FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022388765> ?p ?o ?g. }

• W2022388765 endingPage "1112" @default.
• W2022388765 startingPage "1104" @default.
• W2022388765 abstract "Endochondral ossification comprises a cascade of cell differentiation culminating in chondrocyte hypertrophy and is negatively controlled by soluble environmental mediators at several checkpoints. Proteinases modulate this control by processing protein signals and/or their receptors. Here, we show that insulin-like growth factor I can trigger hypertrophic development by stimulating production and/or activation of proteinases in some populations of chick embryo chondrocytes. Cell surface targets of the enzymes include 1,25-dihydroxyvitamin D3 membrane-associated rapid response steroid receptor (1,25 D3 MARRS receptor), also known as ERp57/GRp58/ERp60. This protein is anchored to the outer surface of plasma membranes and inhibits late chondrocyte differentiation after binding of 1,25-dihydroxyvitamin D3. Upon treatment with insulin-like growth factor I, 1,25 D3 MARRS receptor is cleaved into two fragments of ∼30 and 22 kDa. This process is abrogated along with hypertrophic development by E-64 or cystatin C, inhibitors of cysteine proteinases. Cell differentiation is enhanced by treatment with antibodies to 1,25 D3 MARRS receptor that either block binding of the inhibitory ligand 1,25-dihydroxyvitamin D3 or inactivate 1,25 D3 MARRS receptor left intact after treatment with proteinase inhibitors. Therefore, proteolytic shedding of 1,25 D3 MARRS receptor constitutes a molecular mechanism eliminating the 1,25-dihydroxyvitamin D3-induced barrier against late cartilage differentiation and is a potentially important step during endochondral ossification or cartilage degeneration in osteoarthritis. Endochondral ossification comprises a cascade of cell differentiation culminating in chondrocyte hypertrophy and is negatively controlled by soluble environmental mediators at several checkpoints. Proteinases modulate this control by processing protein signals and/or their receptors. Here, we show that insulin-like growth factor I can trigger hypertrophic development by stimulating production and/or activation of proteinases in some populations of chick embryo chondrocytes. Cell surface targets of the enzymes include 1,25-dihydroxyvitamin D3 membrane-associated rapid response steroid receptor (1,25 D3 MARRS receptor), also known as ERp57/GRp58/ERp60. This protein is anchored to the outer surface of plasma membranes and inhibits late chondrocyte differentiation after binding of 1,25-dihydroxyvitamin D3. Upon treatment with insulin-like growth factor I, 1,25 D3 MARRS receptor is cleaved into two fragments of ∼30 and 22 kDa. This process is abrogated along with hypertrophic development by E-64 or cystatin C, inhibitors of cysteine proteinases. Cell differentiation is enhanced by treatment with antibodies to 1,25 D3 MARRS receptor that either block binding of the inhibitory ligand 1,25-dihydroxyvitamin D3 or inactivate 1,25 D3 MARRS receptor left intact after treatment with proteinase inhibitors. Therefore, proteolytic shedding of 1,25 D3 MARRS receptor constitutes a molecular mechanism eliminating the 1,25-dihydroxyvitamin D3-induced barrier against late cartilage differentiation and is a potentially important step during endochondral ossification or cartilage degeneration in osteoarthritis. Endochondral ossification is one of two mechanisms of bone formation in vertebrates and is particularly important for development, growth, and repair of long bones. During this process, differentiated cartilage cells transit through a cascade of late differentiation events that sequentially include cell proliferation and several steps of chondrocyte maturation culminating in hypertrophy. After invasion of blood vessels into hypertrophic cartilage from subchondral bone, the majority of hypertrophic cells undergo apoptosis and the cartilage template is remodeled into trabecular bone. Each chondrocyte differentiation phase is accompanied by a change in cell shape and the expression of stage-specific markers. The cells produce collagens II, IX, and XI at all stages, albeit at different steady-state levels. In addition, the expression repertoire includes collagen VI and matrilin 1 at early proliferative stages and Indian hedgehog during pre-hypertrophy. Collagen X and alkaline phosphatase are well established surrogate markers for the overtly hypertrophic stage of late chondrocyte differentiation. Hypertrophic chondrocytes also reduce, or even terminate, their production of collagen II (1Cancedda R. Descalzi C.F. Castagnola P. Int. Rev. Cytol. 