analyses indicated that it is targeted to the envelope of chloroplasts. By using the glycine auxotroph Chinese hamster ovary glyB cell line, which lacks a functional MFT and is deficient in folates transport into mitochondria, we showed by complementation that AtFOLT1 functions as a folate transporter in a hamster background. Indeed, stable transfectants bearing the AtFOLT1 cDNA have enhanced levels of folates in mitochondria and can support growth in glycine-free medium. Also, the expression of AtFOLT1 in Escherichia coli allows bacterial cells to uptake exogenous folate. Disruption of the AtFOLT1 gene in Arabidopsis does not lead to phenotypic alterations in folate-sufficient or folate-deficient plants. Also, the atfolt1 null mutant contains wild-type levels of folates in chloroplasts and preserves the enzymatic capacity to catalyze folate-dependent reactions in this subcellular compartment. These findings suggest strongly that, despite many common features shared by chloroplasts and mitochondria from mammals regarding folate metabolism, the folate import mechanisms in these organelles are not equivalent: folate uptake by mammalian mitochondria is mediated by a unique transporter, whereas there are alternative routes for folate import into chloroplasts. The distribution of folates in plant cells suggests a complex traffic of the vitamin between the organelles and the cytosol. The Arabidopsis thaliana protein AtFOLT1 encoded by the At5g66380 gene is the closest homolog of the mitochondrial folate transporters (MFTs) characterized in mammalian cells. AtFOLT1 belongs to the mitochondrial carrier family, but GFP-tagging experiments and Western blot analyses indicated that it is targeted to the envelope of chloroplasts. By using the glycine auxotroph Chinese hamster ovary glyB cell line, which lacks a functional MFT and is deficient in folates transport into mitochondria, we showed by complementation that AtFOLT1 functions as a folate transporter in a hamster background. Indeed, stable transfectants bearing the AtFOLT1 cDNA have enhanced levels of folates in mitochondria and can support growth in glycine-free medium. Also, the expression of AtFOLT1 in Escherichia coli allows bacterial cells to uptake exogenous folate. Disruption of the AtFOLT1 gene in Arabidopsis does not lead to phenotypic alterations in folate-sufficient or folate-deficient plants. Also, the atfolt1 null mutant contains wild-type levels of folates in chloroplasts and preserves the enzymatic capacity to catalyze folate-dependent reactions in this subcellular compartment. These findings suggest strongly that, despite many common features shared by chloroplasts and mitochondria from mammals regarding folate metabolism, the folate import mechanisms in these organelles are not equivalent: folate uptake by mammalian mitochondria is mediated by a unique transporter, whereas there are alternative routes for folate import into chloroplasts. Tetrahydrofolate (THF) 5The abbreviations used are: THF, tetrahydrofolate; MFT, mitochondrial folate transporter; MTX, methotrexate; GFP, green fluorescent protein; IPTG, isopropyl 1-thio-β-d-galactopyranoside; T-DNA, transferred DNA; RT, reverse transcription; HsMFT, human MFT; CHO, Chinese hamster ovary. and its one-carbon-substituted derivatives (collectively termed folates) are involved in key metabolic functions, including the synthesis of methionine, pantothenate, purines, and thymidylate (1Hanson A.D. Roje S. Annu. Rev. Plant Physiol. Plant Mol. Biol. 2001; 52: 119-137Crossref PubMed Scopus (356) Google Scholar). Plants and most microorganisms can synthesize THF de novo, whereas mammals cannot and so require a dietary supply of this soluble vitamin. The plant THF biosynthesis has a unique and complex subcellular compartmentation split between three compartments (Fig. 1) (2Ravanel S. Douce R. Rebeille F. Day D.A. Millar A.H. Whelam J. Advances in Photosynthesis and Respiration. Plant Mitochondria, from Genome to Function. 17. Kluwer Academic Publishers, Dordrecht, The Netherlands2004: 277-292Google Scholar). Folates are tripartite molecules comprising a pterin moiety, a p-aminobenzoate unit, and a γ-linked glutamate chain with one to eight residues. p-Aminobenzoate is formed from chorismate in plastids (3Basset G.J. Quinlivan E.P. Ravanel S. Rebeille F. Nichols B.P. Shinozaki K. Seki M. Adams-Phillips L.C. Giovannoni J.J. Gregory 3rd, J.F. Hanson A.D. