FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022104041> ?p ?o ?g. }

• W2022104041 endingPage "32366" @default.
• W2022104041 startingPage "32360" @default.
• W2022104041 abstract "The H+(Na+)-translocating NADH-quinone (Q) oxidoreductase (NDH-1) of Escherichia coli is composed of 13 different subunits (NuoA-N). Subunit NuoA (ND3, Nqo7) is one of the seven membrane domain subunits that are considered to be involved in H+(Na+) translocation. We demonstrated that in the Paracoccus denitrificans NDH-1 subunit, Nqo7 (ND3) directly interacts with peripheral subunits Nqo6 (PSST) and Nqo4 (49 kDa) by using cross-linkers (Di Bernardo, S., and Yagi, T. (2001) FEBS Lett. 508, 385–388 and Kao, M.-C., Matsuno-Yagi, A., and Yagi, T. (2004) Biochemistry 43, 3750–3755). To investigate the structural and functional roles of conserved charged amino acid residues, a nuoA knock-out mutant and site-specific mutants K46A, E51A, D79N, D79A, E81Q, E81A, and D79N/E81Q were constructed by utilizing chromosomal DNA manipulation. In terms of immunochemical and NADH dehydrogenase activity-staining analyses, all site-specific mutants are similar to the wild type, suggesting that those NuoA site-specific mutations do not significantly affect the assembly of peripheral subunits in situ. In addition, site-specific mutants showed similar deamino-NADH-K3Fe(CN)6 reductase activity to the wild type. The K46A mutation scarcely inhibited deamino-NADH-Q reductase activity. In contrast, E51A, D79A, D79N, E81A, and E81Q mutation partially suppressed deamino-NADH-Q reductase activity to 30, 90, 40, 40, and 50%, respectively. The double mutant D79N/E81Q almost completely lost the energy-transducing NDH-1 activities but did not display any loss of deamino-NADH-K3Fe(CN)6 reductase activity. The possible functional roles of residues Asp-79 and Glu-81 were discussed. The H+(Na+)-translocating NADH-quinone (Q) oxidoreductase (NDH-1) of Escherichia coli is composed of 13 different subunits (NuoA-N). Subunit NuoA (ND3, Nqo7) is one of the seven membrane domain subunits that are considered to be involved in H+(Na+) translocation. We demonstrated that in the Paracoccus denitrificans NDH-1 subunit, Nqo7 (ND3) directly interacts with peripheral subunits Nqo6 (PSST) and Nqo4 (49 kDa) by using cross-linkers (Di Bernardo, S., and Yagi, T. (2001) FEBS Lett. 508, 385–388 and Kao, M.-C., Matsuno-Yagi, A., and Yagi, T. (2004) Biochemistry 43, 3750–3755). To investigate the structural and functional roles of conserved charged amino acid residues, a nuoA knock-out mutant and site-specific mutants K46A, E51A, D79N, D79A, E81Q, E81A, and D79N/E81Q were constructed by utilizing chromosomal DNA manipulation. In terms of immunochemical and NADH dehydrogenase activity-staining analyses, all site-specific mutants are similar to the wild type, suggesting that those NuoA site-specific mutations do not significantly affect the assembly of peripheral subunits in situ. In addition, site-specific mutants showed similar deamino-NADH-K3Fe(CN)6 reductase activity to the wild type. The K46A mutation scarcely inhibited deamino-NADH-Q reductase activity. In contrast, E51A, D79A, D79N, E81A, and E81Q mutation partially suppressed deamino-NADH-Q reductase activity to 30, 90, 40, 40, and 50%, respectively. The double mutant D79N/E81Q almost completely lost the energy-transducing NDH-1 activities but did not display any loss of deamino-NADH-K3Fe(CN)6 reductase activity. The possible functional roles of residues Asp-79 and Glu-81 were discussed. The bacterial H+(Na+)-translocating NADH-quinone oxidoreductase (NDH-1), 1The abbreviations used are: NDH-1, bacterial H+(Na+)-translocating NADH-quinone oxidoreductase; NDH-2, bacterial NADH-quinone oxidoreductase lacking the energy coupling site; DB, dimethoxy-5-methyl-6-decyl-1,4-benzoquinone; deamino-NADH, reduced nicotinamide hypoxanthine dinucleotide; Spc, spectinomycin; DCCD, N,N′dicyclohexylcarbodiimide; cap-40, capsaicin-40; Bistris, 2-[bis-(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; TM, transmembrane. also known as complex I in mitochondria, is a multiple subunit enzyme complex embedded in the cytoplasmic membrane (1Yagi T. Matsuno-Yagi A. Biochemistry. 