1995; 159: 265-358Crossref PubMed Scopus (351) Google Scholar, 2Cancedda R. Castagnola P. Cancedda F.D. Dozin B. Quarto R. Int. J. Dev. Biol. 2000; 44: 707-714PubMed Google Scholar, 3Goldring M.B. Tsuchimochi K. Ijiri K. J. Cell. Biochem. 2006; 97: 33-44Crossref PubMed Scopus (829) Google Scholar, 4Kronenberg H.M. Nature. 2003; 423: 332-336Crossref PubMed Scopus (2090) Google Scholar, 5Provot S. Schipani E. Biochem. Biophys. Res. Commun. 2005; 328: 658-665Crossref PubMed Scopus (310) Google Scholar, 6Szüts V. Möllers U. Bittner K. Schürmann G. Muratoglu S. Deak F. Kiss I. Bruckner P. Matrix Biol. 1998; 17: 435-448Crossref PubMed Scopus (38) Google Scholar). Collagen X is not made in the superficial or intermediate layers of normal articular cartilage but is strongly up-regulated in osteoarthritic cartilage, particularly near surface fissures. For this reason, it has been speculated that osteoarthritis is associated with illegitimate induction of late differentiation in articular chondrocytes (7von der Mark K. Kirsch T. Nerlich A. Kuss A. Weseloh G. Glückert K. Stöss H. Arthritis Rheum. 1992; 35: 806-811Crossref PubMed Scopus (396) Google Scholar). Not least for this reason, there has been a considerable interest in the molecular mechanisms of the environmental control of this process.Late chondrocyte differentiation in vivo is controlled by systemic hormones as well as by locally acting autocrine signals derived from chondrocytes themselves or by paracrine signals derived from cells of surrounding tissues, e.g. the perichondrium or subchondral blood vessels. When cultured in suspension under several conditions (for review see Ref. 1Cancedda R. Descalzi C.F. Castagnola P. Int. Rev. Cytol. 1995; 159: 265-358Crossref PubMed Scopus (351) Google Scholar), chondrocytes in vitro can recapitulate late differentiation, and the order of events and their control elements closely resemble those occurring in vivo. Late chondrocyte differentiation is subject to positive and negative control elements that interact to regulate the rate and progression of the process (3Goldring M.B. Tsuchimochi K. Ijiri K. J. Cell. Biochem. 2006; 97: 33-44Crossref PubMed Scopus (829) Google Scholar). Locally produced factors, such as bone morphogenetic proteins, Wnts, fibroblast growth factors, hedgehogs, insulin-like growth factors (IGFs) 2The abbreviations used are:IGFinsulin-like growth factor1,25-((OH)2) Vit D31,25-dihydroxyvitamin D3MMPmatrix metalloproteinaseMARRS receptormembrane-associated rapid response steroid receptorERKextracellular signal-regulated kinaseMSmass spectrometryHPLChigh pressure liquid chromatographyPBSphosphate-buffered salineRT-PCRreverse transcription PCR. 2The abbreviations used are:IGFinsulin-like growth factor1,25-((OH)2) Vit D31,25-dihydroxyvitamin D3MMPmatrix metalloproteinaseMARRS receptormembrane-associated rapid response steroid receptorERKextracellular signal-regulated kinaseMSmass spectrometryHPLChigh pressure liquid chromatographyPBSphosphate-buffered salineRT-PCRreverse transcription PCR., and retinoids, are known so far to influence endochondral ossification (for reviews see Refs. 2Cancedda R. Castagnola P. Cancedda F.D. Dozin B. Quarto R. Int. J. Dev. Biol. 2000; 44: 707-714PubMed Google Scholar, 4Kronenberg H.M. Nature. 2003; 423: 332-336Crossref PubMed Scopus (2090) Google Scholar, and 5Provot S. Schipani E. Biochem. Biophys. Res. Commun. 2005; 328: 658-665Crossref PubMed Scopus (310) Google Scholar). Likewise, systemic hormones, including growth hormone, thyroid hormone, estrogen, androgen, vitamin D, and glucocorticoids, control the rate and extent of the process at several points. Further, signals may erect barriers against late differentiation at earlier stages but may boost it later. For example, transforming growth factor β2 and fibroblast growth factor-2 in synergy prevent differentiation at early proliferative stages but fibroblast growth factor-2 alone supports it later (8Babarina A.V. Möllers U. Bittner K. Vischer P. Bruckner P. Matrix Biol. 2001; 20: 205-213Crossref PubMed Scopus (33) Google Scholar, 9Böhme K. Conscience-Egli M. Tschan T. Winterhalter K.H. Bruckner P. J. Cell Biol. 1992; 116: 1035-1042Crossref PubMed Scopus (166) Google Scholar). In a feedback loop of paracrine control, perichondrial cells, induced by chondrocyte-derived Indian Hedgehog, produce parathyroid hormone-related peptide that delays progression of late differentiation at late proliferative stages (10Vortkamp A. Lee K. Lanske B. Segre G.V. Kronenberg H.M. Tabin C.J. Science. 