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1496-1501Crossref PubMed Scopus (104) Google Scholar, 4Basset G.J. Ravanel S. Quinlivan E.P. White R. Giovannoni J.J. Rébeillé F. Nichols B.P. Shinozaki K. Seki M. Gregory 3rd, J.F. Hanson A.D. Plant J. 2004; 40: 453-461Crossref PubMed Scopus (71) Google Scholar), the pterin moiety from GTP in the cytosol (5Basset G. Quinlivan E.P. Ziemak M.J. Diaz De La Garza R. Fischer M. Schiffmann S. Bacher A. Gregory 3rd, J.F. Hanson A.D. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 12489-12494Crossref PubMed Scopus (80) Google Scholar, 6Goyer A. Illarionova V. Roje S. Fischer M. Bacher A. Hanson A.D. Plant Physiol. 2004; 135: 103-111Crossref PubMed Scopus (35) Google Scholar), and the two are coupled together, glutamylated and reduced in the mitochondria (7Neuburger M. Rébeillé F. Jourdain A. Nakamura S. Douce R. J. Biol. Chem. 1996; 271: 9466-9472Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 8Rébeillé F. Macherel D. Mouillon J.M. Garin J. Douce R. EMBO J. 1997; 16: 947-957Crossref PubMed Scopus (101) Google Scholar, 9Ravanel S. Cherest H. Jabrin S. Grunwald D. Surdin-Kerjan Y. Douce R. Rébeillé F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 15360-15365Crossref PubMed Scopus (108) Google Scholar). The enzyme folylpolyglutamate synthetase that elongates the glutamate chain exists in the cytosol, mitochondria, and plastids (9Ravanel S. Cherest H. Jabrin S. Grunwald D. Surdin-Kerjan Y. Douce R. Rébeillé F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 15360-15365Crossref PubMed Scopus (108) Google Scholar). This distribution suggests a complex traffic of THF, most probably in a monoglutamate form, and its precursors between the organelles and the cytosol (Fig. 1). In addition to intracellular transports, in vivo studies in Arabidopsis (10Prabhu V. Chatson K.B. Lui H. Abrams G.D. King J. Plant Physiol. 1998; 116: 137-144Crossref PubMed Scopus (44) Google Scholar, 11Ishikawa T. Machida C. Yoshioka Y. Kitano H. Machida Y. Plant J. 2003; 33: 235-244Crossref PubMed Scopus (31) Google Scholar) have shown that plants are able to take up C1 derivatives of THF from the medium (Fig. 1). None of the proteins involved in these multiple transport steps has been characterized so far in plants. In folate-auxotroph organisms, transport systems involved in the cellular uptake of folates have been cloned and characterized. The reduced folate carriers and the folate receptors mediate separate routes for folates uptake into mammalian cells (for a review, see Ref. 12Matherly L.H. Goldman D.I. Vitam. Horm. 2003; 66: 403-456Crossref PubMed Scopus (332) Google Scholar). In the parasitic protozoa Leishmania, the folate-biopterin transporter family includes high affinity folate transporters and a biopterin/folate transporter that are involved in the uptake of folates and the antifolate drug methotrexate (MTX) (13Kundig C. Haimeur A. Legare D. Papadopoulou B. Ouellette M. EMBO J. 1999; 18: 2342-2351Crossref PubMed Scopus (90) Google Scholar, 14Richard D. Kundig C. Ouellette M. J. Biol. Chem. 2002; 277: 29460-29467Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 15Richard D. Leprohon P. Drummelsmith J. Ouellette M. J. Biol. Chem. 2004; 279: 54494-54501Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Following their uptake, folates are either converted to polyglutamates to promote their retention in the cytosol or transported to the organelles where they are polyglutamylated to minimize their diffusion (16Appling D.R. FASEB J. 1991; 5: 2645-2651Crossref PubMed Scopus (304) Google Scholar). The mitochondrial folate transporter (MFT) involved in the traffic of folates from the cytosol to the mitochondria has been cloned and functionally characterized in mammals (17Titus S.A. Moran R.G. J. Biol. Chem. 2000; 275: 36811-36817Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 18McCarthy E.A. Titus S.A. Taylor S.M. Jackson-Cook C. Moran R.G. J. Biol. Chem. 2004; 279: 33829-33836Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). A point mutation within this protein rendered mitochondria unable to accumulate folates