2003; 42: 2266-2274Google Scholar). This enzyme represents the first step of the respiratory chain and links the electron transfer from NADH to quinone with the translocation of protons from the cytoplasmic phase to the periplasmic phase (1Yagi T. Matsuno-Yagi A. Biochemistry. 2003; 42: 2266-2274Google Scholar). The stoichiometry of H+/2e– is considered to be 4 (2Galkin A.S. Grivennikova V.G. Vinogradov A.D. FEBS Lett. 1999; 451: 157-161Google Scholar). The resulting membrane potential is utilized to drive energy required for processes like ATP synthesis or solute transport (3Anraku Y. Gennis R.B. Trends Biochem. Sci. 1987; 12: 262-266Google Scholar). Although mammalian mitochondrial complex I is composed of 46 unlike subunits (4Carroll J. Fearnley I.M. Shannon R.J. Hirst J. Walker J.E. Mol. Cell. Proteomics. 2003; 2: 117-126Google Scholar), bacterial counterparts contain 14 different subunits (designated Nqo1–14 for Paracoccus denitrificans and Thermus thermophilus and NuoA-N for Escherichia coli) 2For simplicity, the E. coli terminology was mainly used throughout this paper. Bovine naming was also used as needed for clarity. (5Friedrich T. Abelmann A. Brors B. Guénebaut V. Kintscher L. Leonard K. Rasmussen T. Scheide D. Schlitt A. Schulte U. Weiss H. Biochim. Biophys. Acta. 1998; 1365: 215-219Google Scholar, 6Yagi T. Yano T. Di Bernardo S. Matsuno-Yagi A. Biochim. Biophys. Acta. 1998; 1364: 125-133Google Scholar). The bacterial NDH-1 contains cofactors (one FMN and 8–9 iron-sulfur clusters) akin to complex I (7Takano S. Yano T. Yagi T. Biochemistry. 1996; 35: 9120-9127Google Scholar, 8Yano T. Yagi T. J. Biol. Chem. 1999; 274: 28606-28611Google Scholar). Topological studies suggest that the NDH-1 can be divided into two sectors, the peripheral segment and the membrane segment (9Di Bernardo S. Yagi T. FEBS Lett. 2001; 508: 385-388Google Scholar). The peripheral segment is composed of 7 subunits (NuoB, -C, -D, -E, -F, -G, and -I). In the case of the E. coli NDH-1, subunits NuoC (30 kDa) and -D (49 kDa) are fused and form NuoCD. Among these peripheral subunits, the NuoB (PSST) and NuoI (TYKY) subunits are recognized to act as connector subunits between the peripheral and membrane segments (9Di Bernardo S. Yagi T. FEBS Lett. 2001; 508: 385-388Google Scholar, 10Yano T. Magnitsky S. Sled′ V.D. Ohnishi T. Yagi T. J. Biol. Chem. 1999; 274: 28598-28605Google Scholar). The membrane segment also consists of seven subunits (NuoA, -H, and -J–N) (11Di Bernardo S. Yano T. Yagi T. Biochemistry. 2000; 39: 9411-9418Google Scholar, 12Kao M.-C. Di Bernardo S. Matsuno-Yagi A. Yagi T. Biochemistry. 2002; 41: 4377-4384Google Scholar, 13Kao M.-C. Di Bernardo S. Matsuno-Yagi A. Yagi T. Biochemistry. 2003; 42: 4534-4543Google Scholar), which are homologues of mtDNA-encoded subunits (ND1-6 and 4L) (14Chomyn A. Mariottini P. Cleeter M.W. Ragan C.I. Matsuno-Yagi A. Hatefi Y. Doolittle R.F. Attardi G. Nature. 1985; 314: 591-597Google Scholar, 15Chomyn A. Cleeter M.W. Ragan C.I. Riley M. Doolittle R.F. Attardi G. Science. 1986; 234: 614-618Google Scholar). The peripheral segment protrudes into the cytoplasmic phase and is believed to house all the known cofactors (1Yagi T. Matsuno-Yagi A. Biochemistry. 2003; 42: 2266-2274Google Scholar). In contrast, the membrane domain is most likely involved in H+ (or Na+) translocation and inhibitor and quinone binding (16Nakamaru-Ogiso E. Sakamoto K. Matsuno-Yagi A. Miyoshi H. Yagi T. Biochemistry. 2003; 42: 746-754Google Scholar, 17Gong X. Xie T. Yu L. Hesterberg M. Scheide D. Friedrich T. Yu C.A. J. Biol. Chem. 2003; 278: 25731-25737Google Scholar, 18Steuber J. J. Biol. Chem. 2003; 278: 26817-26822Google Scholar, 19Nakamaru-Ogiso E. Seo B.B. Yagi T. Matsuno-Yagi A. FEBS Lett. 2003; 549: 43-46Google Scholar). In recent years, complex I, in particular the mitochondrially encoded subunits, received much attention because of their involvement in many mitochondrial diseases (including sporadic Parkinson's disease) (20Robinson B.H. Biochim. Biophys. Acta. 1998; 1364: 271-286Google Scholar, 21Greenamyre J.T. Sherer T.B. Betarbet R. Panov A.V. IUBMB Life. 2001; 52: 135-141Google Scholar). It is known that point mutations of the ND1/nuoH, ND4/nuoM and ND6/nuoJ genes are associated with Leber's hereditary optic neuropathy and suppress the respiratory chain activity of complex I (22Majander A. Finel M. Savontaus M.L. Nikoskelainen E. Wikström M. Eur. J. Biochem. 