1996; 273: 613-622Crossref PubMed Scopus (1628) Google Scholar). However, parathyroid hormone can promote differentiation at other stages (11Erdmann S. Müller W. Bahrami S. Vornehm S.I. Mayer H. Bruckner P. von der Mark K. Burkhardt H. J. Cell Biol. 1996; 135: 1179-1191Crossref PubMed Scopus (43) Google Scholar). Finally, extracellular signals also can stem from suprastructures of the extracellular matrix. For example, fibrils containing cartilage collagens II, IX, and XI interact with chondrocytes through matrix receptors and thereby stabilize the differentiated cartilage phenotype, whereas collagen I-containing fibrils cause the cells to undergo dedifferentiation (12Farjanel J. Schürmann G. Bruckner P. Osteoarthritis Cartilage. 2001; 9: S55-S63Abstract Full Text PDF PubMed Scopus (29) Google Scholar).At day 17 of in ovo development, the sternum of chick embryos still is entirely cartilaginous and contains chondrocytes at different stages of late differentiation. In cells derived from the caudal third, hereafter called caudal cells, hypertrophy is not easily achieved in vitro. Cells derived from the cranial third, hereafter called cranial cells, proceed to become overtly hypertrophic and produce large amounts of collagen X when appropriately stimulated in vitro, e.g. with insulin-like growth factor I or thyroid hormone. It has been thought that the anabolic response elicited by the hormones was tantamount to the induction of late differentiation. However, this notion does not explain easily the elimination of autocrine barriers against hypertrophy, such as those mentioned above.Many stationary and diffusible regulators as well as their cell surface receptors are proteins. Therefore, proteinases are not merely destructive effectors of extracellular matrix degradation but also intervene in regulatory networks, both by eliminating control elements and by converting precursors into active agents. For instance, matrix metalloproteinases (MMPs) modify the extracellular matrix microenvironment, resulting in alteration of cellular behavior. They also regulate cell attachment and, thereby, differentiation and apoptosis. In addition, they modulate mediator activities by direct cleavage or by release from extracellular matrix stores. Furthermore, they control the activity of other proteinases by activating their zymogens or by their elimination through proteolysis (13Ortega N. Behonick D. Stickens D. Werb Z. Ann. N. Y. Acad. Sci. 2003; 995: 109-116Crossref PubMed Scopus (161) Google Scholar). We have shown that proteinases of endothelial cells abrogate the arrest of late differentiation in vitro, most likely by acting in an activation cascade targeting chondrocyte surface components or their soluble ligands (8Babarina A.V. Möllers U. Bittner K. Vischer P. Bruckner P. Matrix Biol. 2001; 20: 205-213Crossref PubMed Scopus (33) Google Scholar, 14Bittner K. Vischer P. Bartholmes P. Bruckner P. Exp. Cell Res. 1998; 238: 491-497Crossref PubMed Scopus (59) Google Scholar). Additionally, cysteine proteinases, especially the cathepsins, have been implicated in several proteolytic scenarios during development, growth, remodeling, and aging, as well as in a variety of pathological processes. During endochondral ossification, cathepsins B, H, K, L, and S were detected immunohistochemically in growth plates of rats and humans (15Söderstrom M. Salminen H. Glumoff V. Kirschke H. Aro H. Vuorio E. Biochim. Biophys. Acta. 1999; 1446: 35-46Crossref PubMed Scopus (64) Google Scholar, 16Nakase T. Kaneko M. Tomita T. Myoui A. Ariga K. Sugamoto K. Uchiyama Y. Ochi T. Yoshikawa H. Histochem. Cell Biol. 2000; 114: 21-27Crossref PubMed Scopus (46) Google Scholar) and are thought to be involved in the proteolysis of several extracellular matrix components.The seco-steroid 1,25-dihydroxyvitamin D3 (1,25-(OH)2 Vit D3) is an essential regulator of bone development, growth, and remodeling (17Norman A.W. Hurwitz S. J. Nutr. 1993; 123: 310-316Crossref PubMed