and cells that are auxotrophic for glycine (17Titus S.A. Moran R.G. J. Biol. Chem. 2000; 275: 36811-36817Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 18McCarthy E.A. Titus S.A. Taylor S.M. Jackson-Cook C. Moran R.G. J. Biol. Chem. 2004; 279: 33829-33836Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). In animals, two multidrug resistance-associated proteins belonging to the ATP-binding cassette transporter superfamily are responsible for anti-folate detoxification (19Zeng H. Liu G. Rea P.A. Kruh G.D. Cancer Res. 2000; 60: 4779-4784PubMed Google Scholar, 20Zeng H. Chen Z.S. Belinsky M.G. Rea P.A. Kruh G.D. Cancer Res. 2001; 61: 7225-7232PubMed Google Scholar). These transporters catalyze a high capacity and low affinity transport of MTX and physiological folates, as well as a moderate-affinity and low capacity transport of several glutathione and glucuronate conjugates (19Zeng H. Liu G. Rea P.A. Kruh G.D. Cancer Res. 2000; 60: 4779-4784PubMed Google Scholar, 20Zeng H. Chen Z.S. Belinsky M.G. Rea P.A. Kruh G.D. Cancer Res. 2001; 61: 7225-7232PubMed Google Scholar). Recently, the plasma membrane ATP-binding cassette transporter AtMRP4 from Arabidopsis has been implicated in the regulation of light-induced stomatal opening (21Klein M. Geisler M. Suh S.J. Kolukisaoglu H.U. Azevedo L. Plaza S. Curtis M.D. Richter A. Weder B. Schulz B. Martinoia E. Plant J. 2004; 39: 219-236Crossref PubMed Scopus (129) Google Scholar). MTX, but not folates, was found to inhibit this process. The physiological significance of folates efflux across the plasma membrane and the link between this transport and guard cell regulation are still unclear. In the present work, we used a genomics-based approach to identify an Arabidopsis protein, called AtFOLT1, which is a homolog of the mammalian MFTs. Using GFP-tagging and Western blot analyses we showed that the AtFOLT1 protein is localized in the chloroplast envelope. To address whether AtFOLT1 was able to transport folates, Chinese hamster ovary glyB cells lacking a functional MFT were stably transfected with the AtFOLT1 cDNA. The AtFOLT1 protein could partially restore the mitochondrial pool of folates if expressed at sufficiently high levels and thus could complement the glycine auxotrophy demonstrated by glyB cells. Also, the expression of AtFOLT1 in Escherichia coli allows bacterial cells to uptake exogenous folic acid. These data indicate that AtFOLT1 functions as a folate transporter in two different heterologous expression systems. Disruption of the AtFOLT1 gene in Arabidopsis does not lead to any obvious phenotype when plants are grown under standard or folate-depleting conditions, and chloroplasts contain wild-type levels of folates and preserve their enzymatic capacity to catalyze THF-dependent reactions. These findings suggest strongly that, contrary to the unique MFT-mediated folate uptake system existing in mitochondria from mammals, there are alternative routes for import of folates into chloroplasts. Plant Growth Conditions—Wild-type and mutant Arabidopsis thaliana (ecotype Columbia, Col-0) plants were grown on soil in a growth chamber (22 °C, 60% air humidity, light intensity of 150 μE m-2 s-1, 16 h light/8 h dark). Seeds of the T-DNA insertion line SALK_005280 generated at the Salk Institute Genome Analysis Laboratory (22Alonso J.M. Stepanova A.N. Leisse T.J. Kim C.J. Chen H. Shinn P. Stevenson D.K. Zimmerman J. Barajas P. Cheuk R. Gadrinab C. Heller C. Jeske A. Koesema E. Meyers C.C. Parker H. Prednis L. Ansari Y. Choy N. Deen H. Geralt M. Hazari N. Hom E. Karnes M. Mulholland C. Ndubaku R. Schmidt I. Guzman P. Aguilar-Henonin L. Schmid M. Weigel D. Carter D.E. Marchand T. Risseeuw E. Brogden D. Zeko A. Crosby W.L. Berry C.C. Ecker J.R. Science. 2003; 301: 653-657Crossref PubMed Scopus (4153) Google Scholar) were obtained from the Arabidopsis Biological Resource Center. For selection of transformed plants and growth studies in controlled conditions, seeds were surface-sterilized and plated on the agar-solidified medium described in Ref. 23Estelle M.A. Somerville C. Mol. Gen. Genet. 