FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022239421> ?p ?o ?g. }

• W2022239421 endingPage "44994" @default.
• W2022239421 startingPage "44988" @default.
• W2022239421 abstract "During differentiation neurons increase phospholipid biosynthesis to provide new membrane for neurite growth. We studied the regulation of phosphatidylcholine (PC) biosynthesis during differentiation of two neuronal cell lines: PC12 cells and Neuro2a cells. We hypothesized that in PC12 cells nerve growth factor (NGF) would up-regulate the activity and expression of the rate-limiting enzyme in PC biosynthesis, CTP:phosphocholine cytidylyltransferase (CT). During neurite outgrowth, NGF doubled the amount of cellular PC and CT activity. CTβ2 mRNA increased within 1 day of NGF application, prior to the formation of visible neurites, and continued to increase during neurite growth. When neurites retracted in response to NGF withdrawal, CTβ2 mRNA, protein, and CT activity decreased. NGF specifically activated CTβ2 by promoting its translocation from cytosol to membranes. In contrast, NGF did not alter CTα expression or translocation. The increase in both CTβ2 mRNA and CT activity was inhibited by U0126, an inhibitor of mitogen-activated kinase/extracellular signal-regulated kinase kinase 1/2 (MEK1/2). In Neuro2a cells, retinoic acid significantly increased CT activity (by 54%) and increased CTβ2 protein, coincident with neurite outgrowth but did not change CTα expression. Together, these data suggest that the CTβ2 isoform of CT is specifically up-regulated and activated during neuronal differentiation to increase PC biosynthesis for growing neurites. During differentiation neurons increase phospholipid biosynthesis to provide new membrane for neurite growth. We studied the regulation of phosphatidylcholine (PC) biosynthesis during differentiation of two neuronal cell lines: PC12 cells and Neuro2a cells. We hypothesized that in PC12 cells nerve growth factor (NGF) would up-regulate the activity and expression of the rate-limiting enzyme in PC biosynthesis, CTP:phosphocholine cytidylyltransferase (CT). During neurite outgrowth, NGF doubled the amount of cellular PC and CT activity. CTβ2 mRNA increased within 1 day of NGF application, prior to the formation of visible neurites, and continued to increase during neurite growth. When neurites retracted in response to NGF withdrawal, CTβ2 mRNA, protein, and CT activity decreased. NGF specifically activated CTβ2 by promoting its translocation from cytosol to membranes. In contrast, NGF did not alter CTα expression or translocation. The increase in both CTβ2 mRNA and CT activity was inhibited by U0126, an inhibitor of mitogen-activated kinase/extracellular signal-regulated kinase kinase 1/2 (MEK1/2). In Neuro2a cells, retinoic acid significantly increased CT activity (by 54%) and increased CTβ2 protein, coincident with neurite outgrowth but did not change CTα expression. Together, these data suggest that the CTβ2 isoform of CT is specifically up-regulated and activated during neuronal differentiation to increase PC biosynthesis for growing neurites. The differentiation of neuronal cell lines is characterized by a halt in proliferation, and the production of neurites. The rapid growth of neurites places a heavy demand on the differentiating cell for new membrane components. It is therefore not surprising that studies in rat pheochromocytoma (PC12) 1The abbreviations used are: PC12, rat pheochromocytoma; CT, CTP: phosphocholine cytidylyltransferase; DMEM, Dulbecco's modified Eagle's medium; MAP kinase, mitogen-activated protein kinase; MEK, mitogen-activated kinase/extracellular signal-regulated kinase kinase; NGF, nerve growth factor; PC, phosphatidylcholine. cells have shown that phosphatidylcholine (PC) biosynthesis increases during neurite outgrowth (1Araki W. Wurtman R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11946-11950Crossref PubMed Scopus (75) Google Scholar). Likewise, sympathetic neurons also increase phospholipid biosynthesis during axonal growth (2Vance J.E. Pan D. Vance D.E. Campenot R.B. J. Cell Biol. 1991; 115: 1061-1068Crossref PubMed Scopus (68) Google Scholar). PC, the predominant phospholipid in mammalian membranes, is synthesized primarily by the Kennedy pathway in which choline is phosphorylated by choline kinase to phosphocholine, which is converted to CDP-choline and subsequently to PC (3Vance D. Vance D.E. Vance J.E. Biochemistry of Lipids, Lipoproteins and Membranes, 4th Edition. Elsevier Science B. V., Amsterdam, The Netherlands2003: 205-232Google Scholar). In this pathway, the conversion of phosphocholine to CDP-choline, catalyzed by CTP:phosphocholine cytidylyltransferase (CT), is the rate-limiting step. To date, two murine/human genes encoding CT isoforms have been identified: Pcyt1a and Pcyt1b. CTα, the product of Pcyt1a, is expressed in all tissues. CTβ2 and CTβ3, which are splice variants of murine Pcyt1b, are both enriched in brain compared with other tissues (4Lykidis A. Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 26992-27001Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar, 5Karim M. Jackson P. Jackowski S. Biochim. Biophys. Acta. 2003; 1633: 1-12Crossref PubMed Scopus (78) Google Scholar). However, whereas CTβ2 is expressed in both embryonic and adult mouse brain, CTβ3 is found only in adult brain (5Karim M. Jackson P. Jackowski S. Biochim. Biophys. Acta. 2003; 1633: 1-12Crossref PubMed Scopus (78) Google Scholar). Orthologs of CTα and CTβ2 have been cloned from rat and have similar tissue distributions to those in mouse (6Xiong Y. Liu X.-I. Wang Y. Du Y.C. Neurosci. Lett. 2000; 283: 129-132Crossref PubMed Scopus (11) Google Scholar). Interestingly, in rat hippocampus, CTβ2 mRNA is upregulated by arginine vasopressin4–8, a metabolite of arginine vasopressin known to enhance memory and promote neurite growth in hippocampal neurons (6Xiong Y. Liu X.-I. Wang Y. Du Y.C. Neurosci. Lett. 2000; 283: 129-132Crossref PubMed Scopus (11) Google Scholar). PC12 cells are widely used for studies on neurite growth that is induced by nerve growth factor (NGF) (7Greene L.A. Tischler A.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 2424-2428Crossref PubMed Scopus (4873) Google Scholar). NGF elicits neurite outgrowth via activation of mitogen-activated protein kinase (MAP kinase) (8Vaudry D. Stork P.J.S. Lazarovici P. Elden L.E. Science. 2002; 296: 1648-1649Crossref PubMed Scopus (710) Google Scholar). MAP kinase signaling has also been implicated in ganglioside-dependent neurite outgrowth in murine Neuro2a cells (9Prinetti A. Iwabuchi K. Hakomori S.-i. J. Biol. Chem. 1999; 274: 20916-20924Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar), which rapidly differentiate in response to retinoic acid. We hypothesized that in differentiating neuronal cells PC biosynthesis is stimulated by an increase in CT activity and/or expression. To test this hypothesis, we examined PC biosynthesis, CT activity and CT isoform expression in PC12 cells and in Neuro2a cells. The results demonstrate a role for CT in neuritogenesis. Specifically, we observed a striking induction in expression of the CTβ2 isoform during neurite outgrowth. Materials—The MAP kinase/ERK kinase1/2 inhibitor, U0126, was obtained from Promega. All trans-retinoic acid was from Sigma. All cell culture media and reagents were from Invitrogen. Cell Culture—PC12 cells were obtained from the American Type Cell Culture Collection. Cells were maintained in F12-K medium supplemented with 15% heat-inactivated horse serum and 2.5% fetal bovine serum (FBS) at 37 °C in a humidified atmosphere containing 5% CO2. For differentiation experiments, cells were seeded on collagen-coated 35-mm dishes at a density of 1 × 105 cells/dish. Cells were incubated overnight and then 50 ng/ml 2.5 S NGF (Alomone Labs) was added. For NGF-withdrawn conditions, the cells were grown in NGF-containing medium for 5 days after which the medium was removed and replaced with control medium lacking NGF. All cells were harvested on day 9. The MAP kinase inhibitor, U0126, was dissolved in dimethyl sulfoxide and added to the medium to give a final concentration of inhibitor of 50 μm. The control medium contained the same amount of vehicle. The murine neuroblastoma cell line, Neuro2a, was a generous gift from Dr. David Williams (State University of New York, Stonybrook). The cells were maintained in Dulbecco's modified Eagle's medium (DMEM)/F12 medium (1:1 ratio) containing 10% heat-inactivated fetal bovine serum. For differentiation experiments, cells were plated on 35-mm dishes at a density of 1.5 × 105 cells per dish in DMEM containing 2% fetal bovine serum. Following an overnight incubation, cell medium was replaced with DMEM with 2% fetal bovine serum containing 20 μm retinoic acid (Sigma). After incubation for 48 h, cells were harvested in homogenization