Scopus (41) Google Scholar). Vitamin D hormone modulates proliferation and differentiation of growth plate chondrocytes both by mechanisms involving the classical nuclear vitamin D receptor and by rapid actions through membrane-associated receptors (18Boyan B.D. Dean D.D. Sylvia V.L. Schwartz Z. Connect. Tissue Res. 2003; 44: 130-135Crossref PubMed Scopus (19) Google Scholar). In chondrocytes of the growth zone, binding of 1,25-(OH)2 Vit D3 to a membrane-associated vitamin D receptor molecule modulates gene expression through the ERK1/2 pathway activated by phospholipase C. In addition, protein kinase C turns on the synthesis of prostaglandins that also increase ERK1/2 activities. In chondrocytes of the resting zone, however, rapid actions are not mediated through 1,25-(OH)2 Vit D3 but, rather, via 24,25-dihydroxyvitamin D3. Membrane binding of this vitamin D metabolite induces mitogen-activated protein kinase activity via phospholipase D and decreased prostaglandin production (19Schwartz Z. Ehland H. Sylvia V.L. Larsson D. Hardin R.R. Bingham V. Lopez D. Dean D.D. Boyan B.D. Endocrinology. 2002; 143: 2775-2786Crossref PubMed Scopus (68) Google Scholar). Rapid, non-genomic effects of 1α, 25-(OH)2 Vit D3 have been attributed in several tissues and species to a 1,25-dihydroxyvitamin D-binding protein at the cell surface, which is called 1,25-dihydroxyvitamin D3 membrane-associated rapid response steroid receptor (1,25 D3 MARRS receptor) and which is also known as ERp57, GRp58, or ERp60 (GenBank™ accession code 373899) (20Nemere I. Ray R. McManus W. Am. J. Physiol. 2000; 278: E1104-E1114Crossref PubMed Google Scholar, 21Nemere I. Safford S.E. Rohe B. DeSouza M.M. Farach-Carson M.C. J. Steroid Biochem. Mol. Biol. 2004; 89-90: 281-285Crossref PubMed Scopus (99) Google Scholar, 22Nemere I. Steroids. 2005; 70: 455-457Crossref PubMed Scopus (43) Google Scholar, 23Khanal R. Nemere I. Crit Rev. Eukaryotic Gene Expression. 2007; 17: 31-47Crossref PubMed Google Scholar, 24Khanal R.C. Nemere I. Curr. Med. Chem. 2007; 14: 1087-1093Crossref PubMed Scopus (110) Google Scholar).Here, we found that cysteine proteinase activity is essential for progression toward hypertrophy not only in caudal but also in cranial cells. In addition, we found that these cysteine proteinases target membrane-associated signaling by vitamin D hormones, the last barrier against late differentiation of cranial cells.EXPERIMENTAL PROCEDURESAntibodies—AB099 is a polyclonal rabbit antibody directed against 1,25 D3 MARRS receptor (20Nemere I. Ray R. McManus W. Am. J. Physiol. 2000; 278: E1104-E1114Crossref PubMed Google Scholar), produced by means of the multiple antigenic peptide system using the first 20 N-terminal amino acids of the putative membrane vitamin D receptor. Horseradish peroxidase-conjugated anti-rabbit IgG from donkey (Amersham Biosciences) served as secondary antibody for immunoblotting. Binding of AB099 in immunohistochemistry was detected with the alkaline phosphatase-anti-alkaline phosphatase protocol with a mouse anti-rabbit IgG-bridging antibody (both DAKO, Glostrup, Denmark).Chondrocyte Cultures—Chondrocytes were isolated from the cranial third of 17-day-old chick embryo sterna by overnight digestion with collagenase. The cells were cultured in agarose suspension cultures under serum-free conditions as described (25Tschan T. Hörler I. Houze Y. Winterhalter K.H. Richter C. Bruckner P. J. Cell Biol. 1990; 111: 257-260Crossref PubMed Scopus (80) Google Scholar). Briefly, cells were suspended in 0.5% low melting agarose in Dulbecco's modified Eagle's medium (Biochrom) and allowed to sediment on the culture dishes pre-coated with 1% high melting agarose in water. Cells were grown at densities of 2 × 106 cells/ml in Dulbecco's modified Eagle's medium (Biochrom) containing 60 μg/ml β-aminopropionitrile fumarate, 25 μg/ml sodium ascorbate, 1 mm cysteine, 1 mm pyruvate, 100 units/ml penicillin, and 100 μg/ml streptomycin (complete medium) for 14 days at 37 °C and 5% CO2. For two-dimensional electrophoresis or one-step RT-PCR the cells were cultured on top of agarose layers at high density (8 × 106 cells/ml) in complete medium for 48 h. Where indicated, 100 ng/ml IGF-I, 10-6-10-7m 1α, 25-dihydroxyvitamin D3 or 24 (R5),25-dihydroxyvitamin D3 (both Biomol), AB099 in a dilution of 1:1000, and/or the proteinase inhibitors E-64 (0,14-14 μm; Roche Applied Science) or