FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022233291> ?p ?o ?g. }

• W2022233291 endingPage "20242" @default.
• W2022233291 startingPage "20239" @default.
• W2022233291 abstract "In the search for physiological substrates of MAPK-activated protein (MAPKAP) kinases, we identified the basic helix-loop-helix (bHLH) transcription factor E47 as an interaction partner of chromosome 3p kinase (3pK) and MAPKAP-K2 (MK2). The E2A protein E47 is known to be involved in the regulation of tissue-specific gene expression and cell differentiation. E47 is a phosphoprotein, and we identified 3pK and MK2 as E47 kinases in vitro. Furthermore, the expression of either kinase results in a repression of the transcriptional activity of E47 on an E-box containing promoter. In summary, the MAPK-activated protein kinases 3pK and MK2 were identified to form an assembly with the bHLH protein E47 suggesting that these kinases are regulators of E47 activity and E47-dependent gene expression. In the search for physiological substrates of MAPK-activated protein (MAPKAP) kinases, we identified the basic helix-loop-helix (bHLH) transcription factor E47 as an interaction partner of chromosome 3p kinase (3pK) and MAPKAP-K2 (MK2). The E2A protein E47 is known to be involved in the regulation of tissue-specific gene expression and cell differentiation. E47 is a phosphoprotein, and we identified 3pK and MK2 as E47 kinases in vitro. Furthermore, the expression of either kinase results in a repression of the transcriptional activity of E47 on an E-box containing promoter. In summary, the MAPK-activated protein kinases 3pK and MK2 were identified to form an assembly with the bHLH protein E47 suggesting that these kinases are regulators of E47 activity and E47-dependent gene expression. chromosome 3p kinase mitogen-activated protein kinase MAPK-activated protein kinase 2 extracellular signal-regulated kinase MAPK/ERK kinase c-Jun NH2-terminal kinase/stress-activated protein kinase helix-loop-helix basic HLH protein small heat shock protein cAMP-responsive element binding factor serum response factor myocyte enhancer factor protein kinase A casein kinase II glutathione S-transferase green fluorescence protein fetal calf serum Triton-lysis buffer radioimmune precipitation buffer 2-(N-morpholino)ethanesulfonic acid 12-O-tetradecanoylphorbol-13-acetate β-galactosidase polyacrylamide gel electrophoresis four E-boxes Chromosome 3p kinase(3pK)1 (21.Sithanandam G. Latif F. Duh F.M. Bernal R. Smola U. Li H. Kuzmin I. Wixler V. Geil L. Shrestha S. Mol. Cell. Biol. 1996; 16: 868-876Crossref PubMed Scopus (86) Google Scholar) and MK2 belong to a family of serine/threonine kinases that are activated by members of the mitogen-activated protein kinase (MAPK) family. 3pK, also known as MAPKAP kinase 3 (1.McLaughlin M.M. Kumar S. McDonnell P.C. Van Horn S. Lee J.C. Livi G.P. Young P.R. J. Biol. Chem. 1996; 271: 8488-8492Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar) is unique in that it was shown to be activated by mitogenic inducers such as serum/TPA through the Raf/MEK/ERK cascade as well as by stress-inducing agents that are activators of stress-induced MAPK cascades, thereby leading to the phosphorylation of 3pK by either JNK/SAPK or p38 (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). Thus, the kinase is targeted by the corresponding cascade depending on the extracellular stimulus (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). Although the upstream activation pathways of 3pK are well documented, little is known about its downstream effectors. A close homologue of 3pK, MK2, is involved in stress response mediated through p38. Among the substrates of MK2 are the small heat shock proteins (Hsp27/25) (3.Rouse J. Cohen P. Trigon S. Morange M. Alonso-Llamazares A. Zamanillo D. Hunt T. Nebreda A.R. Cell. 1994; 78: 1027-1037Abstract Full Text PDF PubMed Scopus (1498) Google Scholar, 4.Engel K. Ahlers A. Brach M.A. Herrmann F. Gaestel M. J. Cell. Biochem. 