buffer A (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 2 mm EDTA, 1 mm dithiothreitol, 0.1 mm phenylmethylsulfonyl fluoride, and 100 μg/ml each of leupeptin and aprotinin) and treated as described for PC12 cells. PC Measurements and CT Assays—Cells were collected in 1 ml of homogenization buffer A. The cells were counted and then sonicated for 20sat4 °C. Cell lysates were centrifuged at 7,000 × g for 5 min to pellet nuclei and unbroken cells. Aliquots of supernatant were used for lipid extractions, CT activity assays, and immunoblotting. For fractionation of membranes and cytosol, an aliquot of the cell lysate was centrifuged at 470,000 × g for 30 min. The supernatant corresponded to the cytosol fraction; the pellet (microsomal fraction) was re-suspended in homogenization buffer A. All protein concentrations were measured using the Bio-Rad protein assay with bovine serum albumin used as a standard. CT activities in the total homogenate, soluble and membrane fractions were determined in the presence of PC:oleate vesicles by monitoring the conversion of phospho[3H]choline to CDP-[3H]choline as previously described (10Pelech S.L. Prtichard P.H. Vance D.E. J. Biol. Chem. 1981; 256: 8283-8286Abstract Full Text PDF PubMed Google Scholar). RNA Preparation and Reverse Transcriptase-mediated PCR—Total poly(A) RNA was isolated using the TRIZOL (Invitrogen) reagent as described by the manufacturer. 1 μg of total RNA was reverse-transcribed using a first strand cDNA synthesis kit (Superscript II, Invitrogen) according to the manufacturer's protocol. Aliquots of the reverse transcribed product were used for PCR amplification with the following sequence-specific primers for CTα: AGTGGAGGAGAAGAGCATCG (sense) and GGAAGTCTTGCCAGAGAAGG (antisense); choline kinase α, GTGAATGGATGGCTCCACTC (sense) and ACCTTCAAAGCCTGGTCATG (antisense); cyclophilin TCCAAAGACAGCAGAAAACTTTCG (sense) and TCTTCTTGCTGGTCTTGCCATTC (antisense); CTβ3: AAATGCAGCATGGACAAGG (sense) and TTTGCTTGCATAAGTGCCC (antisense). Two separate primer pairs were used for PCR amplification of CTβ2: pair 1, CCAAGGAGCTGAATGTCAGC (sense) and GCACTTGTTAACCAGGCACC (antisense); pair 2, GCCATGCCAGTAGTTACCACT (sense) and TTTGCTGCATAAGTGCCC (antisense). All PCR amplifications used the following program: 94 °C for 1 min, 60 °C for 1.5 min and 72 °C for 1.5 min for a total of 32 thermocycles (40 cycles for CTβ3), which was within the linear response range for each primer pair. The primers generated amplicons of the following sizes: CTα, 232 bp; CTβ2, 452 bp (pair 1) and 302 bp (pair 2); CTβ3, 218 bp; choline kinase α (200 bp); and cyclophilin, 380 bp. All amplified products were resolved on 1.5% agarose gels and stained with ethidium bromide. The amounts of the products generated with the CTα, choline kinase α, CTβ2 and CTβ3 primer pairs were normalized to the amount of cyclophilin product. RNase Protection Assays—Ribonuclease protection assays were performed using a RPA III™ kit (Ambion) according to the manufacturer's protocol. Briefly, 5 μg of total RNA was hybridized to 32P-labeled antisense riboprobes corresponding to CTα, CTβ2, or cyclophilin. Following an overnight hybridization, the RNA was digested with a single-strand-specific RNase (Ambion) and then separated on a 5% denaturing polyacrylamide gel and detected by autoradiography. Riboprobe-protected fragments were predicted to be 200bp (CTα), 200bp (CTβ2), and 250bp (cyclophilin). Immunoblots—Anti-human CTβ2 and anti-human CTα rabbit polyclonal antibodies were generous gifts from Dr. S. Jackowski (St. Jude Children's Research Hospital, Memphis, TN). The CTβ2 antibody was raised against a peptide corresponding to amino acids 347–365 of CTβ2 (4Lykidis A. Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 26992-27001Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). The CTα antibody was raised against a peptide corresponding to amino acids 1–17 of CTα (4Lykidis A. Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 26992-27001Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Equal amounts of protein in cell lysates were separated by electrophoresis on 10% polyacrylamide gels containing 0.1% SDS and transferred onto Immobilon-P transfer membranes (Millipore). Ponceau S stain was used to compare protein loading in all lanes of the gel. The membranes were blocked for 2 h with 5% skim milk in Tris-buffered saline (20 mm Tris-HCl, pH 7.5, 500 mm NaCl) containing 0.1% Tween 20 (TBS-T) and then incubated overnight with either anti-CTα (dilution 1:1,000) or anti-CTβ2 (dilution 1:1,000) antibodies. The blots were washed with TBS-T for 1 h and incubated with secondary antibody, horseradish peroxidase linked to anti-rabbit IgG (1/2500 dilution) for 1 h. After incubation the blot was washed with TBS-T and visualized with Amersham Biosciences ECL reagents. NGF Increases Cellular Protein and Phosphatidylcholine Levels in PC12 Cells—PC12 cells require NGF for differentiation to a neuronal phenotype; however, this differentiation is reversible. Once NGF is removed from the culture medium, the cells retract their neurites and resume proliferation. In our experiments, PC12 cells were incubated with medium containing 50 ng/ml NGF for 9 days (NGF), incubated with 50 ng/ml NGF for 5 days then cultured in medium lacking NGF for 4 more days (NGF-Withdrawn) or incubated without NGF throughout the experiment (Control). As expected, untreated cells continued to proliferate while NGF-treated cells stopped proliferating and started to extend neurites by day 3 of NGF treatment. NGF-withdrawn cells extended neurites during NGF treatment but the neurites retracted when NGF was removed from the culture medium. Previous studies have shown that incubation of PC12 cells with NGF significantly increases cellular protein content as well as PC content (1Araki W. Wurtman R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11946-11950Crossref PubMed Scopus (75) Google Scholar). We used these two parameters, along with the presence of neurites, to confirm that the PC12 cells were responding appropriately to NGF treatment. After 9 days of NGF treatment, the amount of protein per cell increased by 78% compared with that of control cells (373 pg/cell versus 209 pg/cell) (Fig. 1A). Prior to NGF withdrawal on day 5, NGF-withdrawn cells had significantly higher cellular protein compared with that in control cells; however, at day 9, when the cells had been deprived of NGF for 4 days, cellular protein was no longer significantly different from that of control cells (258 pg/cell). Fig. 1B demonstrates that treatment with NGF doubled the PC content per cell (p < 0.001). In contrast, the level of PC in the NGF-withdrawn cells was not significantly different from that in control cells. These results confirm that the increase in cellular protein and PC content is dependent on NGF and coincident with neurite outgrowth. NGF Stimulates CT Activity in PC12 Cells—Consistent with previous studies (1Araki W. Wurtman R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11946-11950Crossref PubMed Scopus (75) Google Scholar), NGF did not significantly increase CT activity in vitro when the activity was normalized to mg of protein (Fig. 2A, 3.24 nmol/min/mg protein and 3.39 nmol/min/mg protein in control and NGF-treated cells, respectively). Nor did NGF withdrawal alter CT activity. However, since NGF-dependent differentiation substantially increased the amount of protein per cell (Fig. 1A), presumably due to neurite outgrowth, we also normalized CT activity to cell number. Fig. 2B shows that NGF significantly increased CT activity per cell by greater than 100% (p < 0.001, Fig. 2B). Furthermore, in cells that were treated with NGF and in which NGF was subsequently withdrawn, CT activity returned to a level no longer significantly different from that in control cells. These results suggest that the increase in CT activity is dependent on NGF and coincides with neurite outgrowth. CT, an amphitropic enzyme, is activated by translocation from a soluble form to a membrane-associated form (11Sleight R. Kent C. J. Biol. Chem. 1980; 255: 10644-10650Abstract Full Text PDF PubMed Google Scholar, 12Vance D.E. Pelech S.L. Trends Biochem. Sci. 1984; 9: 17-20Abstract Full Text PDF Scopus (101) Google Scholar). We assayed soluble and membrane fractions of PC12 cells to determine whether or not NGF increased CT activity by promoting CT translocation to membranes. As shown in Fig. 3A, NGF significantly increased CT activity in the membrane fraction compared with that of control cells (p < 0.01). CT activity in membranes from NGF-withdrawn cells was not significantly different from that of control membranes. NGF did not significantly alter CT activity in the soluble fraction (Fig. 3B). Together, these results suggest that NGF activates CT by increasing its activity on cellular membranes. However, since we did