cystatin C (7,5-750 pm; Calbiochem) were added to the medium during the whole culture duration. Medium was changed every 2-3 days. Micrographs were recorded on day 12 with an inverse microscope (Axiovert 100 equipped with Axiovision 2.0; Zeiss).Expression of Differentiation Markers—After 14 days in culture, newly synthesized chondrocyte proteins were metabolically labeled for 24 h with 1 μCi/ml of [14C]proline (uniformly labeled, 250 Ci/mmol; PerkinElmer Life Science products). Collagens were isolated after limited digestion with pepsin from the culture medium or the agarose layers and were analyzed by SDS-PAGE on 4.5-15% gradient gels, followed by fluorography as described (26Bruckner P. Hörler I. Mendler M. Houze Y. Winterhalter K.H. Eich-Bender S.G. Spycher M.A. J. Cell Biol. 1989; 109: 2537-2545Crossref PubMed Scopus (150) Google Scholar). Alkaline phosphatase activity was monitored in culture medium with p-nitrophenyl phosphate as a substrate (27Bessey A.O. Lowry O.H. Brock M.J. J. Biol. Chem. 1946; 164: 321-329Abstract Full Text PDF PubMed Google Scholar).One-step RT-PCR—Total RNA was isolated with TRIzol reagent (Invitrogen) as recommended by the manufacturer from chondrocytes cultured in suspension on top of agarose for 7 days. Prior to the one-step PCR protocol (Qiagen), RNA was treated with RNase-free DNase I (Ambion) for 30 min at 37 °C. The following primer sequences were used: β actin forward, ggtatgtgcaaggccggttt, β actin reverse, atggctggggtgttgaaggt, amplicon size: 353 bp; collagen X forward, acctgcaggatccctggtctat, collagen X reverse, atcaatgacagcactgcctgagg, amplicon size, 161 bp. RT-PCR products were separated on a 2% agarose gel.Immunohistochemical Analysis—Tibiae of 17-day-old chick embryos were fixed for 24 h in 3% paraformaldehyde in 20 mm sodium phosphate buffer, pH 7.4, containing 150 mm NaCl (PBS). After decalcification in 10% EDTA in 3% Tris-HCl, pH 7.4, the samples were paraffin-embedded. 3-μm sections were deparaffinized and subjected to digestion for 90 min at 37 °C with 1 mg/ml of bovine testicular hyaluronidase (Serva) in 20 mm sodium phosphate buffer, pH 5.3, containing 150 mm NaCl (28Müller-Glauser W. Humbel B. Glatt M. Strauli P. Winterhalter K.H. Bruckner P. J. Cell Biol. 1986; 102: 1931-1939Crossref PubMed Scopus (111) Google Scholar). After washing with PBS, unspecific antibody binding sites were blocked at 4 °C overnight with PBS containing 10% normal goat serum (DAKO) and 50 mg/ml of bovine serum albumin. Sections were then exposed for 1 h at 37 °C to AB099 (1:1000) or rabbit immunoglobulin fraction (Dako), diluted in blocking solution. Immune complexes were stained with the APAAP detection kit, as recommended by the manufacturer with mouse anti-rabbit IgG as a bridging antibody (Dako) and NBT/BCIP® solution (Sigma) as chromogenic substrate.Immunoblotting—Proteins in 1 ml of conditioned medium from chondrocytes cultured in agarose were precipitated with 3% (w/v) trichloroacetic acid and were subjected to 4.5-15% SDS-polyacrylamide gel electrophoresis under reducing conditions. Pre-stained protein standards within a range of 207 to 7.5 kDa (Bio-Rad) were used as molecular mass markers. Proteins were electro-transferred onto nitrocellulose membranes (Schleicher and Schuell) for 3 h at 4 °C. Filters were blocked for 1 h in blocking buffer (5% dry skim milk + 1% bovine serum albumin in Tris-buffered saline containing 0.1% Tween 20) and incubated overnight with a rabbit antiserum (AB099, diluted 1:5000) directed against 1,25 D3 MARRS receptor or RP1MMP13 (Triple Point Biologics, Inc.; Forest Grove, OR, 1:1000) directed against MMP-13, washed with Tris-buffered saline, and incubated for 2 h with horseradish peroxidase-coupled anti-rabbit IgG antibody from donkey (Amersham Biosciences). Signals were visualized with ECL reagent by exposure on blue light-sensitive autoradiography films (Pierce).Analysis of Chondrocyte Membrane Fragments by Two-dimensional Gel Electrophoresis or Immunoblotting—In order to enrich for plasma membrane-associated proteins, chondrocytes were harvested after 2 days of culture and cell surface proteins were biotinylated with sulfo-NHS-LC-biotin (Pierce) according to the manufacturer's protocol. Briefly, the cells were washed two times in PBS to remove amine-containing culture medium and proteins. To 2.5 × 107 cells/ml in PBS 2 mm biotin reagent was added and incubated