1995; 57: 321-330Crossref PubMed Scopus (54) Google Scholar) and transcription factors such as CREB (5.Tan Y. Rouse J. Zhang A. Cariati S. Cohen P. Comb M.J. EMBO J. 1996; 15: 4629-4642Crossref PubMed Scopus (565) Google Scholar) and SRF (6.Heidenreich O. Neininger A. Schratt G. Zinck R. Cahill M.A. Engel K. Kotlyarov A. Kraft R. Kostka S. Gaestel M. Nordheim A. J. Biol. Chem. 1999; 274: 14434-14443Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar). The basic helix-loop-helix (bHLH) transcription factors E12 and E47 are encoded by the E2A gene and are generated by differential splicing of E12- and E47-specific bHLH-encoding exons (7.Murre C. McCaw P.S. Baltimore D. Cell. 1989; 56: 777-783Abstract Full Text PDF PubMed Scopus (1846) Google Scholar, 8.Sun X.H. Baltimore D. Cell. 1991; 64: 459-470Abstract Full Text PDF PubMed Scopus (317) Google Scholar). These E-proteins are characterized by their ability to bind to the consensus DNA sequence CANNTG, referred to as E-box, either as homodimers in B-cells or as heterodimers with tissue-specific Class II HLH proteins in other cell types (9.Murre C. McCaw P.S. Vaessin H. Caudy M. Jan L.Y. Jan Y.N. Cabrera C.V. Buskin J.N. Hauschka S.D. Lassar A.B. et al.Cell. 1989; 58: 537-544Abstract Full Text PDF PubMed Scopus (1298) Google Scholar, 10.Lassar A.B. Davis R.L. Wright W.E. Kadesch T. Murre C. Voronova A. Baltimore D. Weintraub H. Cell. 1991; 66: 305-315Abstract Full Text PDF PubMed Scopus (686) Google Scholar). Initially identified in B-cells as immunoglobulin enhancer-binding proteins, the E2A gene products classified as Class I HLH proteins are also involved in cell differentiation, lineage commitment, and the expression of many tissue-specific genes (11.Murre C. Bain G. van Dijk M.A. Engel I. Furnari B.A. Massari M.E. Matthews J.R. Quong M.W. Rivera R.R. Stuiver M.H. Biochim. Biophys. Acta. 1994; 1218: 129-135Crossref PubMed Scopus (407) Google Scholar). Through phosphorylation, DNA binding and transactivation of a variety of transcription factors are regulated (12.Karin M. Curr. Opin. Cell Biol. 1994; 6: 415-424Crossref PubMed Scopus (359) Google Scholar). For example, the dimerization of myogenin with E2A products was shown to enhance phosphorylation of myogenin, thereby reducing the transcriptional activity of myogenin, suggesting that phosphorylation of this myocyte enhancer factor (MEF) negatively interferes with muscle-specific gene expression (13.Zhou J. Olson E.N. Mol. Cell. Biol. 1994; 14: 6232-6243Crossref PubMed Scopus (30) Google Scholar). The DNA-binding activity of MyoD homodimers but not MyoD-E12 heterodimers was inhibited by phosphorylation (14.Mitsui K. Shirakata M. Paterson B.M. J. Biol. Chem. 1993; 268: 24415-24420Abstract Full Text PDF PubMed Google Scholar). Johnson et al. (16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar) demonstrated that overexpression of casein kinase II (CKII) increased the transcriptional activities of MRF4 and MyoD in vivo via a mechanism involving phosphorylation of its binding partner, E47. A direct effect of E47 phosphorylation was reported by Sloan et al. (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar), providing evidence that phosphorylation hinders binding of E47 homodimers but allows E47 heterodimer binding. This suggests a differential regulation of the E-protein in B-cellversus non-B-cell-specific gene regulation. E47 contains more than 100 potential phosphorylation sites and is known to be phosphorylated in many cell types. However, there is only limited information with regard to