1996; 239: 201-207Google Scholar, 23Carelli V. Ghelli A. Bucchi L. Montagna P. De Negri A. Leuzzi V. Carducci C. Lenaz G. Lugaresi E. Degli Esposti M. Ann. Neurol. 1999; 45: 320-328Google Scholar). Furthermore, it has been reported that the defects of the ND5/NuoL subunit are involved in mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes syndrome and other encephalomyelopathies (24Crimi M. Galbiati S. Moroni I. Bordoni A. Perini M.P. Lamantea E. Sciacco M. Zeviani M. Biunno I. Moggio M. Scarlato G. Comi G.P. Neurology. 2003; 60: 1857-1861Google Scholar). A single point mutation (T10191C, this mutation substitutes Pro for Ser-45, human numbering) of the ND3/NuoA subunit has been reported to substantially reduce the activity of complex I and to be associated with a progressive clinical picture of epilepsy, strokes, optic atrophy, and cognitive decline (25Taylor R.W. Singh-Kler R. Hayes C.M. Smith P.E. Turnbull D.M. Ann. Neurol. 2001; 50: 104-107Google Scholar). Recently, another point mutation (T10158C, this mutation replaces Ser-34 with Pro) of the ND3 subunit has been reported for infantile mitochondrial encephalopathy (26McFarland R. Kirby D.M. Fowler K.J. Ohtake A. Ryan M.T. Amor D.J. Fletcher J.M. Dixon J.W. Collins F.A. Turnbull D.M. Taylor R.W. Thorburn D.R. Ann. Neurol. 2004; 55: 58-64Google Scholar). Although these studies provided evidence for the important role of these hydrophobic subunits, it is clear that a more systematic investigation is required to identify the key residues in the mechanism of action of complex I/NDH-1. In a previous paper (11Di Bernardo S. Yano T. Yagi T. Biochemistry. 2000; 39: 9411-9418Google Scholar), we determined the topology of the Paracoccus NuoA subunit. The Paracoccus NuoA subunit is composed of three transmembrane segments (designated TM1–3 from the N to the C terminus), and its N- and C-terminal regions are directed toward the cytoplasmic and periplasmic phases of the membrane, respectively (11Di Bernardo S. Yano T. Yagi T. Biochemistry. 2000; 39: 9411-9418Google Scholar). The predicted topology places two highly conserved carboxyl residues (Asp-79 and Glu-81, E. coli numbering) in the middle of the TM2 (11Di Bernardo S. Yano T. Yagi T. Biochemistry. 2000; 39: 9411-9418Google Scholar). More recently, our cross-linking study revealed direct interactions between subunits NuoA and NuoB and between subunits NuoA and NuoD (9Di Bernardo S. Yagi T. FEBS Lett. 2001; 508: 385-388Google Scholar, 27Kao M.-C. Matsuno-Yagi A. Yagi T. Biochemistry. 2004; 43: 3750-3755Google Scholar). The NuoB subunit is considered to bear the center N2, which shows the highest midpoint redox potential values of all known cofactors in the NDH-1 (1Yagi T. Matsuno-Yagi A. Biochemistry. 2003; 42: 2266-2274Google Scholar, 6Yagi T. Yano T. Di Bernardo S. Matsuno-Yagi A. Biochim. Biophys. Acta. 1998; 1364: 125-133Google Scholar). Therefore, it was of interest to clarify structural and functional roles of these conserved and protonated residues in the NuoA subunit. For this purpose, we have constructed mutants of the residues of interest by using a gene manipulation technique of the E. coli chromosomal NDH-1 operon and characterized these mutants. Mutants E51A, D79A, D79N, E81A, and E81Q showed a partial decrease in the activities of deamino-NADH oxidase and deamino-NADH-dimethoxy-5-methyl-6-decyl-1,4-benzoquinone (DB) reductase but retained the deamino-NADH-K3Fe(CN)6 reductase activity comparable with the wild type. In addition, whereas the D79N/E81Q mutant is similar to the wild type in terms of both NADH dehydrogenase activity staining and immunochemical analyses of native gels, the energy-transducing NDH-1 activities of this double mutant were almost completely inactivated. Materials—The pCRScript Cloning kit was from Stratagene. The gene replacement vector, pKO3 was a generous gift from Dr. George M. Church (Harvard Medical School, Boston, MA). Materials for PCR product purification, gel extraction, and plasmid preparation were obtained from Qiagen (Valencia, CA). Site-specific mutants were constructed using the GeneEditor mutagenesis kit from Promega (Madison, WI). The BCA protein assay kit and SuperSignal West Pico chemiluminescent substrate were from Pierce. NADH, deamino-NADH, DB, chloramphenicol, and spectinomycin (Spc) were from