for 30 min at 4 °C. To quench and remove excess biotin reagent, 5 ml of PBS + 100 mm glycine was added and the cells were washed twice in PBS. For isolation of membrane fragments the cells were resuspended in 5 mm Tris-HCl, pH 7.8, 250 mm saccharose containing a proteinase inhibitor mixture (Complete; Roche Applied Science), lysed by three cycles of freeze/thawing, followed by sonification. After removal of nuclei, mitochondria, and the rough microsomes by centrifugation (1000 × g, 30 min, 4 °C), the membrane fragments were pelleted by centrifugation (150,000 × g, 30 min, 4 °C) and resuspended in PBS. Biotinylated membrane fragments were enriched by applying a magnetic separation technique with Magprep™ streptavidin beads (Novagen) as recommended by the manufacturer. Proteins were subjected to immunoblotting with subsequent image analysis (ImageQuant; GE Healthcare) or isoelectric focusing (pH 3-10) using the Zoom IPG Runner on zoom stripes pH 3-10 NL (both Invitrogen) in the following sample buffer: 7 m urea, 2 m thiourea, 1% ASB-14, 40 mm Tris, 20 mm dithiothreitol, 0.5% 3/10 ampholyte, 0.001% bromphenol blue. The isoelectric focusing run was conducted at 4 °C at 200 V for 20 min, at 450 V for 15 min, at 750 V for 15 min, and at 2000 V for 45 min. Electrophoresis in the second dimension was carried out on a 4.5-15% gradient SDS-PAGE under reducing conditions. Protein standards within a range of 200 to 6.5 kDa (Bio-Rad) were used as molecular mass markers. The gel was stained overnight with Coomassie Brilliant Blue G-250 and destained in HPLC grade A bidest.Mass Spectrometric Analysis—1,25 D3 MARRS receptor was identified by peptide mass fingerprint (matrix-assisted laser desorption ionization time-of-flight MS analysis) and liquid chromatography MS/MS (nano-HPLC and subsequent quantitative time-of-flight electrospray MS/MS analysis) at the Central Bioanalytics Department (ZBA), Center for Molecular Medicine (ZMMK) Cologne, Germany.RESULTSIGF-I-stimulated Late Differentiation of Cranial Cells in Vitro Requires Extracellular Proteinase Activity—In serum-free culture in agarose gels, cranial cells become hypertrophic within 14 days in the presence of 100 ng/ml IGF-I or 25 ng/ml thyroxin. They change their morphology and initiate synthesis of alkaline phosphatase, collagen type X (29Böhme K. Winterhalter K.H. Bruckner P. Exp. Cell Res. 1995; 216: 191-198Crossref PubMed Scopus (109) Google Scholar), and MMP-13. Newly synthesized radiolabeled collagens II and X after pepsin digestion were identified as characteristic bands migrating with mobilities corresponding to apparent molecular masses of 120 and 58 kDa, respectively, as routinely carried out in several laboratories (1Cancedda R. Descalzi C.F. Castagnola P. Int. Rev. Cytol. 1995; 159: 265-358Crossref PubMed Scopus (351) Google Scholar). In developing bone, chondrocytes synthesize this matrix molecule after they have become hypertrophic and before mineralization of the extracellular matrix occurs (1Cancedda R. Descalzi C.F. Castagnola P. Int. Rev. Cytol. 1995; 159: 265-358Crossref PubMed Scopus (351) Google Scholar, 2Cancedda R. Castagnola P. Cancedda F.D. Dozin B. Quarto R. Int. J. Dev. Biol. 2000; 44: 707-714PubMed Google Scholar, 30Schmid T.M. Conrad H.E. J. Biol. Chem. 1982; 257: 12444-12450Abstract Full Text PDF PubMed Google Scholar, 31Capasso O. Tajana G. Cancedda R. Mol. Cell. Biol. 1984; 4: 1163-1168Crossref PubMed Scopus (46) Google Scholar, 32Gibson G.J. Schor S.L. Grant M.E. J. Cell Biol. 1982; 93: 767-774Crossref PubMed Scopus (157) Google Scholar, 33Iyama K. Ninomiya Y. Olsen B.R. Linsenmayer T.F. Trelstad R.L. Hayashi M. Anat. Rec. 1991; 229: 462-472Crossref PubMed Scopus (93) Google Scholar). To determine the role of cysteine proteinases during IGF-I-stimulated chondrocyte differentiation, E-64, a specific inhibitor of papain and of other cysteine proteinases such as cathepsin B or L, or cystatin C, a low molecular mass protein of the cystatin superfamily, were added to the cells during the whole culture period. After 14 days the cultures were metabolically labeled with [14C]proline and pepsin-treated collagens were isolated from the cell culture medium and analyzed by SDS-PAGE and subsequent fluorography (Fig. 1). In cranial cells stimulated by IGF-I, addition of E-64 dose dependently reduced the production of collagen X, the marker of hypertrophic cells. ∼5 