1987; 206: 200-206Crossref Scopus (486) Google Scholar containing either kanamycin (50 μg/ml) or folate analogs (sulfanilamide or MTX, 10-9 to 2 × 10-4 m). Plates were kept at 4 °C in the dark for 4 days before being transferred to the growth chamber. A. thaliana (ecotype Columbia) cell suspension cultures were grown under continuous white light (40 μE m-2 s-1) at 23°C in Gamborg's B5 medium supplemented with 1 μm 2-naphthalene acetic acid and 1.5% (w/v) sucrose. cDNAs Cloning—The full-length cDNAs coding At5g66380 (AtFOLT1), At2g47490, and At1g25380 were obtained by PCR using a cDNA amplification library prepared from above-ground parts of 3-week-old A. thaliana (ecotype Wassilewskija) plants (9Ravanel S. Cherest H. Jabrin S. Grunwald D. Surdin-Kerjan Y. Douce R. Rébeillé F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 15360-15365Crossref PubMed Scopus (108) Google Scholar). PCR was done with the proofreading Pfu DNA polymerase (Promega) using the following primers: FT1-1, AGGATTCGTTGATGGCGGCG; FT1-2, GTGACAAGTCAACCGCGTGC; At2g47490-1, GGTGACGCGTTTCCTCAAGG; At2g47490-2, CCGGATTTAAAGTATAGAGCTTTG; At1g25380-1, CCCCCAATTGAGAGATTCTAGG; and At1g25380-2, ACGTAGTTGGAACATGGCATCG. The PCR products were subcloned into the pBluescriptII KS vector digested with SmaI and sequenced (GenomeExpress, Meylan, France). Localization of AtFOLT1:GFP—Plasmid p35Ω-sGFP(S65T) expressing an engineered version of the green fluorescent protein (GFP) under the control of the cauliflower mosaic virus 35S promoter (24Chiu W. Niwa Y. Zeng W. Hirano T. Kobayashi H. Sheen J. Curr. Biol. 1996; 6: 325-330Abstract Full Text Full Text PDF PubMed Scopus (1217) Google Scholar) was used for transient expression experiments in Arabidopsis protoplasts. The full-length AtFOLT1 sequence was amplified from pKS-AtFOLT1 by high fidelity PCR using Pfu DNA polymerase and primers FT1-GFP5′ (GTCGACTGATGGCGGCGTCGTGGC) and FT1-GFP3′ (CCATGGAATCTTTTGTTGTTGGATGCTG). The resulting fragment was digested with SalI and NcoI and inserted between the corresponding sites of p35Ω-sGFP(S65T). The resulting plasmid pGFP-AtFOLT1 and p35Ω-sGFP(S65T) were used to transform protoplasts prepared from a 4-day-old Arabidopsis cell suspension culture essentially as described in Ref. 25Abel S. Theologis A. Plant J. 1994; 5: 421-427Crossref PubMed Scopus (343) Google Scholar. GFP chimera bearing the transit peptide sequences of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase from Arabidopsis and dihydropterin pyrophosphokinase/dihydropteroate synthase from Pisum sativum were used as controls for the targeting of GFP to plastids and mitochondria, respectively (9Ravanel S. Cherest H. Jabrin S. Grunwald D. Surdin-Kerjan Y. Douce R. Rébeillé F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 15360-15365Crossref PubMed Scopus (108) Google Scholar). Samples were analyzed by confocal laser scanning microscopy using a Leica TCS-SP2 operating system as described (9Ravanel S. Cherest H. Jabrin S. Grunwald D. Surdin-Kerjan Y. Douce R. Rébeillé F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 15360-15365Crossref PubMed Scopus (108) Google Scholar). CaPO4-mediated Transfection of AtFOLT1 into glyB Cells—The full-length AtFOLT1 sequence was excised from pKS-AtFOLT1 with XbaI and HindIII and subcloned into the same sites of pcDNA3.1+ (Invitrogen). The resulting plasmid pcDNA-AtFOLT1 allows the expression of AtFOLT1 under the control of the human cytomegalovirus immediate-early promoter. CHO glyB cells maintained in α minimal essential medium (Invitrogen) were plated at a density of 2 × 105 cells/100-mm plate. The following day, plasmid (5 μg/plate) was mixed with 1 m CaCl2 and HEBS (19.2 mm HEPES, 135 mm NaCl, 5 mm KCl, 0.45 mm Na2PO4, and 10 mm dextrose) in a total volume of 1 ml/plate and added to the cells for 30 min at room temperature. Nine milliliters of media was added to each plate, and the cultures were incubated at 37 °C. Twenty-four h later, the cells were briefly shocked with Me2SO, the medium was changed, and the cells were allowed to recover for 48 h. Transfectants were selected in α minimal essential medium supplemented with 10% dialyzed fetal calf serum and 1 mg/ml of G418 with or without glycine in the medium. Cells were grown for 10 days and colonies were fixed, stained, and counted. Subcellular Distribution of Folates in glyB Transformants—Several colonies of glyB cells stably transfected with the AtFOLT1 construct were