Sigma. p-Nitroblue tetrazolium was from CalBiochem. Capsaicin 40 (cap-40) and pET(EcoNuoE) bearing the E. coli nuoE gene were kind gifts from Dr. Hideto Miyoshi (Kyoto University, Kyoto, Japan) and Dr. Judy Hirst (MRC, Cambridge, United Kingdom), respectively. Cloning and Mutagenesis of the E. coli nuoA Gene—The gene encoding the NuoA subunit together with a 1-kb DNA segment upstream and a 1-kb DNA segment downstream were cloned by PCR technology from E. coli DH5α. To generate the restriction sites SmaI/NotI and NotI/SalI the sense/antisense primers 5′-GGTACGCCCGGGAAATCCTGCGTTTTAATGATGAGG-3′ with 5′-ACCTCGCGCGGCCGCGACCGCCTAAAAACCGCC-3′ and 5′-TATCTGGCGGCCGCGTTCTTCGTTATCTTCGACGTTG-3′ with 5′-GTGTGCGTCGACGTTCGTCCATGCCGTGTAAGTC-3′, respectively, were used, where the underlined bases were altered from E. coli DNA, and the italicized bases represented the restriction site sequence. The spectinomycin-encoding gene from transposon Tn554 of Staphylococcus aureus (28Murphy E. Huwyler L. Freire Bastos M.C. EMBO J. 1985; 4: 3357-3365Google Scholar) was cloned by the PCR technology using the sense primer 5′-CGGGGGCGGCCGCTCAGTGGAACGAAAACTCACG-3′ and the antisense primer 5′-AAGGAGCGGCCGCTTTCTATTTTCAATAGTTAC-3′ both containing a NotI restriction site represented by italicized bases. The DNA fragments and the Spc cassette were cloned in pCRScript and finally assembled in pKO3. In the same way the sense primer 5′-GCATTCAAGATCTTGGTTACGCCAGGAAAATCC-3′, which contains a BglII restriction site (italicized), was used together with the NotI-generating antisense primer to produce a DNA fragment that was cloned in pCRScript. Then the sense primer 5′-CCATGAATCGATGTGGCGTCC-3′, which contains a ClaI restriction site (italicized) was used together with the SalI-generating antisense primer to produce a DNA fragment used for the generation of nuoA point mutants. The DNA inserted in the pCRscript cloning plasmid was mutagenized with the mutagenesis primers shown in Table I. These fragments were also assembled in pCRScript and then cloned into pKO3.Table IPrimers for introduction of a site-specific mutation into E. coli NuoA subunitMutationMutagenic primer sequenceaUnderline indicates mutation.NuoA(K46A)5′-CACGCGCGAGGTCGGCAAACGTGCCGTTTG-3′NuoA(E51A)5′-GTGCCGTTTGCATCCGGTATC-3′NuoA(D79A)5′-GTTATCTTCGCCGTTGAAGCG-3′NuoA(D79N)5′-CGTTATCTTCAACGTTGAAGC-3′NuoA(E81A)5′-GTTATCTTCGACGTTGCCGCGCTGTATCTGTTCG-3′NuoA(E81Q)5′-CTTCGACGTTCAAGCGCTGTA-3′NuoA(D79N + E81Q)5′-CGTTATCTTCAACGTTCAAGC-3′a Underline indicates mutation. Open table in a new tab The first step of site-specific mutation of the nuoA gene of the E. coli NDH-1 operon was to construct a nuoA gene knock-out mutant. For this purpose, we employed the pKO3 system developed by Church and co-workers (29Link A.J. Phillips D. Church G.M. J. Bacteriol. 1997; 179: 6228-6237Google Scholar). In brief, the pKO3 vector contains a repA(Ts) (temperature-sensitive replication origin), a chloramphenicol-resistant gene (cat), and a Bacillus subtilis sacB gene encoding levansucrase. The pKO3 carrying nuoA-knock-out DNA was prepared as follows (see Fig. 1, a and b). DNA fragments, SmaI/NotI (1467 bp) and NotI/SalI (1269 bp), were amplified from E. coli chromosomal DNA by PCR and individually inserted in cloning vector pCRScript at the SrfI site as a blunt end fragment. A PCR-amplified spc cassette carrying NotI sites (1200 bp) was also inserted at the SrfI site of pCRScript. The two DNA fragments and the spc cassette were assembled in pKO3. The resulting plasmid, pKO3(nuoA::spc), lacks 90 bp of the nuoA gene, which have been replaced by the spc cassette. The pKO3 vectors carrying mutated nuoA genes were prepared as shown in Fig. 1, c–e. The R and L fragments were cloned as blunt end fragments at the SrfI site in pCRScript. First, the R fragments of 1544 bp in which a SalI site was introduced at the 3′-end by the PCR amplification were cloned in pCRScript (designated pCRScript-R) (see Fig. 1, c). The pCRScript-R was used to generate the nuoA mutants. Then the L fragment of 1015 bp containing BglII and NotI sites at the 5′- and 3′-ends, respectively, was also cloned in pCRScript generating plasmid PCRScript-L (see Fig. 1, d). This plasmid was digested with HindIII/XhoI, blunted, and religated to remove a ClaI site in the multiple cloning site. The R fragments containing the mutations were isolated by ClaI and NotI (the latter is present in the multiple cloning site) and purified. The ClaI/NotI fragments were inserted into ClaI/NotI-cleaved pCRScript-L. The resulting plasmids were designated pCRScript-nuoA(mutants). Each DNA fragment containing nuoA mutations were then isolated by BglII/SalI digestion from the pCRScript constructs and transferred to integration plasmid pKO3 at the BamHI/SalI sites. The resulting plasmids are referred to as pKO3-nuoA (mutants) (see Fig. 1, e). Preparation of Knock-out and Mutant Cells—E. coli strain MC4100 (F–, araD139, Δ(arg F-lac)U169, ptsF25, relA1, flb5301, rpsL 150.