μg/ml of E-64 was sufficient to fully block the secretion of the protein. In parallel, collagen II synthesis was increased (Fig. 1A). Inhibition of cysteine proteinases by cystatin C dose dependently produced similar results (Fig. 1C). To confirm that changes in collagen II and X protein are not due to altered proteolysis or processing but rather are associated with terminal chondrocyte differentiation, gene expression of collagen X and β actin (loading control) was analyzed by one-step RT-PCR (Fig. 1D). Collagen X expression is strongly induced after IGF-I stimulation. In the presence of 10 ng/ml cystatin C and IGF-I, however, collagen X expression was strongly diminished. Finally, MMP-13, a metalloproteinase produced by late hypertrophic cells, is another late-stage differentiation marker. The enzyme is essential for degradation of the extracellular matrix of ossifying hypertrophic cartilage prior to mineralization and remodeling into bone. After treatment with IGF-I, MMP-13 was detected in immunoblots as the 60-kDa proenzyme (34Zijlstra A. Aimes R.T. Zhu D. Regazzoni K. Kupriyanova T. Seandel M. Deryugina E.I. Quigley J.P. J. Biol. Chem. 2004; 279: 27633-27645Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, Fig. 1B). In the presence of 5 μg/ml of the cysteine proteinase inhibitor E-64, however, MMP-13 secretion is barely visible on the immunoblots. Taken together, these results showed that cysteine proteinases were required for the production of markers of late differentiation by IGF-I-stimulated chondrocyte and indicated that, in the presence of cysteine proteinase inhibitors, the cells remained at earlier stages of late differentiation.Treatment with E-64 Elevates the Abundance of 1,25 D3 MARRS-binding Protein on the Surface of IGF-I-stimulated Cranial Cells—Because E-64 does not penetrate membranes, cysteine proteinases target components of the culture medium or of the cell surfaces. In a preliminary screen for candidate substrates, proteins on membrane fragments of IGF-I-stimulated cranial cells cultured with or without E-64 were analyzed. In this type of experiments, it was necessary to culture the cells in liquid suspension on top of agarose, a good alternative to suspension culture within agarose gels (1Cancedda R. Descalzi C.F. Castagnola P. Int. Rev. Cytol. 1995; 159: 265-358Crossref PubMed Scopus (351) Google Scholar). This allowed easy recovery of the cells after culture. Membrane fragments were prepared from the cells after culture and were subjected to two-dimensional electrophoresis (isoelectric focusing pH 3-10, SDS-PAGE). Gels stained with colloidal Coomassie Blue revealed a number of differences in the protein patterns (Fig. 2A). A 64-kDa protein with an isoelectric point of ∼5.8 was more abundant in cells cultivated with E-64 (Fig. 2A, arrow). This was in contrast to other proteins on the same gels that produced spots with similar intensities (Fig. 2A, asterisks). The 64-kDa protein was analyzed by peptide mass fingerprinting and liquid chromatography MS/MS and was identified as 1,25 D3 MARRS receptor, also known as ERp57/GRp58/ERp60. Alternatively, biotinylated plasma membrane proteins of IGF-I-stimulated cranial cells cultured with or without E-64 were isolated via Magprep™ streptavidin beads and subjected to immunoblotting using AB099 to detect 1,25 D3 MARRS receptor (Fig. 2B). As quantified by image analysis, there was ∼60% more 1,25 D3 MARRS receptor detectable on chondrocyte cell surfaces in the presence of E-64. These results indicated that this membrane-associated vitamin D receptor was a cell surface target of cysteine proteinases and therefore qualified as a candidate attenuator of late differentiation. The" @default.
• W2022388765 created "2016-06-24" @default.
• W2022388765 creator A5015148582 @default.
• W2022388765 creator A5048024864 @default.
• W2022388765 creator A5048191253 @default.
• W2022388765 creator A5060926236 @default.
• W2022388765 creator A5075250222 @default.
• W2022388765 date "2008-01-01" @default.
• W2022388765 modified "2023-10-12" @default.
• W2022388765 title "Terminal Differentiation of Chick Embryo Chondrocytes Requires Shedding of a Cell Surface Protein That Binds 1,25-Dihydroxyvitamin D3" @default.
• W2022388765 cites W1533197701 @default.
• W2022388765 cites W1540384225 @default.
• W2022388765 cites W1542339233 @default.
• W2022388765 cites W1560487523 @default.