E47 kinases. So far, CKII and PKA have been described to phosphorylate E47 in vitro (16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar, 17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar, 18.Shen C.P. Kadesch T. Mol. Cell. Biol. 1995; 15: 4518-4524Crossref PubMed Scopus (160) Google Scholar). In the present study, we show that 3pK and MK2 interact with E47in vivo and are able to phosphorylate E47 in vitro. Furthermore, the expression of 3pK or MK2 results in repression of E47-induced transcriptional activity, suggesting a role for these kinases in the regulation of this transcription factor. Plasmids expressing 3pK wild type, the ATP-binding site mutant 3pK K73M (3pK KM), and the constitutively active mutant 3pK TT201/313EE (3pK TTEE) in bacteria and eukaryotic cells as a GST fusion protein were cloned as described recently (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). A GFP-tagged version of 3pK was cloned in the pRSPA vector background. A GFP-tagged version of MK2 was kindly provided by M. Gaestel (Halle, Germany). pcDNA3HA-3pK was generated by inserting theNheI-SpeI fragment of pPC97-3pK into pcDNA3HA. The BamHI insert of pGEX KG-3pK was ligated in the yeast two-hybrid vector pAS2.1 (CLONTECH) to produce pAS2.1-3pK KM. pGAD10-E47 (amino acids 1–494) was constructed by ligating the 5′ 1492-base pair NotI fragment of pGAD10-E47 into pGAD10. The 3′ 912-base pair XhoI fragment was inserted in pGAD10 to create pGAD10-E47 (amino acids 372–651). For pGAD10-E47 (amino acids 18–229), the original pGAD10-E47 was cut with SacI and religated. 5′-cgcgtacacctgctgcctcccaacacctgctgcctcccaacacctgctgcctcccaacacctgcc-3′ and 5′-tcgaggcaggtgttgggaggcagcaggtgttgggaggcagcaggtgttgggaggca gcaggtgat-3′ primers (E-boxes are underlined) containing four E-box sequences were annealed and cloned into the MluI andXhoI sites of the pGL3 promoter vector (Promega). The yeast two-hybrid screen was performed using a human heart MATCHMAKER cDNA library cloned into pGAD10 (CLONTECH). Yeast strain Y190 was manipulated according the MATCHMAKER Library User Manual (CLONTECH). A sequential transformation protocol was used with pAS2.1-3pK KM as bait. Positive clones were identified by growth on SD/−TRP/−LEU/−HIS/+25 mm3-amino-1,2,4-triazole (Sigma) plates and activity of thelacZ reporter gene in filter assays. DNA sequence analysis showed that 1 colony of 128 β-Gal-positive colonies contained a human full-length E47 cDNA. Direct two-hybrid tests with the interaction partner and pAS2.1-3pK KM were performed according to standard protocols. The human embryonic kidney cell line HEK293 and COS7 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal calf serum (FCS) at 37 °C in humidified air with 6% CO2. Production of rabbit anti-glutathioneS-transferase (GST) antiserum was described earlier (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). An anti-GST monoclonal antibody was kindly provided by S. Feller (Würzburg, Germany). Polyclonal rabbit anti-E47 IgG (sc-763 X) was purchased from Santa Cruz Biotechnology. HA-tagged proteins were detected with a monoclonal anti-HA antibody (12CA5). Cells were transfected by a calcium phosphate coprecipitation method according to a modified Stratagene protocol (2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar). HEK293 cells were starved in Dulbecco's modified Eagle's medium with 0.3% (v/v) FCS for 48 h after transfection. For activation of 3pK or MK2, HEK293 cells were stimulated with 0.5 mm sodiummeta-arsenite (Sigma) for 30 min prior to harvesting. Transfected HEK293 cells were lysed in Triton lysis buffer (TLB) (20 mm Tris, pH 7.4, 50 mm sodium β-glycerophosphate, 20 mm sodium pyrophosphate, 137 mm NaCl, 10% (v/v) glycerol, 1% (v/v) Triton X-100, 2 mm EDTA, and an inhibitor mix