not observe a corresponding decrease in soluble CT activity (Fig. 3B), we hypothesized that NGF might also upregulate CT expression. NGF Induces CTβ2 mRNA Expression—To determine whether or not NGF increased expression of the different CT isoforms, we assessed the mRNA abundance of the three known rodent isoforms of CT (CTα, CTβ2, and CTβ3) by semiquantitative RT-PCR. As shown in Fig. 4A, when PC12 cells were treated with NGF for 9 days, CTβ2 expression dramatically increased compared with that in cells not treated with NGF. In NGF-withdrawn cells CTβ2 mRNA was barely detectable. Furthermore, NGF increased CTβ2 expression as early as 1 day after application, and CTβ2 mRNA abundance increased with prolonged NGF exposure (Fig. 4B). In contrast, NGF did not alter CTα mRNA expression or choline kinase α mRNA expression. (Fig. 4A). Since neither the murine nor the rat cDNA encoding CDP-choline:diacylglycerol cholinephosphotransferase has been cloned, we could not examine if NGF affected its expression. We also used a ribonuclease protection assay to obtain a more quantitative assessment of whether or not NGF affected CTα or CTβ2 expression. As shown in Fig. 5A, CTβ2 mRNA was barely detectable in PC12 cells incubated without NGF (lane 2). However, CTβ2 mRNA was dramatically increased in cells treated with NGF for 7 days (lane 3). In contrast, and consistent with the RT-PCR results (Fig. 4A), CTα mRNA abundance was unaffected by NGF treatment. The approximately equal abundance of the 100-bp ribonuclease-protected cyclophilin mRNA fragment in all samples confirmed that equivalent amounts of RNA were used in the hybridization reactions. Recently, a novel isoform of CTβ has been identified, CTβ3, which is predicted to be a splice variant of CTβ2 (5Karim M. Jackson P. Jackowski S. Biochim. Biophys. Acta. 2003; 1633: 1-12Crossref PubMed Scopus (78) Google Scholar). Like CTβ2, CTβ3 mRNA is found in mouse brain (5Karim M. Jackson P. Jackowski S. Biochim. Biophys. Acta. 2003; 1633: 1-12Crossref PubMed Scopus (78) Google Scholar). We used RT-PCR to determine whether PC12 or Neuro2a cells expressed CTβ3 mRNA. As shown in Fig. 5B, CTβ3 mRNA was undetectable in PC12 cells after 40 PCR cycles. For this reason, we conclude that CTβ3 plays little or no role in the NGF-dependent increase in CT activity in PC12 cells. NGF Increases the Amount of CTβ2 Protein and Promotes Translocation to Membranes—Since NGF treatment dramatically increased CTβ2 mRNA abundance, we hypothesized that NGF also increases the amount of CTβ2 protein. Fig. 6A demonstrates that NGF markedly increased the amount of CTβ2 protein compared with that in control cells. The anti-CTβ2 antibody produces a characteristic doublet which corresponds to the predicted 43-kDa CTβ2 protein and a larger, phosphorylated form of CTβ2 (4Lykidis A. Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 26992-27001Abstract Full Text Full Text PDF PubMed Scopus (134) Google Scholar). Moreover, when NGF was removed from the culture medium, and the PC12 cells retracted their neurites, the amount of CTβ2 protein decreased to virtually undetectable levels. In contrast, NGF treatment did not alter the amount of CTα protein (Fig. 6A). These results suggest that the increase in the amount of CTβ2 protein also depends on NGF and coincides with neurite outgrowth, consistent with the observed increases in PC content and CT activity. Since CT activity increased in the membrane fraction of NGF-treated PC12 cells, we hypothesized that NGF not only up-regulates the expression of CTβ2 specifically, but also activates CTβ2 by promoting its translocation from the soluble reservoir to membranes. Immunoblot analysis (Fig. 6B) demonstrated that membranes of NGF-treated PC12 cells contained more CTβ2 than did control or NGF-withdrawn cells. In contrast, membranes of NGF-treated cells did not show an appreciable increase in CTα immunoreactivity. The anti-CTα antibody revealed a doublet of immunoreactive bands in membranes from untreated, NGF-treated, and NGF-withdrawn PC12 cells, as well as in the positive control (10 μg of protein from a lysate of McArdle 7777 rat hepatoma cells, which overexpress CTα, data not shown). The lower band corresponds to the predicted size of CTα (41kDa) but the origin of the second, larger immunoreactive band in all of the samples is not clear. We conclude that NGF increases CT activity in two specific ways. First, NGF up-regulates CTβ2, but not CTα, expression. Second, NGF specifically activates CTβ2, but not CTα, by promoting the association of CTβ2 with membranes. U0126 Inhibits the NGF-dependent Increase in CT Activity and CTβ2 Expression—NGF signals through multiple intracellular cascades to promote neuronal survival and differentiation. Among these signaling cascades, MAP kinase is essential for neurite outgrowth (8Vaudry D. Stork P.J.S. Lazarovici P. Elden L.E. Science. 