selected and expanded into cultures. Cultures were seeded at 6 × 106/175 cm2 in α minimal essential medium supplemented with dialyzed fetal calf serum and 0.3 μCi/ml [3H]folic acid (Moravek) for 48 h. Cells were then harvested by trypsinization and pelleted. The pellets were resuspended in 10 ml of phosphate-buffered saline (5% fetal calf serum), counted, and re-pelleted. The cells were homogenized in 0.25 m sucrose and 1 mm EDTA using a hand-held Dounce homogenizer, and the various subcellular fractions (nuclei and unbroken cells, mitochondria, and cytosol) were isolated by centrifugation as described previously (17Titus S.A. Moran R.G. J. Biol. Chem. 2000; 275: 36811-36817Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar). Radioactivity in the various fractions was determined by scintillation counting. Expression of AtFOLT1 in E. coli JM105 Cells—The AtFOLT1 coding sequence lacking the first six residues located before the first predicted transmembrane α-helix was amplified from pcDNA-AtFOLT1 by high fidelity PCR using Pfu DNA polymerase and primers FT1-pTrc5′ (GGAATTCCATATGGAAAATGCCACCGCCGGC) and FT1-pTrc3′ (ACGAGCTCCTAATCTTTTGTTGTTGGATGC). The resulting fragment was digested with EcoRI and SacI, and inserted between the corresponding sites of pTrc99A (Amersham Biosciences). The resulting plasmid pTrc-AtFOLT1 was introduced first in E. coli DH5α strain, the sequence was verified, and then the plasmid was added into E. coli JM105 strain. Independent transformants harboring pTrc-AtFOLT1 or the empty pTrc99A vector were grown in LB containing 100 μg/ml carbenicillin until A600 reached 0.3. Cells were collected by centrifugation, washed three times in 0.9% (w/v) NaCl, and diluted to A600 = 0.0015 in M9 minimal medium (26Sambrook J. Russell D.W. Molecular Cloning: A Laboratory Manual, 3rd. Ed.. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar) containing 0.4% (w/v) glucose, 10 μg/ml thiamine, 100 μg/ml carbenicillin, and 30 μm asulam. Folic acid (50 μm) and/or IPTG (1 mm) were added to this medium, and cells were allowed to grow at 37 °C. Bacterial growth was monitored by measuring A600. To analyze the expression of AtFOLT1 in JM105 cells, pTrc-At-FOLT1 and pTrc99A transformants were grown in LB medium until A600 was 0.6, at which point 1 mm IPTG was added. Incubation was continued at 37 °C, and cells were collected by centrifugation at different time intervals and then suspended in SDS-PAGE loading buffer. Total proteins from ∼2 × 108 cells were separated by SDS-PAGE and analyzed by Western blot using purified AtFOLT1 antibodies. Nucleic Acid Manipulations—For PCR analysis Arabidopsis genomic DNA was isolated as described in Ref. 27Doyle J.J. Doyle J.L. Focus. 1990; 12: 13-15Google Scholar and amplified using the Titanium™ TaqDNA polymerase (Clontech) and primer pairs specific for the AtFOLT1 gene (FT1-2 and FT1-5, CGACCTAGTACCAACGGAATCC) or the T-DNA insertion (RB1, GCTCATGATCAGATTGTCGTTTCCCGCCTT and LB1, GGCAATCAGCTGTTGCCCGTCTCACTGGTG). Amplicons were separated by 1.4% (w/v) agarose gel electrophoresis, purified, and sequenced. For Southern analysis, genomic DNA was digested, separated by 0.7% (w/v) agarose gel, and transferred to a Hybond-N+membrane (Amersham Biosciences). Hybridization was at 42 °C in 6× SSC, 5× Denhardt's solution, 50% (v/v) formamide, 0.5% (w/v) SDS, and 100 μg/ml herring sperm DNA. The 4.9-kb BglII fragment of the pROK2 vector corresponding to the entire T-DNA region (28Baulcombe D.C. Saunders G.R. Bevan M.W. Mayo M.A. Harrison B.D. Nature. 1986; 321: 446-449Crossref Scopus (196) Google Scholar) and the full-length AtFOLT1 cDNA were labeled with 32P using random primers and used as probes. For RT-PCR analysis, total RNA was isolated from leaves by using the RNeasy plant mini extraction kit (Qiagen). RNA (3 μg) was treated with DNase I, and first strand cDNA was synthesized with the ThermoScript RT-PCR system (Invitrogen). AtFOLT1 and actin2 (At5g09810) were amplified by PCR with the Titanium™ TaqDNA polymerase using specific primers: FT1-1 and FT1-11, CTGCCTCTAGCGTACCTCTGC; At5g09810-Fwd, ACATCGTTCTCAGTGGTGGTTC; and At5g09810-Rev, ACCTGACTCATCGTACTCACTC. Amplicons were then analyzed by 1.4% (w/v) agarose gel electrophoresis. Folates Measurements in Leaves and Chloroplasts—Folates were determined using the microbiological assay with Lactobacillus casei ATCC7469 (American Type Culture Collection) as described in Ref. 29Gambonnet B. Jabrin S. Ravanel S. Karan M. Douce R. Rébeillé F. J. Sci. Food Agric. 