containing 1 mm Pefabloc, 1 mmsodium orthovanadate, 5 mm benzamidine, 5 μg/ml aprotinin, 5 μg/ml leupeptin) on ice for 10 min. Cell debris was removed by centrifugation, and supernatants were incubated with different antisera for 2 h at 4 °C. The immune complexes were precipitated with 25 μl of protein A-agarose and washed extensively with TLB. For in vitro coprecipitation experiments, 15 μg of recombinant GST-E47 were synthesized according to the manufacturer's manual (Amersham Pharmacia Biotech) and bound to glutathione-Sepharose 4B. These complexes were added to precleared TLB lysates (500 μg of total protein) of transfected or untransfected HEK293 cells, incubated for 6–12 h, and washed twice either with high salt TLB (0.5m NaCl) or with RIPA (25 mm Tris, pH 8, 137 mm NaCl, 10% (v/v) glycerol, 0.1% SDS, 0.5% sodium deoxycholate, 1% Nonidet P-40, 2 mm EDTA, pH 8, supplemented with inhibitors). After resuspension in Laemmli buffer and SDS-PAGE, proteins were detected by immunoblot. COS7 cells were fixed with 3.7% paraformaldehyde (in phosphate-buffered saline) for 20 min at room temperature, washed, and then incubated with ice cold acetone for 7 min at −20 °C. After being blocked with 10% FCS for 20 min at 37 °C, cells were incubated with either a mouse monoclonal antibody to GST or with the anti-E47 antiserum at 1 μg/ml for 30 min at 37 °C. Cells were washed and blocked again with FCS for 20 min at 37 °C. Cells were incubated with a Texas Red-labeled anti-rabbit IgG or a fluorescein isothiocyanate-labeled anti-mouse IgG antiserum in a 1:200 dilution (Dako) for 30 min at 37 °C, washed, and mounted with Moviol (Aldrich) in Glycerol/H20 supplemented with 2.5% diazabicyclo[2.2.2]octane (Merck). In vitro kinase assays with bacterially expressed 3pK and GST-E47 were performed with equal amounts (1.6 μg) of active 3pK or inactive 3pK and 10 μg Sepharose-bound GST-E47 as a substrate added to the kinase buffer (10 mm MgCl2, 25 mmβ-glycerophosphate, 25 mm HEPES, pH 7.5, 5 mmbenzamidine, 0.5 mm dithiothreitol, 1 mm sodium vanadate). Immunoprecipitated versions of tagged HA-3pK, HA-MK2, or E47 were combined and washed twice in RIPA buffer supplemented with 0.5m NaCl before being subjected to the kinase buffer. The kinase assays (30 min) were performed at 30 °C with 5 μCi of [γ32P]ATP (Amersham Pharmacia Biotech) and 0.1 mm ATP. 24 h after transfection, COS7 cells were harvested in 100 μl of lysis buffer (50 mm Na-MES, pH 7.8, 50 mm Tris-HCl, pH 7.8, 10 mmdithiothreitol, and 2% Triton X-100). 50 μl of precleared cell extracts were added to 50 μl of luciferase assay buffer (125 mm Na-MES, pH 7.8, 125 mm Tris-HCl, pH 7.8, 25 mm magnesium acetate, and 2 mg/ml ATP). Immediately after the injection of 50 μl of 1 mm D-luciferin (AppliChem), luminescence was measured for 5 s in a luminometer (Berthold). The luciferase activities were normalized on the β-galactosidase activity of cotransfected β-Gal vector. The β-galactosidase assay was performed with 20 μl of precleared cell lysate according to a standard protocol (19.Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1989Google Scholar). Mean values and standard deviations from three independent experiments are shown. To unravel the unknown physiological function of 3pK, we searched for binding partners in a yeast two-hybrid screen. The only in vitro and in vivo substrate for 3pK identified to date is the small heat shock protein Hsp27. Hsp27 phosphorylation may regulate actin filament dynamics, thought to be mediated by 3pK and MK2 (23.Huot J. Houle F. Rousseau S. Deschesnes R.G. Shah G.M. Landry J. J. Cell Biol. 1998; 143: 1361-1373Crossref PubMed Scopus (266) Google Scholar). Because both kinases are found in the nucleus of cells (Fig.2 B and Ref. 22.Engel K. Kotlyarov A. Gaestel