λ–) was transformed with pKO3 (nuoA::Spc) plasmid, and recombination was carried out as described in Link et al. (29Link A.J. Phillips D. Church G.M. J. Bacteriol. 1997; 179: 6228-6237Google Scholar). In brief, several well isolated colonies from LB agar plates containing 20 μg/ml chloramphenicol and 100 μg/ml Spc, grown overnight at 30 °C, were transferred into 100 μl of LB and serially diluted. The dilutions corresponding to 104–106 were then plated on LB agar plates containing 20 μg/ml chloramphenicol and 100 μg/ml Spc, prewarmed at 43 °C and grown overnight. The next day again several colonies (typically 5) were transferred from the 43 °C plates into 100 μl of LB, serially diluted, and plated on LB agar plates containing 5% sucrose at 30 °C overnight. The surviving colonies were then replica-plated on LB agar plates containing 20 μg/ml chloramphenicol and on LB plates containing 100 μg/ml Spc and grown at 30 °C overnight. Colonies sensitive to chloramphenicol but resistant to Spc were used for the PCR amplification of the nuoA region using the 5′-oligonucleotide CTGAACATGGCATTCAAC (chro5′) and the 3′-oligonucleotide AAGGAGCGGCGGCTTTCTATTTTCAATAGTTAC (spc3′). The chro5′ oligonucleotide was designed to amplify DNA from within the E. coli chromosome and the spc3′ oligonucleotide from within the Spc cassette. In this way the presence of the Spc cassette and its location in the genomic DNA was confirmed. The knocked-out MC4100 cells where then stored as glycerol stocks at –80 °C. Knocked-out MC4100 competent cells were then employed to introduce nuoA mutated DNA in the E. coli genome using a similar procedure except that the identification of recombinants was carried out by screening for spectinomycin sensitivity in addition to chloramphenicol sensitivity. To confirm the presence of the mutations, the sense oligonucleotide chro5′ and the antisense oligonucleotide CATACGCTCGCGGCGTG (nuoA3′), which is located inside the nuoA gene, were used as primers for PCR amplification of the nuoA DNA fragments. The nuoA DNA fragments produced were subjected to direct sequencing. Antibody Production—Antibodies directed against a 12-amino-acid oligopeptide corresponding to the C-terminal region of the E. coli NuoA subunit was produced as follows. An oligopeptide H-CNPETNSIAN-RQR-OH was synthesized (designated NuoAc) and conjugated to maleimide-activated bovine serum albumin (Pierce) according to the manufacturer's protocol. It should be noted that, for the purpose of conjugation with bovine serum albumin, a cysteine residue was added to the N terminus. For raising antibodies specific to subunits NuoB, NuoE, NuoF, NuoG, and NuoI inclusion bodies of the overexpressed subunits were used as described previously (7Takano S. Yano T. Yagi T. Biochemistry. 1996; 35: 9120-9127Google Scholar). The antibodies were affinity-purified according to Han et al. (30Han A.-L. Yagi T. Hatefi Y. Arch. Biochem. Biophys. 1989; 275: 166-173Google Scholar). Cell Growth and Membrane Preparation—For the preparation of membranes suitable for enzymatic assays wild type, knock-out, and point mutants were grown in 250 ml of Terrific Broth medium until A600 was ∼2. The cells were then harvested in a GSA rotor at 6000 rpm for 10 min. The cell pellet was resuspended at 10% (w/v) in a buffer containing 10 mm Tris-HCl (pH 7.0), 1 mm EDTA, 1 mm dithiothreitol, 1 mm phenylmethanesulfonyl fluoride, and 15% (w/v) glycerol. The cell suspension was then passed once in a French press at 25,000 p.s.i. and centrifuged again in the GSA rotor at 12,000 rpm for 10 min. Cell debris was discarded, and the supernatant was then ultracentrifuged in a 70Ti rotor at 50,000 rpm for 30 min. The pellet was resuspended in the same buffer and was used immediately for enzymatic activity measurements. Gel Electrophoresis and Western Blot Analysis—To confirm the expression of the NDH-1 subunits Western blot experiments were carried out. Antibodies against the NuoAc and the peripheral subunits NuoE, NuoF, NuoG, and NuoI reacted with a 16-, a 20-, a 50-, a 91-, and a 21-kDa band of the E. coli membranes, respectively. Membranes were subjected to blue-native PAGE according to Schagger (31Schagger H. Methods Enzymol. 