2002; 296: 1648-1649Crossref PubMed Scopus (710) Google Scholar, 13Barrie A.P. Clohessy A.M. Buensuceso C.S. Rogers M.V. Allen J.M. J. Biol. Chem. 1997; 272: 19666-19671Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar). In this pathway, NGF activates Ras, which activates mitogen-activated kinase/extracellular signal-regulated kinase kinase (MEK), which subsequently activates MAP kinase. We, therefore, hypothesized that NGF signals through the MAP kinase pathway to induce CTβ2 expression and activation. We treated PC12 cells with U0126, an inhibitor of MEK1/2, which inhibits the MEK-dependent activation of MAP kinase, and examined its effect on CT activity and CTβ2 expression in NGF-differentiated PC12 cells. Previous studies have shown that when NGF-treated PC12 cells are incubated with U0126 neurite extension is impaired compared with that in cells treated with NGF alone (14Kano Y. Nohno T. Hasegawa T. Takahashi R. Hiragami F. Kawamura K. Iwama M.K. Motoda H. Miyamoto K. Neurochem. Res. 2002; 27: 1655-1661Crossref PubMed Scopus (12) Google Scholar). We, therefore, incubated PC12 cells for 5 days with 50 ng/ml NGF (NGF), with 50 ng/ml NGF and 50 μm U0126 (NGF/U0126), with 50 μm U0126 alone (U0126) or without both NGF and U0126 (control). Control and U0126-treated cells proliferated and exhibited no discernible morphological differences. Both NGF- and NGF/U0126-treated cells differentiated. However, fewer NGF/U0126-treated cells extended neurites and the average neurite length at 5 days was shorter than in NGF-treated cells. Consistent with the 9-day differentiation experiments (Fig. 2B), cells incubated with NGF for 5 days contained a significantly higher CT activity per cell than did control cells (p < 0.01, Fig. 7A). However, when PC12 cells were incubated with NGF in the presence of U0126, CT activity was not significantly different from that of control cells. We used semi-quantitative RT-PCR to examine whether or not U0126 attenuated CTβ2 mRNA and CTα mRNA expression. In cells treated with NGF and U0126 together, CTβ2 mRNA abundance was appreciably less than in NGF-treated cells (Fig. 7B). CTα mRNA abundance was the same under all treatment conditions (data not shown). These results support our hypothesis that MAP kinase signaling mediates the NGF-dependent increase in CTβ2 expression and the subsequent increase in CT activity. Retinoic Acid Stimulates CT Activity in Neuro2a Cells— Neurite outgrowth is characteristic of all differentiating neuronal cells. We, therefore, hypothesized that CTβ2 expression and CT activity would be increased in any cells that were actively growing neurites, rather than only in cells, which differentiate upon NGF treatment. To test this hypothesis, we measured CT activity in Neuro2a cells, which do not require NGF for differentiation but instead rapidly differentiate in response to treatment with retinoic acid (15Shea T.B. Fischer I. Sapirstein V.S. Dev. Brain Res. 1985; 21: 307-314Crossref Scopus (125) Google Scholar). We plated Neuro2a cells on 35 mm dishes and treated them with 20 μm retinoic acid for 48 h. Within 12 h after retinoic acid application, virtually all cells had stopped proliferating and had extended neurites longer than the diameter of a cell body. Retinoic acid-dependent differentiation increased cellular protein in Neuro2a cells (p < 0.01, Fig. 8A), similar to the situation in NGF-dependent differentiation of PC12 cells (Fig. 1A). Also similar to PC12 cells, CT activity per mg of protein did not increase (not shown) whereas the activity per cell increased by 54% (p < 0.0025) from 3.9 fmol/min/cell in cells incubated without retinoic acid to 6.0 fmol/min/cell in cells incubated with retinoic acid (Fig. 8B). From these data, we conclude that in both Neuro2a and PC12 cells, which differentiate in response to retinoic acid and NGF, respectively, CT activity is significantly increased during neurite outgrowth. Retinoic Acid Increases the Amount of CTβ2 Protein in Neuro2a Cells—Since