M. EMBO J. 1998; 17: 3363-3371Crossref PubMed Scopus (236) Google Scholar), 3pK and MK2 may also have nuclear targets. Indeed, MK2 was shown to phosphorylate the nuclear transcription factors CREB as well as SRF (5.Tan Y. Rouse J. Zhang A. Cariati S. Cohen P. Comb M.J. EMBO J. 1996; 15: 4629-4642Crossref PubMed Scopus (565) Google Scholar, 6.Heidenreich O. Neininger A. Schratt G. Zinck R. Cahill M.A. Engel K. Kotlyarov A. Kraft R. Kostka S. Gaestel M. Nordheim A. J. Biol. Chem. 1999; 274: 14434-14443Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar) and to modulate their transcriptional activity. 3pK is also able to phosphorylate CREBin vitro and to interact with several nuclear proteins in vivo. 2B. Neufeld, S. Ludwig, and U. R. Rapp, unpublished data. We used a human heart cDNA library and a kinase inactive version of 3pK as a bait, because wild-type 3pK autonomously led to the transactivation of the reporter genes. It has recently been demonstrated that substitution of a lysine residue by methionine in the putative ATP-binding site of a kinase allows a more stable binding with its substrates, thus leading to a stronger transcriptional activation of the two-hybrid reporter gene (20.Zhou G. Bao Z.Q. Dixon J.E. J. Biol. Chem. 1995; 270: 12665-12669Abstract Full Text Full Text PDF PubMed Scopus (536) Google Scholar). In the two-hybrid screen, we found the full-length human basic helix-loop-helix transcription factor E47 to be a 3pK interaction partner (Fig.1). To narrow down the interacting domain of E47 that binds 3pK, we cloned several deletion mutants of E47 for direct two-hybrid tests (Fig. 1). Interestingly, deletion of 157 amino acids of the extreme C terminus including the acidic and the basic helix-loop-helix domain abolished the interaction, suggesting that this region is necessary for the binding of E47 to 3pK. The N-terminal deletion of amino acids 18–229 containing the first activation domain did not weaken the interaction, whereas a further N-terminal truncation of E47 up to amino acid 371 eliminated binding. This finding indicates that in addition to the loop-helix transactivation domain and the acidic domain located in the C-terminal half, an N-terminal region is also necessary for binding to 3pK. To confirm independently the 3pK-E47 two-hybrid interaction, we performed coimmunoprecipitation experiments as well as colocalization studies. Transfected E47 specifically coprecipitates with HA-3pK (Fig.2 A, lane 4), whereas no coprecipitated proteins were detectable in the control samples (Fig. 2 A, lanes 2 and 3). Fig. 2 B shows that GST- and GFP-tagged versions of 3pK and MK2 are located in the nucleus of transfected COS7 cells and GFP-tagged kinases colocalize with E47. It is noteworthy that neither GST nor GFP fusion affects kinase activity of 3pK (Ref. 2.Ludwig S. Engel K. Hoffmeyer A. Sithanandam G. Neufeld B. Palm D. Gaestel M. Rapp U.R. Mol. Cell. Biol. 1996; 16: 6687-6697Crossref PubMed Scopus (153) Google Scholar and data not shown). These experiments indicate that 3pK and E47 interact in vivoin yeast as well as in mammalian cells. We further analyzed whether MK2 also interacts with E47. Recombinant GST-tagged E47 or GST alone was bound to glutathione-Sepharose and added to precleared HEK293 lysates containing either HA-3pK, HA-MK2, or no kinase. After the pull-down, the beads were washed twice either under moderate (high salt TLB) or high stringency conditions (RIPA) and then subjected to SDS-PAGE. Under both conditions, 3pK and MK2 were pulled down with GST-E47 (Fig.3, lanes 2 and 6) but not when GST was bound to the Sepharose (Fig. 3, lanes 3and 7) or when lysates of untransfected cells were used (Fig. 3, lane 4). Thus, 3pK and MK2 overlap in their ability to bind to E47 even under highly