1995; 260: 190-202Google Scholar). Briefly, the cholate-treated E. coli membranes (800 μg of protein) were prepared as described previously (7Takano S. Yano T. Yagi T. Biochemistry. 1996; 35: 9120-9127Google Scholar) and resuspended in 40 μl of 750 mm aminocaproic acid, 50 mm Bistris-HCl (pH 7.0). Then, 8 μl of 10% dodecylmaltoside and 50 μg/ml DNase were added, and the preparation was left on ice for 1 h. After the incubation on ice the samples were centrifuged at 149,000 × g in a Beckman Airfuge for 5 min. The supernatant was recovered (∼40 μl), and 16 μl of 5% Coomassie Blue in 500 mm aminocaproic acid was added to the samples. The samples were then loaded on a 7% gel and run in the cold room at 75 V until the dye entered the separating gel. Subsequently the voltage was raised to 200 V, and the gel was run for another 3 h. After completion of the electrophoresis the gel was incubated in 2 mm Tris-HCl (pH 7.5) containing 150 μm NADH and 2.5 mg/ml p-nitroblue tetrazolium at 37 °C for 2 h in a shaking incubator. The reaction was stopped with 7% acetic acid. Enzymatic Assay—It is recognized that deamino-NADH can be catalyzed by NDH-1/complex I but not NDH-2 (32Matsushita K. Ohnishi T. Kaback H.R. Biochemistry. 1987; 26: 7732-7737Google Scholar). Therefore, in this study, deamino-NADH was used as a substrate. Deamino-NADH oxidase activity was spectrophotometrically assayed at 340 nm in 10 mm potassium phosphate (pH 7.0) containing 1 mm EDTA and 0.15 mm deamino-NADH at 37 °C as described (33Yagi T. Arch. Biochem. Biophys. 1986; 250: 302-311Google Scholar), using the E. coli membranes (80 μg of protein/ml). 10 μm cap-40 (34Satoh T. Miyoshi H. Sakamoto K. Iwamura H. Biochim. Biophys. Acta. 1996; 1273: 21-30Google Scholar) was used to inhibit the reaction. For the deamino-NADH-DB activity measurements, 10 mm KCN, 0.15 mm deamino-NADH, and 100 μm DB were routinely added to the assay mixture. Deamino-NADH-K3Fe(CN)6 reductase activity was assayed at 420 nm in the same buffer containing 10 mm KCN, 0.15 mm deamino-NADH, and 1 mm K3Fe(CN)6. The non-enzymatic activity of deamino-NADH-K3Fe(CN)6 reductase was subtracted from all measurements. The extinction coefficients used for activity calculations were ϵ340 = 6.22 mm–1 cm–1 for deamino-NADH and ϵ420 = 1.00 mm–1 cm–1 for K3Fe(CN)6. Other Analytical Procedures—Protein concentrations were estimated by the BCA protein assay kit with bovine serum albumin as the standard according to the manufacture's instruction. Any variations from the procedures and details are described in the figure legends. Strategy for Constructions of NuoA Mutants—The E. coli NDH-1 operon is predicted to be ∼15-kb long (35Yagi T. Di Bernardo S. Nakamaru-Ogiso E. Kao M.-C. Seo B.B. Matsuno-Yagi A. Zannoni D. Respiration in Archaea and Bacteria. Kluwer Publishings, Dordrecht2004: 15-40Google Scholar, 36Wackwitz B. Bongaerts J. Goodman S.D. Unden G. Mol. Gen. Genet. 1999; 262: 876-883Google Scholar). Because this length does not allow incorporation of the whole operon into expression vectors, a site-specific mutation is traditionally carried out by complementation of a cassette-inserted gene with a mutated gene in the expression plasmid (designated in trans complementation) (37Kurki S. Zickermann V. Kervinen M. Hassinen I. Finel M. Biochemistry. 2000; 39: 13496-13502Google Scholar, 38Amarneh B. Vik S.B. Biochemistry. 2003; 42: 4800-4808Google Scholar, 39Flemming D. Hellwig P. Friedrich T. J. Biol. Chem. 2002; 278: 3055-3062Google Scholar, 40Chevallet M. Dupuis A. Lunardi J. Van Belzen R. Albracht S.P.J. Issartel J.P. Eur. J. Biochem. 1997; 250: 451-458Google Scholar, 41Lunardi J. Darrouzet E. Dupuis A. Issartel J.P. Biochim. Biophys. Acta. 1998; 1407: 114-124Google Scholar, 42Flemming D. Schlitt A. Spehr V. Bischof T. Friedrich T. J. Biol. Chem. 2003; 278: 47602-47609Google Scholar, 43Kervinen M. Patsi J. Finel M. Hassinen I.E. Biochemistry. 