2001; 81: 835-841Crossref Scopus (64) Google Scholar. Leaves were harvested at different stages of development and ground to a fine powder in liquid nitrogen before extraction of folates. Chloroplasts from 3-week-old Arabidopsis rosettes were purified on Percoll gradients as described in Ref. 30Block M.A. Tewari A.K. Albrieux C. Marechal E. Joyard J. Eur. J. Biochem. 2002; 269: 240-248Crossref PubMed Scopus (69) Google Scholar. Intact chloroplasts were submitted to three freeze/thaw cycles to ensure complete lysis, and membranes were removed by centrifugation at 16,000 × g for 30 min at 4 °C. The supernatant was used for folates and protein measurements (31Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). Protein Extraction and Immunoblot Analysis—Soluble proteins from Arabidopsis leaves were extracted by grinding powdered samples in 50 mm Tris-HCl, pH 7.5, 10 mm β-mercaptoethanol, 5% (v/v) glycerol, 1 mm phenylmethylsulfonyl fluoride, and 1 mm aminocaproic acid. Samples were centrifuged at 130,000 × g for 20 min at 4 °C, and the supernatant was used as a source of soluble proteins. Total proteins were extracted in the above buffer containing 1% (w/v) SDS, incubated at 4 °C for 30 min, and centrifuged at 16,000 × g for 20 min at 4 °C. The supernatant was used as a source of total proteins. Intact Percoll-purified chloroplasts were lysed in the hypotonic protein extraction buffer described above and plastidial subfractions (envelope, thylakoids, and stroma) were separated by ultracentrifugation on a step gradient of sucrose as described in Ref. 32Ferro M. Salvi D. Brugiere S. Miras S. Kowalski S. Louwagie M. Garin J. Joyard J. Rolland N. Mol. Cell. Proteomics. 2003; 2: 325-345Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar. Proteins were resolved by SDS-PAGE and electroblotted to nitrocellulose membrane (BA85, Schleicher & Schuell). The blots were probed with primary antibodies raised against AtFOLT1, IEP45 (2-oxoglutarate/malate translocator, At5g12860 (37Emanuelsson O. Nielsen H. von Heijne G. Protein Sci. 1999; 8: 978-984Crossref PubMed Scopus (1555) Google Scholar)), light-harvesting complex proteins (P16 protein from Chlamydomonas reinhardtii (32Ferro M. Salvi D. Brugiere S. Miras S. Kowalski S. Louwagie M. Garin J. Joyard J. Rolland N. Mol. Cell. Proteomics. 2003; 2: 325-345Abstract Full Text Full Text PDF PubMed Scopus (381) Google Scholar)), chloroplastic folylpolyglutamate synthetase (9Ravanel S. Cherest H. Jabrin S. Grunwald D. Surdin-Kerjan Y. Douce R. Rébeillé F. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 15360-15365Crossref PubMed Scopus (108) Google Scholar), or methionine synthase (33Ravanel S. Block M.A. Rippert P. Jabrin S. Curien G. Rébeillé F. Douce R. J. Biol. Chem. 2004; 279: 22548-22557Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). The synthetic AtFOLT1 peptide RAKQRYARGRDDEK (residues 90-103) coupled to the carrier protein KLH was used to raise a rabbit polyclonal serum (Neosystem SA, Strasbourg, France). IgG were purified from the serum using a HiTrap NHS-activated HP column according to the manufacturer's instructions (Amersham Biosciences). Purified antibodies were further desalted in phosphate-buffered saline and concentrated using a Microsep 3K unit. Primary antibodies were detected by using a chemiluminescent detection system (ECL, Amersham Biosciences). Cloning of Mammalian MFT Homologs in Arabidopsis—We searched the Arabidopsis genome for genes encoding putative homologs of the human mitochondrial folate transporter (HsMFT) and found that all the candidates were hypothetical members of the mitochondrial carrier family. In silico analysis of the complete Arabidopsis genome has revealed 57 members in this family, of which only onefourth have been functionally characterized (34Palmieri F. Picault N. Palmieri L. Hodges M. Day D.A. Millar A.H. Whelam J. Advances in Photosynthesis and Respiration. Plant Mitochondria, from Genome to Function. 