stringent conditions, demonstrating a high binding affinity of the kinases to E47. E47 is phosphorylatedin vivo at several different sites in many cell types (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar,18.Shen C.P. Kadesch T. Mol. Cell. Biol. 1995; 15: 4518-4524Crossref PubMed Scopus (160) Google Scholar); however, there is only limited information about the identity of these E47 kinases. Several bHLH proteins, including E47, contain potential PKA and CKII phosphorylation motifs, which have since been confirmed in in vitro kinase phosphorylation studies (14.Mitsui K. Shirakata M. Paterson B.M. J. Biol. Chem. 1993; 268: 24415-24420Abstract Full Text PDF PubMed Google Scholar,16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar, 24.Hardy S. Kong Y. Konieczny S.F. Mol. Cell. Biol. 1993; 13: 5943-5956Crossref PubMed Scopus (53) Google Scholar). Interestingly, some of the PKA substrates such as the transcription factor CREB are also phosphorylated by MAPKAP kinases at the same sites, indicating that these kinases have overlapping sequence preferences. We therefore performed in vitro kinase assays to determine whether 3pK and MK2 are able to phosphorylate E47. HA-3pK, HA-MK2, or E47 were separately transfected in HEK293 cells, immunoprecipitated, washed, and mixed prior to the kinase reaction (Fig. 4 A). As a source of activated 3pK and MK2, cells were stimulated with arsenite resulting in a strong activation of both kinases, as shown by autophosphorylation. In the presence of active kinases, E47 was strongly phosphorylated (Fig. 4 A, lanes 3 and 6). Because the 3pK immunoprecipitates might contain additional kinases eventually responsible for this phosphorylation, we also used bacterially expressed and purified proteins for the experiments shown in Fig. 4 B. A GST fusion protein of E47 (GST-E47) was incubated with active or inactive recombinant 3pK (Fig. 4 B). In the presence of the active kinase, GST-E47 is phosphorylated, whereas the inactive version failed to phosphorylate E47. The negative control shows that the GST part is not a substrate. These results clearly demonstrate the ability of the MAPKAP kinases 3pK and MK2 to phosphorylate E47 in vitro. The E47 amino acid sequence shows four potential minimal consensus motifs for phosphorylation by MAPKAP kinases, three in the extreme N terminus and one at Ser-529, phosphorylated not in B-cells but in non-B cells (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar). Phosphorylation of Ser-529 in concert with Ser-514, both lying in close proximity to the basic DNA-binding domain, was found to inhibit DNA binding of E47 homodimers, whereas hypophosphorylated E47 allows DNA binding of homodimers as it occurs in B-cells (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar). Similar results were obtained for phosphorylation regulated DNA binding of Max homodimers (25.Berberich S.J. Cole M.D. Genes Dev. 1992; 6: 166-176Crossref PubMed Scopus (175) Google Scholar), suggesting that phosphate modification is an important step in the regulation of bHLH transcription factors. It has been postulated that the overall negative net charge in close proximity to the basic DNA-binding region may weaken the contact of homodimers with DNA (17.Sloan S.R. Shen C.P. McCarrick-Walmsley R. Kadesch T. Mol. Cell. Biol. 1996; 16: 6900-6908Crossref PubMed Scopus (82) Google Scholar). The colocalization and interaction of the two MAPKAP kinases with E47 suggest that the kinases are involved in the regulation of the transcriptional activity of the bHLH protein. Transcriptional activity of E47 was analyzed using a four E-box (4xE)-containing promoter gene construct that is strongly activated in the presence of the transcription factor (Fig. 5). We observed that coexpression of