2004; 43: 773-781Google Scholar). However, the in trans complementation procedure presents some problems when applied to a gene cluster. For example, the cassette inserted in chromosomal DNA might interrupt the expression of the downstream genes (44Falk-Krzesinski H. Wolfe A.J. J. Bacteriol. 1998; 180: 1174-1184Google Scholar). The only case that does not suffer this polar effect is when the mutated gene is at the last position in the operon (38Amarneh B. Vik S.B. Biochemistry. 2003; 42: 4800-4808Google Scholar). Another problem is that the mutated gene is under the control of a promoter in the expression plasmid, which often leads to overexpression of the mutated subunit. In mutation studies of the NDH-1 using the in trans complementation, it has been reported that the enzyme activities were significantly low (∼20% of the wild type cells) even when the unmutated gene was used (42Flemming D. Schlitt A. Spehr V. Bischof T. Friedrich T. J. Biol. Chem. 2003; 278: 47602-47609Google Scholar, 43Kervinen M. Patsi J. Finel M. Hassinen I.E. Biochemistry. 2004; 43: 773-781Google Scholar, 45Garofano A. Zwicker K. Kerscher S. Okun P. Brandt U. J. Biol. Chem. 2003; 278: 42435-42440Google Scholar). An alternative method of site-directed mutation is to introduce mutations directly in chromosomal DNA as detailed in this work (designated chromosomal DNA mutation, see Fig. 1) (29Link A.J. Phillips D. Church G.M. J. Bacteriol. 1997; 179: 6228-6237Google Scholar, 42Flemming D. Schlitt A. Spehr V. Bischof T. Friedrich T. J. Biol. Chem. 2003; 278: 47602-47609Google Scholar). In this procedure, expression of all genes of the operon are regulated by the authentic promoter. Although chromosomal DNA mutation is laborious and time-consuming, we adopted this technique to produce NuoA mutants to minimize any complications derived from disruption of the operon. As anticipated, the NDH1 was apparently expressed at the same level in all mutants as in the wild type (see below). Sequence Analysis of the NuoA Subunit—Fig. 2A is an amino acid sequence comparison between the E. coli NuoA subunit and its counterparts of various organisms. In terms of hydropathy plots, the E. coli NuoA subunit is akin to its counterpart of P. denitrificans. Fig. 2B is a hypothetical topology of the E. coli NuoA subunit deduced from topological studies of the P. denitrificans NuoA subunit (11Di Bernardo S. Yano T. Yagi T. Biochemistry. 2000; 39: 9411-9418Google Scholar). The E. coli NuoA subunit is predicted to contain the three transmembrane segments (designated TM1–3 from N to C terminus). The N- and C-terminal regions are also predicted to be directed toward the cytoplasmic and periplasmic phases of the membrane, respectively. In addition, a long loop (L1) between TM1 and TM2 is exposed to the periplasmic side. As far as our data base search is concerned (more than 250 organisms), Asp-79 (E. coli numbering) is conserved except for its homologues of Cyanidium caldarium mitochondria (Asp-79 → C, CAA88774) and Pseudomonas aeruginosa (Asp-79 → G, D83410). On the other hand, Glu-81 is perfectly conserved. Asp-79 and Glu-81 (E. coli numbering) seem to be located in the middle of the TM2. Carboxyl residues are rarely located in the middle of TM of the hydrophobic polypeptides. Therefore, it has been generally recognized that carboxyl residues present in the TM may play important roles in cation translocation of the membrane-associated enzyme complexes (46Sorgen P.L. Hu Y. Guan L. Kaback H.R. Girvin M.E. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 14037-14040Google Scholar, 47Kaback H.R. Sahin-Toth M. Weinglass A.B. Nat. Rev. Mol. Cell. Biol. 2001; 2: 610-620Google Scholar). One well known example is a perfectly conserved carboxyl residue in the center of a transmembrane helix of the N,N′-dicyclohexylcarbodiimide (DCCD)-binding protein (also called subunit c or proteolipid subunit) of the ATP synthase (48Zhang Y. Fillingame R.H. J. Biol. Chem. 1994; 269: 5473-5479Google Sc" @default.
• W2022104041 created "2016-06-24" @default.
• W2022104041 creator A5010100269 @default.
• W2022104041 creator A5020986127 @default.
• W2022104041 creator A5025435421 @default.
• W2022104041 creator A5026936772 @default.