17. Kluwer Academic Publishers, Dordrecht, The Netherlands2004: 247-276Google Scholar). Among the best hits of our BLASTP search, the product of the At5g66380 gene shared the highest sequence identity with the human and zebrafish MFTs (40.9 and 36.8%, respectively) (Fig. 2). The corresponding cDNA (named AtFOLT1 for A. thaliana FOLate Transporter 1) was cloned by PCR using reverse-transcribed mRNAs from the Wassilewskija ecotype. Sequence analysis revealed nine nucleotide changes between the AtFOLT1 and At5g66380 cDNA (ecotype Columbia, GenBank™ accession number BT010139). Among these changes, only one leads to an altered amino acid at position 26 (Pro for AtFOLT1, Ser for At5g66380). It is unlikely that this point mutation affects the AtFOLT1 function because: (i) the full-length Arabidopsis (ecotype Columbia) cDNA sequenced by the CERES company (CERES:118596) also encodes for a Pro at position 26; (ii) a Pro residue is present at the same position on the human and zebrafish MFTs; and (iii) this Pro residue is included in one of the energy signature motifs characteristic of the mitochondrial carrier family (Fig. 2B), in which it is involved in the three-dimensional organization of the odd-numbered transmembrane helices (35Pebay-Peyroula E. Dahout-Gonzalez C. Kahn R. Trezeguet V. Lauquin G.J. Brandolin G. Nature. 2003; 426: 39-44Crossref PubMed Scopus (803) Google Scholar). The cDNAs coding the At2g47490 and At1g25380 proteins, which share 31-36% identity with HsMFT (Fig. 2), were also cloned by PCR. These cDNAs showed two and one polymorphic sites, respectively, compared with the corresponding sequences deposited in the Arabidopsis Information Resource data base (www.arabidopsis.org). Of these SNP, two resulted in silent substitutions for the At2g47490 cDNA, and one in a change from a Leu (position 84, Wassilewskija sequence) to Ser (Col-0 sequence) in the At1g25380 protein. AtFOLT1 is a 34-kDa protein that exhibits a hydrophobic profile with six putative transmembrane domains, a tripartite structure made up of related tandem domains of about 100 residues in length, and sequence motifs that are characteristic of the mitochondrial carrier family (34Palmieri F. Picault N. Palmieri L. Hodges M. Day D.A. Millar A.H. Whelam J. Advances in Photosynthesis and Respiration. Plant Mitochondria, from Genome to Function. 17. Kluwer Academic Publishers, Dordrecht, The Netherlands2004: 247-276Google Scholar). Sequence homology between AtFOLT1 and HsMFT extends throughout the entire proteins and several highly conserved blocks are preserved (Fig. 2B). They particularly correspond to the six putative transmembrane α-helices and the three domains located within pairs of odd- and even-numbered helices, which are predicted to extrude into the matrix side of the membrane (18McCarthy E.A. Titus S.A. Taylor S.M. Jackson-Cook C. Moran R.G. J. Biol. Chem. 2004; 279: 33829-33836Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 35Pebay-Peyroula E. Dahout-Gonzalez C. Kahn R. Trezeguet V. Lauquin G.J. Brandolin G. Nature. 2003; 426: 39-44Crossref PubMed Scopus (803) Google Scholar). Subcellular Localization of AtFOLT1—Not all of the members of the plant mitochondrial carrier family are actually targeted to mitochondria because the plastid envelope membrane harbors several transporters of this family (for a review see Ref. 36Weber A.P. Schwacke R. Flugge U.I. Annu. Rev. Plant Biol. 2005; 56: 133-164Crossref PubMed Scopus (159) Google Scholar). Analyses of the AtFOLT1 sequence using different programs failed to predict a subcellular location for this protein with a high probability. However, the prediction results from the ChloroP version 1.1 program (chloroplastic transit peptide: score" @default.
• W2022075894 created "2016-06-24" @default.
• W2022075894 creator A5005698274 @default.
• W2022075894 creator A5007782541 @default.
• W2022075894 creator A5009872907 @default.
• W2022075894 creator A5011356944 @default.
• W2022075894 creator A5032651935 @default.
• W2022075894 creator A5050693651 @default.
• W2022075894 creator A5054719614 @default.
• W2022075894 date "2005-10-01" @default.
• W2022075894 modified "2023-10-14" @default.
• W2022075894 title "Folate Metabolism in Plants" @default.
• W2022075894 cites W1508038146 @default.
• W2022075894 cites W1775749144 @default.
• W2022075894 cites W1788126413 @default.