retinoic acid treatment significantly increased CT activity in Neuro2a cells, we immunoblotted Neuro2A cell lysates to determine whether or not retinoic acid increased the amount of CT protein. As shown in Fig. 9, the amount of CTβ2 protein was substantially higher in retinoic acid-treated cells than in control cells. The amount of CTα protein in Neuro2a cells, however, was unaffected by retinoic acid treatment. Together these results support our hypothesis that CTβ2 expression and CT activity are increased during neurite outgrowth irrespective of the method of induction of differentiation. Neurite outgrowth places a high demand on neurons for membrane biosynthesis. This is especially true for PC biosynthesis since PC is the most abundant phospholipid in mammalian membranes. We have shown that during neurite growth of PC12 cells, NGF stimulates PC biosynthesis by specifically up-regulating the expression and activity of CTβ2. Furthermore, in Neuro2a cells, retinoic acid-induced differentiation also stimulated CTβ2 expression and increased CT activity. We conclude that in both of these neuronal cell lines, the demand for PC during neurite growth is accommodated by an elevation of CTβ2 expression, with a concomitant elevation in CT activity. CT Activity and Isoform Expression in NGF-treated PC12 Cells—CT is an amphitrophic enzyme (3Vance D. Vance D.E. Vance J.E. Biochemistry of Lipids, Lipoproteins and Membranes, 4th Edition. Elsevier Science B. V., Amsterdam, The Netherlands2003: 205-232Google Scholar), existing in a soluble form with low activity, and an active, membrane-associated form. Translocation of CT from a soluble form to membranes is a major mechanism of regulation of CT activity (11Sleight R. Kent C. J. Biol. Chem. 1980; 255: 10644-10650Abstract Full Text PDF PubMed Google Scholar, 12Vance D.E. Pelech S.L. Trends Biochem. Sci. 1984; 9: 17-20Abstract Full Text PDF Scopus (101) Google Scholar). Accordingly, we found that in PC12 cells NGF regulated CT activity by promoting translocation of CT to membranes. Furthermore, CTβ2, but not CTα, protein increased in the membranes of NGF-treated cells (Fig. 6B). These observations provide the first evidence that one isoform of CT can be differentially activated over another isoform. The increase in membrane-associated CTβ2 in response to NGF was not simply due to an increase in the amount of CTβ2 protein, because the cytosolic CT activity was not increased in parallel. Previous reports have shown that the incorporation of labeled choline into PC increases dramatically when PC12 cells are exposed to NGF and that this increase in PC biosynthesis coincides with neurite outgrowth (1Araki W. Wurtman R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11946-11950Crossref PubMed Scopus (75) Google Scholar). Similarly, in our experiments, PC mass per cell doubled in cells treated for 9 days with NGF. Consistent with a previous report (1Araki W. Wurtman R.J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11946-11950Crossref PubMed Scopus (75) Google Scholar), NGF treatment did not increase CT activity when measured in vitro per mg of protein. Nevertheless, as expected, the dramatic morphological changes of neuronal differentiation were associated with significant increases in cellular protein content (Fig. 1B); thus, we normalized our CT activity measurements to cell number as well as mg of protein. CT activity per cell increased by 50%" @default.
• W2022239421 created "2016-06-24" @default.
• W2022239421 creator A5006782806 @default.
• W2022239421 creator A5019669813 @default.
• W2022239421 creator A5036396804 @default.
• W2022239421 creator A5057746394 @default.
• W2022239421 creator A5073998071 @default.
• W2022239421 date "2003-11-01" @default.
• W2022239421 modified "2023-09-26" @default.
• W2022239421 title "Enhanced Expression and Activation of CTP:Phosphocholine Cytidylyltransferase β2 during Neurite Outgrowth" @default.
• W2022239421 cites W1010635479 @default.
• W2022239421 cites W1525648980 @default.
• W2022239421 cites W1581680249 @default.
• W2022239421 cites W1582530932 @default.
• W2022239421 cites W1592254226 @default.
• W2022239421 cites W1615873781 @default.
• W2022239421 cites W1909266718 @default.
• W2022239421 cites W1923711010 @default.
• W2022239421 cites W1935140087 @default.
• W2022239421 cites W1970587959 @default.
• W2022239421 cites W1974817754 @default.
• W2022239421 cites W1979844286 @default.