both 3pK and MK2 repressed the transcriptional activity of E47 on the 4xE-box promoter (Fig. 5,black and gray bars) in a dose-dependent manner to levels near those observed in the absence of E47. Expression of the kinases alone had no effect on the activity of the 4xE-box promoter in the absence of E47 (data not shown), indicating that the effect we observed is due to a cooperative action between the kinases and the transcription factor. Repression of the promoter was not observed when increasing amounts of SAPKβ were coexpressed with E47 (Fig. 5, white bars), indicating that this phenomenon is specific for 3pK and MK2. We used SAPKβ instead of the dominant negative 3pK in this assay, because 3pK KM is aberrantly located in the cytoplasm of the cell and may artificially discern E47 from the nucleus. The phosphorylation status of different bHLH proteins was found to be correlated with a reduced transcriptional activation of tissue-specific genes, including those involved in cell differentiation (13.Zhou J. Olson E.N. Mol. Cell. Biol. 1994; 14: 6232-6243Crossref PubMed Scopus (30) Google Scholar, 15.Winter B. Braun T. Arnold H.H. J. Biol. Chem. 1993; 268: 9869-9878Abstract Full Text PDF PubMed Google Scholar, 16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar). This kinase-dependent transcriptional repression is consistent with a previous report showing that overexpression of CKII results in a dramatic reduction of E47 homodimer-directed transcription, suggesting that CKII may act as a positive regulator of myogenesis by preventing E-protein homodimers from binding to muscle gene regulatory elements (16.Johnson S.E. Wang X. Hardy S. Taparowsky E.J. Konieczny S.F. Mol. Cell. Biol. 1996; 16: 1604-1613Crossref PubMed Scopus (69) Google Scholar). Thus, by binding and/or phosphorylating E47, MAPKAP kinases may also prevent E47 homodimer binding, thereby reducing homodimer-dependent transactivation. In summary, we demonstrate that 3pK and MK2 are E47 kinases and that they bind to the bHLH transcription factor with high affinity and repress its transcriptional activity. These data link the E47 function to the MAPK signaling network and suggest that the MAPK-activated protein kinases are regulators of E47-controlled gene expression and differentiation." @default.
• W2022233291 created "2016-06-24" @default.
• W2022233291 creator A5001270756 @default.
• W2022233291 creator A5011787812 @default.
• W2022233291 creator A5016200442 @default.
• W2022233291 creator A5044381105 @default.
• W2022233291 creator A5046883019 @default.
• W2022233291 creator A5062075315 @default.
• W2022233291 creator A5073955535 @default.
• W2022233291 creator A5075407431 @default.
• W2022233291 date "2000-07-01" @default.
• W2022233291 modified "2023-10-18" @default.
• W2022233291 title "Serine/Threonine Kinases 3pK and MAPK-activated Protein Kinase 2 Interact with the Basic Helix-Loop-Helix Transcription Factor E47 and Repress Its Transcriptional Activity" @default.
• W2022233291 cites W1533465487 @default.
• W2022233291 cites W1560653098 @default.
• W2022233291 cites W1562481790 @default.
• W2022233291 cites W1813567193 @default.
• W2022233291 cites W1976462601 @default.
• W2022233291 cites W2022339270 @default.
• W2022233291 cites W2023990373 @default.
• W2022233291 cites W2041401980 @default.
• W2022233291 cites W2061183445 @default.
• W2022233291 cites W2065301449 @default.
• W2022233291 cites W2078856910 @default.
• W2022233291 cites W2082670705 @default.
• W2022233291 cites W2094179447 @default.
• W2022233291 cites W2108490725 @default.
• W2022233291 cites W2116746764 @default.
• W2022233291 cites W2118806935 @default.
• W2022233291 cites W2120957537 @default.
• W2022233291 cites W2121643037 @default.
• W2022233291 cites W2133180230 @default.