• W2022104041 creator A5030605627 @default.
• W2022104041 creator A5080582789 @default.
• W2022104041 date "2004-07-01" @default.
• W2022104041 modified "2023-09-26" @default.
• W2022104041 title "Functional Roles of Four Conserved Charged Residues in the Membrane Domain Subunit NuoA of the Proton-translocating NADH-Quinone Oxidoreductase from Escherichia coli" @default.
• W2022104041 cites W1509159701 @default.
• W2022104041 cites W1570253404 @default.
• W2022104041 cites W1612433898 @default.
• W2022104041 cites W1964219210 @default.
• W2022104041 cites W1966614294 @default.
• W2022104041 cites W1970801714 @default.
• W2022104041 cites W1972066943 @default.
• W2022104041 cites W1979368553 @default.
• W2022104041 cites W198753092 @default.
• W2022104041 cites W1988312683 @default.
• W2022104041 cites W2000389514 @default.
• W2022104041 cites W2001063971 @default.
• W2022104041 cites W2002378144 @default.
• W2022104041 cites W2005238912 @default.
• W2022104041 cites W2006964441 @default.
• W2022104041 cites W2009310436 @default.
• W2022104041 cites W2022741948 @default.
• W2022104041 cites W2030716890 @default.
• W2022104041 cites W2033555996 @default.
• W2022104041 cites W2034429340 @default.
• W2022104041 cites W2035578240 @default.
• W2022104041 cites W2036074567 @default.
• W2022104041 cites W2039162492 @default.
• W2022104041 cites W2039957802 @default.
• W2022104041 cites W2041693710 @default.
• W2022104041 cites W2041850796 @default.
• W2022104041 cites W2043823094 @default.
• W2022104041 cites W2044417730 @default.
• W2022104041 cites W2053274745 @default.
• W2022104041 cites W2055906989 @default.
• W2022104041 cites W2057355720 @default.
• W2022104041 cites W2066430727 @default.
• W2022104041 cites W2067124266 @default.
• W2022104041 cites W2068754574 @default.
• W2022104041 cites W2074519937 @default.
• W2022104041 cites W2075137223 @default.
• W2022104041 cites W2076017764 @default.
• W2022104041 cites W2077170431 @default.
• W2022104041 cites W2079000030 @default.
• W2022104041 cites W2090567399 @default.
• W2022104041 cites W2091239190 @default.
• W2022104041 cites W2099001896 @default.
• W2022104041 cites W2099727979 @default.
• W2022104041 cites W2121147116 @default.
• W2022104041 cites W2122437957 @default.
• W2022104041 cites W2125957234 @default.
• W2022104041 cites W2137999969 @default.
• W2022104041 cites W2147354493 @default.
• W2022104041 cites W2148208867 @default.
• W2022104041 cites W2150937995 @default.
• W2022104041 cites W2154660868 @default.
• W2022104041 cites W2166193173 @default.
• W2022104041 cites W4235128066 @default.
• W2022104041 cites W4237825483 @default.
• W2022104041 doi "https://doi.org/10.1074/jbc.m403885200" @default.
• W2022104041 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15175326" @default.
• W2022104041 hasPublicationYear "2004" @default.
• W2022104041 type Work @default.
• W2022104041 sameAs 2022104041 @default.
• W2022104041 citedByCount "53" @default.
• W2022104041 countsByYear W20221040412012 @default.
• W2022104041 countsByYear W20221040412013 @default.
• W2022104041 countsByYear W20221040412014 @default.
• W2022104041 countsByYear W20221040412015 @default.
• W2022104041 countsByYear W20221040412016 @default.
• W2022104041 countsByYear W20221040412017 @default.
• W2022104041 countsByYear W20221040412018 @default.
• W2022104041 countsByYear W20221040412019 @default.
• W2022104041 countsByYear W20221040412020 @default.
• W2022104041 countsByYear W20221040412021 @default.
• W2022104041 countsByYear W20221040412022 @default.
• W2022104041 countsByYear W20221040412023 @default.
• W2022104041 crossrefType "journal-article" @default.
• W2022104041 hasAuthorship W2022104041A5010100269 @default.
• W2022104041 hasAuthorship W2022104041A5020986127 @default.
• W2022104041 hasAuthorship W2022104041A5025435421 @default.
• W2022104041 hasAuthorship W2022104041A5026936772 @default.
• W2022104041 hasAuthorship W2022104041A5030605627 @default.
• W2022104041 hasAuthorship W2022104041A5080582789 @default.
• W2022104041 hasBestOaLocation W20221040411 @default.
• W2022104041 hasConcept C104292427 @default.
• W2022104041 hasConcept C104317684 @default.
• W2022104041 hasConcept C112243037 @default.
• W2022104041 hasConcept C134306372 @default.
• W2022104041 hasConcept C171357686 @default.
• W2022104041 hasConcept C181199279 @default.
• W2022104041 hasConcept C185592680 @default.

• next