• W2022239421 cites W1989517748 @default.
• W2022239421 cites W1994480608 @default.
• W2022239421 cites W1994532732 @default.
• W2022239421 cites W2004999534 @default.
• W2022239421 cites W2027147108 @default.
• W2022239421 cites W2032466814 @default.
• W2022239421 cites W2038113019 @default.
• W2022239421 cites W2041749846 @default.
• W2022239421 cites W2045466436 @default.
• W2022239421 cites W2049198952 @default.
• W2022239421 cites W2050477788 @default.
• W2022239421 cites W2053871565 @default.
• W2022239421 cites W2065406230 @default.
• W2022239421 cites W2070851884 @default.
• W2022239421 cites W2087645448 @default.
• W2022239421 cites W2109368575 @default.
• W2022239421 cites W2128509011 @default.
• W2022239421 cites W60995632 @default.
• W2022239421 doi "https://doi.org/10.1074/jbc.m307336200" @default.
• W2022239421 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12928431" @default.
• W2022239421 hasPublicationYear "2003" @default.
• W2022239421 type Work @default.
• W2022239421 sameAs 2022239421 @default.
• W2022239421 citedByCount "43" @default.
• W2022239421 countsByYear W20222394212012 @default.
• W2022239421 countsByYear W20222394212013 @default.
• W2022239421 countsByYear W20222394212014 @default.
• W2022239421 countsByYear W20222394212015 @default.
• W2022239421 countsByYear W20222394212016 @default.
• W2022239421 countsByYear W20222394212019 @default.
• W2022239421 countsByYear W20222394212020 @default.
• W2022239421 countsByYear W20222394212022 @default.
• W2022239421 countsByYear W20222394212023 @default.
• W2022239421 crossrefType "journal-article" @default.
• W2022239421 hasAuthorship W2022239421A5006782806 @default.
• W2022239421 hasAuthorship W2022239421A5019669813 @default.
• W2022239421 hasAuthorship W2022239421A5036396804 @default.
• W2022239421 hasAuthorship W2022239421A5057746394 @default.
• W2022239421 hasAuthorship W2022239421A5073998071 @default.
• W2022239421 hasBestOaLocation W20222394211 @default.
• W2022239421 hasConcept C113246987 @default.
• W2022239421 hasConcept C153911025 @default.
• W2022239421 hasConcept C185592680 @default.
• W2022239421 hasConcept C202751555 @default.
• W2022239421 hasConcept C2776131300 @default.
• W2022239421 hasConcept C2776330855 @default.
• W2022239421 hasConcept C2776923060 @default.
• W2022239421 hasConcept C2777658100 @default.
• W2022239421 hasConcept C2778830669 @default.
• W2022239421 hasConcept C2778918659 @default.
• W2022239421 hasConcept C2994587330 @default.
• W2022239421 hasConcept C41625074 @default.
• W2022239421 hasConcept C502942594 @default.
• W2022239421 hasConcept C55493867 @default.
• W2022239421 hasConcept C86803240 @default.
• W2022239421 hasConcept C95444343 @default.
• W2022239421 hasConceptScore W2022239421C113246987 @default.
• W2022239421 hasConceptScore W2022239421C153911025 @default.
• W2022239421 hasConceptScore W2022239421C185592680 @default.
• W2022239421 hasConceptScore W2022239421C202751555 @default.
• W2022239421 hasConceptScore W2022239421C2776131300 @default.
• W2022239421 hasConceptScore W2022239421C2776330855 @default.
• W2022239421 hasConceptScore W2022239421C2776923060 @default.
• W2022239421 hasConceptScore W2022239421C2777658100 @default.
• W2022239421 hasConceptScore W2022239421C2778830669 @default.
• W2022239421 hasConceptScore W2022239421C2778918659 @default.
• W2022239421 hasConceptScore W2022239421C2994587330 @default.
• W2022239421 hasConceptScore W2022239421C41625074 @default.
• W2022239421 hasConceptScore W2022239421C502942594 @default.
• W2022239421 hasConceptScore W2022239421C55493867 @default.
• W2022239421 hasConceptScore W2022239421C86803240 @default.
• W2022239421 hasConceptScore W2022239421C95444343 @default.
• W2022239421 hasIssue "45" @default.
• W2022239421 hasLocation W20222394211 @default.
• W2022239421 hasOpenAccess W2022239421 @default.
• W2022239421 hasPrimaryLocation W20222394211 @default.

• next