• W2022388765 cites W1930664300 @default.
• W2022388765 cites W1963946720 @default.
• W2022388765 cites W1966912816 @default.
• W2022388765 cites W1976451311 @default.
• W2022388765 cites W1979245402 @default.
• W2022388765 cites W1979313922 @default.
• W2022388765 cites W1983268040 @default.
• W2022388765 cites W1989052690 @default.
• W2022388765 cites W1992570938 @default.
• W2022388765 cites W1995499476 @default.
• W2022388765 cites W1997733459 @default.
• W2022388765 cites W2001740011 @default.
• W2022388765 cites W2002187143 @default.
• W2022388765 cites W2004706898 @default.
• W2022388765 cites W2016749697 @default.
• W2022388765 cites W2017026387 @default.
• W2022388765 cites W2028500986 @default.
• W2022388765 cites W2035716585 @default.
• W2022388765 cites W2040155058 @default.
• W2022388765 cites W2042187005 @default.
• W2022388765 cites W2042932723 @default.
• W2022388765 cites W2049736562 @default.
• W2022388765 cites W2056507563 @default.
• W2022388765 cites W2069075404 @default.
• W2022388765 cites W2070747794 @default.
• W2022388765 cites W2098549454 @default.
• W2022388765 cites W2098657941 @default.
• W2022388765 cites W2099669252 @default.
• W2022388765 cites W2107409970 @default.
• W2022388765 cites W2108784488 @default.
• W2022388765 cites W2123819897 @default.
• W2022388765 cites W2125053662 @default.
• W2022388765 cites W2132660240 @default.
• W2022388765 cites W2166259149 @default.
• W2022388765 cites W4211112402 @default.
• W2022388765 cites W5876813 @default.
• W2022388765 doi "https://doi.org/10.1074/jbc.m703336200" @default.
• W2022388765 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/17984094" @default.
• W2022388765 hasPublicationYear "2008" @default.
• W2022388765 type Work @default.
• W2022388765 sameAs 2022388765 @default.
• W2022388765 citedByCount "18" @default.
• W2022388765 countsByYear W20223887652012 @default.
• W2022388765 countsByYear W20223887652013 @default.
• W2022388765 countsByYear W20223887652014 @default.
• W2022388765 countsByYear W20223887652015 @default.
• W2022388765 countsByYear W20223887652020 @default.
• W2022388765 crossrefType "journal-article" @default.
• W2022388765 hasAuthorship W2022388765A5015148582 @default.
• W2022388765 hasAuthorship W2022388765A5048024864 @default.
• W2022388765 hasAuthorship W2022388765A5048191253 @default.
• W2022388765 hasAuthorship W2022388765A5060926236 @default.
• W2022388765 hasAuthorship W2022388765A5075250222 @default.
• W2022388765 hasConcept C1491633281 @default.
• W2022388765 hasConcept C185592680 @default.
• W2022388765 hasConcept C196843134 @default.
• W2022388765 hasConcept C2779664074 @default.
• W2022388765 hasConcept C41008148 @default.
• W2022388765 hasConcept C55493867 @default.
• W2022388765 hasConcept C76155785 @default.
• W2022388765 hasConcept C86803240 @default.
• W2022388765 hasConcept C95444343 @default.
• W2022388765 hasConceptScore W2022388765C1491633281 @default.
• W2022388765 hasConceptScore W2022388765C185592680 @default.
• W2022388765 hasConceptScore W2022388765C196843134 @default.
• W2022388765 hasConceptScore W2022388765C2779664074 @default.
• W2022388765 hasConceptScore W2022388765C41008148 @default.
• W2022388765 hasConceptScore W2022388765C55493867 @default.
• W2022388765 hasConceptScore W2022388765C76155785 @default.
• W2022388765 hasConceptScore W2022388765C86803240 @default.
• W2022388765 hasConceptScore W2022388765C95444343 @default.
• W2022388765 hasIssue "2" @default.
• W2022388765 hasLocation W20223887651 @default.
• W2022388765 hasOpenAccess W2022388765 @default.
• W2022388765 hasPrimaryLocation W20223887651 @default.
• W2022388765 hasRelatedWork W2007036916 @default.
• W2022388765 hasRelatedWork W2010102767 @default.
• W2022388765 hasRelatedWork W2120266540 @default.
• W2022388765 hasRelatedWork W2164087676 @default.
• W2022388765 hasRelatedWork W2416728927 @default.
• W2022388765 hasRelatedWork W3015807911 @default.
• W2022388765 hasRelatedWork W3211557223 @default.
• W2022388765 hasRelatedWork W4206528302 @default.
• W2022388765 hasRelatedWork W4240867999 @default.

• next