• W2022233291 cites W2134468110 @default.
• W2022233291 cites W2145734345 @default.
• W2022233291 cites W2155791075 @default.
• W2022233291 cites W2161314639 @default.
• W2022233291 cites W2181679132 @default.
• W2022233291 cites W2182786267 @default.
• W2022233291 cites W4248369960 @default.
• W2022233291 cites W4250201766 @default.
• W2022233291 doi "https://doi.org/10.1074/jbc.c901040199" @default.
• W2022233291 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/10781029" @default.
• W2022233291 hasPublicationYear "2000" @default.
• W2022233291 type Work @default.
• W2022233291 sameAs 2022233291 @default.
• W2022233291 citedByCount "70" @default.
• W2022233291 countsByYear W20222332912013 @default.
• W2022233291 countsByYear W20222332912014 @default.
• W2022233291 countsByYear W20222332912016 @default.
• W2022233291 countsByYear W20222332912019 @default.
• W2022233291 countsByYear W20222332912020 @default.
• W2022233291 countsByYear W20222332912021 @default.
• W2022233291 countsByYear W20222332912022 @default.
• W2022233291 crossrefType "journal-article" @default.
• W2022233291 hasAuthorship W2022233291A5001270756 @default.
• W2022233291 hasAuthorship W2022233291A5011787812 @default.
• W2022233291 hasAuthorship W2022233291A5016200442 @default.
• W2022233291 hasAuthorship W2022233291A5044381105 @default.
• W2022233291 hasAuthorship W2022233291A5046883019 @default.
• W2022233291 hasAuthorship W2022233291A5062075315 @default.
• W2022233291 hasAuthorship W2022233291A5073955535 @default.
• W2022233291 hasAuthorship W2022233291A5075407431 @default.
• W2022233291 hasBestOaLocation W20222332911 @default.
• W2022233291 hasConcept C104317684 @default.
• W2022233291 hasConcept C11960822 @default.
• W2022233291 hasConcept C184235292 @default.
• W2022233291 hasConcept C185592680 @default.
• W2022233291 hasConcept C2775880066 @default.
• W2022233291 hasConcept C2776414213 @default.
• W2022233291 hasConcept C2910050888 @default.
• W2022233291 hasConcept C55493867 @default.
• W2022233291 hasConcept C57074206 @default.
• W2022233291 hasConcept C6174537 @default.
• W2022233291 hasConcept C86339819 @default.
• W2022233291 hasConcept C86803240 @default.
• W2022233291 hasConcept C94966510 @default.
• W2022233291 hasConcept C95444343 @default.
• W2022233291 hasConcept C97029542 @default.
• W2022233291 hasConceptScore W2022233291C104317684 @default.
• W2022233291 hasConceptScore W2022233291C11960822 @default.
• W2022233291 hasConceptScore W2022233291C184235292 @default.
• W2022233291 hasConceptScore W2022233291C185592680 @default.
• W2022233291 hasConceptScore W2022233291C2775880066 @default.
• W2022233291 hasConceptScore W2022233291C2776414213 @default.
• W2022233291 hasConceptScore W2022233291C2910050888 @default.
• W2022233291 hasConceptScore W2022233291C55493867 @default.
• W2022233291 hasConceptScore W2022233291C57074206 @default.
• W2022233291 hasConceptScore W2022233291C6174537 @default.
• W2022233291 hasConceptScore W2022233291C86339819 @default.
• W2022233291 hasConceptScore W2022233291C86803240 @default.
• W2022233291 hasConceptScore W2022233291C94966510 @default.
• W2022233291 hasConceptScore W2022233291C95444343 @default.
• W2022233291 hasConceptScore W2022233291C97029542 @default.
• W2022233291 hasIssue "27" @default.
• W2022233291 hasLocation W20222332911 @default.
• W2022233291 hasOpenAccess W2022233291 @default.
• W2022233291 hasPrimaryLocation W20222332911 @default.
• W2022233291 hasRelatedWork W1538962080 @default.

• next