Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022240582> ?p ?o ?g. }
Showing items 1 to 71 of
71
with 100 items per page.
- W2022240582 endingPage "147" @default.
- W2022240582 startingPage "143" @default.
- W2022240582 abstract "The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCA-DAGCGCAψUUGUUUUGGNψFACAAAAUmsu7GUCACGGGTψCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNAPro (UGG), the other two known plant organellar tRNAsPro." @default.
- W2022240582 created "2016-06-24" @default.
- W2022240582 creator A5000539509 @default.
- W2022240582 creator A5031865310 @default.
- W2022240582 date "1997-03-01" @default.
- W2022240582 modified "2023-09-27" @default.
- W2022240582 title "Nucleotide sequence of a cucumber chloroplast proline tRNA" @default.
- W2022240582 cites W1988662537 @default.
- W2022240582 cites W1992486617 @default.
- W2022240582 cites W2075315521 @default.
- W2022240582 cites W2076253357 @default.
- W2022240582 cites W2080162497 @default.
- W2022240582 cites W2106896768 @default.
- W2022240582 cites W2132541664 @default.
- W2022240582 cites W2171100233 @default.
- W2022240582 cites W2179908318 @default.
- W2022240582 cites W4213329868 @default.
- W2022240582 doi "https://doi.org/10.1007/bf02704728" @default.
- W2022240582 hasPublicationYear "1997" @default.
- W2022240582 type Work @default.
- W2022240582 sameAs 2022240582 @default.
- W2022240582 citedByCount "2" @default.
- W2022240582 countsByYear W20222405822013 @default.
- W2022240582 crossrefType "journal-article" @default.
- W2022240582 hasAuthorship W2022240582A5000539509 @default.
- W2022240582 hasAuthorship W2022240582A5031865310 @default.
- W2022240582 hasBestOaLocation W20222405822 @default.
- W2022240582 hasConcept C104317684 @default.
- W2022240582 hasConcept C153957851 @default.
- W2022240582 hasConcept C165525559 @default.
- W2022240582 hasConcept C2779815552 @default.
- W2022240582 hasConcept C515207424 @default.
- W2022240582 hasConcept C54355233 @default.
- W2022240582 hasConcept C552990157 @default.
- W2022240582 hasConcept C67705224 @default.
- W2022240582 hasConcept C69305403 @default.
- W2022240582 hasConcept C84148353 @default.
- W2022240582 hasConcept C86803240 @default.
- W2022240582 hasConceptScore W2022240582C104317684 @default.
- W2022240582 hasConceptScore W2022240582C153957851 @default.
- W2022240582 hasConceptScore W2022240582C165525559 @default.
- W2022240582 hasConceptScore W2022240582C2779815552 @default.
- W2022240582 hasConceptScore W2022240582C515207424 @default.
- W2022240582 hasConceptScore W2022240582C54355233 @default.
- W2022240582 hasConceptScore W2022240582C552990157 @default.
- W2022240582 hasConceptScore W2022240582C67705224 @default.
- W2022240582 hasConceptScore W2022240582C69305403 @default.
- W2022240582 hasConceptScore W2022240582C84148353 @default.
- W2022240582 hasConceptScore W2022240582C86803240 @default.
- W2022240582 hasIssue "2" @default.
- W2022240582 hasLocation W20222405821 @default.
- W2022240582 hasLocation W20222405822 @default.
- W2022240582 hasOpenAccess W2022240582 @default.
- W2022240582 hasPrimaryLocation W20222405821 @default.
- W2022240582 hasRelatedWork W1972813354 @default.
- W2022240582 hasRelatedWork W1988663151 @default.
- W2022240582 hasRelatedWork W2023856281 @default.
- W2022240582 hasRelatedWork W2045313050 @default.
- W2022240582 hasRelatedWork W2066856346 @default.
- W2022240582 hasRelatedWork W2081145949 @default.
- W2022240582 hasRelatedWork W2151139122 @default.
- W2022240582 hasRelatedWork W4230434078 @default.
- W2022240582 hasRelatedWork W4253442229 @default.
- W2022240582 hasRelatedWork W1996488360 @default.
- W2022240582 hasVolume "22" @default.
- W2022240582 isParatext "false" @default.
- W2022240582 isRetracted "false" @default.
- W2022240582 magId "2022240582" @default.
- W2022240582 workType "article" @default.