• W2022075894 cites W1842284815 @default.
• W2022075894 cites W1970509239 @default.
• W2022075894 cites W1975195438 @default.
• W2022075894 cites W1987184389 @default.
• W2022075894 cites W1992089740 @default.
• W2022075894 cites W2004764415 @default.
• W2022075894 cites W2010916312 @default.
• W2022075894 cites W2019686818 @default.
• W2022075894 cites W2020971073 @default.
• W2022075894 cites W2025561511 @default.
• W2022075894 cites W2025681203 @default.
• W2022075894 cites W2041680957 @default.
• W2022075894 cites W2047030874 @default.
• W2022075894 cites W2047161343 @default.
• W2022075894 cites W2050829260 @default.
• W2022075894 cites W2055684244 @default.
• W2022075894 cites W2057116461 @default.
• W2022075894 cites W2070815578 @default.
• W2022075894 cites W2096451658 @default.
• W2022075894 cites W2098115340 @default.
• W2022075894 cites W2098998842 @default.
• W2022075894 cites W2101195019 @default.
• W2022075894 cites W2101259585 @default.
• W2022075894 cites W2102378099 @default.
• W2022075894 cites W2105370173 @default.
• W2022075894 cites W2109756752 @default.
• W2022075894 cites W2123016629 @default.
• W2022075894 cites W2125152239 @default.
• W2022075894 cites W2129095580 @default.
• W2022075894 cites W2135834023 @default.
• W2022075894 cites W2148996212 @default.
• W2022075894 cites W2150449715 @default.
• W2022075894 cites W2150689878 @default.
• W2022075894 cites W2154182251 @default.
• W2022075894 cites W2157547973 @default.
• W2022075894 doi "https://doi.org/10.1074/jbc.m506045200" @default.
• W2022075894 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16055441" @default.
• W2022075894 hasPublicationYear "2005" @default.
• W2022075894 type Work @default.
• W2022075894 sameAs 2022075894 @default.
• W2022075894 citedByCount "109" @default.
• W2022075894 countsByYear W20220758942012 @default.
• W2022075894 countsByYear W20220758942013 @default.
• W2022075894 countsByYear W20220758942014 @default.
• W2022075894 countsByYear W20220758942015 @default.
• W2022075894 countsByYear W20220758942016 @default.
• W2022075894 countsByYear W20220758942017 @default.
• W2022075894 countsByYear W20220758942018 @default.
• W2022075894 countsByYear W20220758942019 @default.
• W2022075894 countsByYear W20220758942020 @default.
• W2022075894 countsByYear W20220758942021 @default.
• W2022075894 countsByYear W20220758942022 @default.
• W2022075894 countsByYear W20220758942023 @default.
• W2022075894 crossrefType "journal-article" @default.
• W2022075894 hasAuthorship W2022075894A5005698274 @default.
• W2022075894 hasAuthorship W2022075894A5007782541 @default.
• W2022075894 hasAuthorship W2022075894A5009872907 @default.
• W2022075894 hasAuthorship W2022075894A5011356944 @default.
• W2022075894 hasAuthorship W2022075894A5032651935 @default.
• W2022075894 hasAuthorship W2022075894A5050693651 @default.
• W2022075894 hasAuthorship W2022075894A5054719614 @default.
• W2022075894 hasBestOaLocation W20220758941 @default.
• W2022075894 hasConcept C185592680 @default.
• W2022075894 hasConcept C55493867 @default.
• W2022075894 hasConcept C62231903 @default.
• W2022075894 hasConceptScore W2022075894C185592680 @default.
• W2022075894 hasConceptScore W2022075894C55493867 @default.
• W2022075894 hasConceptScore W2022075894C62231903 @default.
• W2022075894 hasIssue "41" @default.
• W2022075894 hasLocation W20220758941 @default.
• W2022075894 hasLocation W20220758942 @default.
• W2022075894 hasLocation W20220758943 @default.
• W2022075894 hasLocation W20220758944 @default.
• W2022075894 hasLocation W20220758945 @default.
• W2022075894 hasOpenAccess W2022075894 @default.
• W2022075894 hasPrimaryLocation W20220758941 @default.
• W2022075894 hasRelatedWork W1580828668 @default.
• W2022075894 hasRelatedWork W1588209866 @default.
• W2022075894 hasRelatedWork W1588865119 @default.
• W2022075894 hasRelatedWork W1590584272 @default.
• W2022075894 hasRelatedWork W2000016162 @default.
• W2022075894 hasRelatedWork W2005579623 @default.
• W2022075894 hasRelatedWork W2073046925 @default.

• next