FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022602233> ?p ?o ?g. }

• W2022602233 endingPage "25840" @default.
• W2022602233 startingPage "25834" @default.
• W2022602233 abstract "Ectopic production of the EVI1 transcriptional repressor zinc finger protein is seen in 4–6% of human acute myeloid leukemias. Overexpression also transforms Rat1 fibroblasts by an unknown mechanism, which is likely to be related to its role in leukemia and which depends upon its repressor activity. We show here that mutant murine Evi-1 proteins, lacking either the N-terminal zinc finger DNA binding domain or both DNA binding zinc finger clusters, function as dominant negative mutants by reverting the transformed phenotype of Evi-1 transformed Rat1 fibroblasts. The dominant negative activity of the non-DNA binding mutants suggests sequestration of transformation-specific cofactors and that recruitment of these cellular factors might mediate Evi-1 transforming activity.C-terminal bindingprotein (CtBP) co-repressor family proteins bind PLDLS-like motifs. We show that the murine Evi-1 repressor domain has two such sites, PFDLT (site a, amino acids 553–559) and PLDLS (site b, amino acids 584–590), which independently can bind CtBP family co-repressor proteins, with site b binding with higher affinity than site a. Functional analysis of specific CtBP binding mutants show site b is absolutely required to mediate both transformation of Rat1 fibroblasts and transcriptional repressor activity. This is the first demonstration that the biological activity of a mammalian cellular transcriptional repressor protein is mediated by CtBPs. Furthermore, it suggests that CtBP proteins are involved in the development of some acute leukemias and that blocking their ability to specifically interact with EVI1 might provide a target for the development of pharmacological therapeutic agents. Ectopic production of the EVI1 transcriptional repressor zinc finger protein is seen in 4–6% of human acute myeloid leukemias. Overexpression also transforms Rat1 fibroblasts by an unknown mechanism, which is likely to be related to its role in leukemia and which depends upon its repressor activity. We show here that mutant murine Evi-1 proteins, lacking either the N-terminal zinc finger DNA binding domain or both DNA binding zinc finger clusters, function as dominant negative mutants by reverting the transformed phenotype of Evi-1 transformed Rat1 fibroblasts. The dominant negative activity of the non-DNA binding mutants suggests sequestration of transformation-specific cofactors and that recruitment of these cellular factors might mediate Evi-1 transforming activity.C-terminal bindingprotein (CtBP) co-repressor family proteins bind PLDLS-like motifs. We show that the murine Evi-1 repressor domain has two such sites, PFDLT (site a, amino acids 553–559) and PLDLS (site b, amino acids 584–590), which independently can bind CtBP family co-repressor proteins, with site b binding with higher affinity than site a. Functional analysis of specific CtBP binding mutants show site b is absolutely required to mediate both transformation of Rat1 fibroblasts and transcriptional repressor activity. This is the first demonstration that the biological activity of a mammalian cellular transcriptional repressor protein is mediated by CtBPs. Furthermore, it suggests that CtBP proteins are involved in the development of some acute leukemias and that blocking their ability to specifically interact with EVI1 might provide a target for the development of pharmacological therapeutic agents. acute myeloid leukemia full-length chloramphenicol acetyltransferase polymerase chain reaction base pair(s) C-terminal-binding protein DNA binding domain activation domain A small number of transcription factors are frequently targets for de-regulation by recurring chromosome translocations in acute leukemias, and these events play a pivotal role in disease progression (1Rabbitts T.H. Cell. 1991; 67: 641-644Abstract Full Text PDF PubMed Scopus (234) Google Scholar). The EVI-1 gene encodes one of these transcription factors, which is activated in 4–6% of acute myeloid leukemia (AML)1 patients with various karyotypic abnormalities of chromosome 3q26 (2Morishita K. Paraganas E. Williams C.L. Whittaker M.H. Drabkin H. Oval J. Taetle R. Valentine M.B. Ihle J.N. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 3937-3941Crossref PubMed Scopus (291) Google Scholar), which result in the ectopic production of intact or, occasionally, C-terminal-truncated EVI1 proteins (3Fichelson S. Leukemia. 1992; 6: 93-99PubMed Google Scholar, 4Yufu Y. Sadamura S. Ishikura H. Abe Y. Katsuno M. Nishimura J. Nawata H. Am. J. Hematol. 1996; 53: 30-34Crossref PubMed Scopus (8) Google Scholar, 5Suzukawa K. Kodera T. Shimizu S. Nagasawa T. Asou H. Kamada N. Taniwaki M. Yokota J. Morishita K. Leukemia. 1999; 13: 1359-1366Crossref PubMed Scopus (7) Google Scholar, 6Suzukawa K. Taki T. Abe T. Asoh H. Kamada N. Yokota J. Morishita K. Genomics. 1997; 42: 356-360Crossref PubMed Scopus (27) Google Scholar). In addition, novel EVI1 fusion proteins are sometimes produced. For example, patients with karyotypes t(3;21) (q26;q22) or t(3;12) (q26;p13) express AML1/EVI1 (7Mitani K. Ogawa S. Tanaka T. Miyoshi H. Kurokawa M. Mano H. Yazaki Y. Ohki M. Hirai H. EMBO J. 1994; 13: 504-510Crossref PubMed Scopus (322) Google Scholar) and ETV6(TEL)/EVI1 (8Peeters P. Wlodarska I. Baens M. Criel A. Selleslag D. Hagemeijer A. Van den Berghe H. Marynen P. Cancer Res. 1997; 57: 564-569PubMed Google Scholar) chimeras, respectively, and similar fusions with a naturally occurring MDS1/EVI1 isoform (9Fears S. Mathieu C. Zeleznik-Le N. Huang S. Rowley J.D. Nucifora G. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 1642-1647Crossref PubMed Scopus (188) Google Scholar). The precise contribution of ectopic EVI1 and EVI1 fusion protein production in leukemia progression is unknown, but a combination of enforced transgene expression and intervention studies shows a causative role, affecting both cell differentiation and proliferation. Expression of AML1/MDS1/EVI1 induces AML in mice, resulting in the accumulation of myeloid blast cells and immature differentiated myelocytic and monocytic lineages (10Cuenco G.M. Nucifora G. Ren R. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1760-1765Crossref PubMed Scopus (77) Google Scholar). EVI1 or AML1/EVI1 expression in either 32Dcl3 cells or murine primary bone marrow cells abrogates granulocyte colony-stimulating factor and erythropoietin-mediated differentiation and survival, respectively (11Morishita K. Parganas E. Matsugi T. Ihle J.N. Mol. Cell. Biol. 1992; 12: 183-189Crossref PubMed Scopus (132) Google Scholar, 12Tanaka T. Mitani K. Kurokawa M. Ogawa S. Tanaka K. Nishida J. Yazaki Y. Shibata Y. Hirai H. Mol. Cell. Biol. 1995; 15: 2383-2392Crossref PubMed Scopus (105) Google Scholar, 13Kreider B. Orkin S.H. Ihle J.N. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 6454-6458Crossref PubMed Scopus (129) Google Scholar). EVI-1 antisense oligonucleotides inhibit proliferation of leukemic cells expressing the AML1/EVI1 fusion protein (14Mitani K. Ogawa S. Tanaka T. Kurokawa M. Yazaki Y. Hirai H. Br. J. Haematol. 1995; 90: 711-714Crossref PubMed Scopus (10) Google Scholar), and evi-1 gene targeting produces an embryonic lethal phenotype accompanied by widespread hypocellularity (15Hoyt P.R. Bartholomew C. Davis A.J. Yutzey K. Gomer L.M. Potter S.S. Ihle J.N. Mucenski M.L. Mech. Dev. 1997; 65: 55-70Crossref PubMed Scopus (136) Google Scholar). The 145-kDa nuclear EVI-1 full-length protein (FL) is a sequence-specific transcriptional repressor protein (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar) that is organized into at least four distinct domains. Two comprise seven (ZF1) and three repeats (ZF2) of the DNA binding Cys2-His2 zinc finger motif, which have distinct DNA binding specificities (17Delwel R. Funabiki T. Kreider B. Morishita M. Ihle J.N. Mol. Cell. Biol. 1993; 13: 4291-4300Crossref PubMed Scopus (122) Google Scholar, 18Funabiki T. Kreider B. Ihle J.N. Oncogene. 1994; 9: 1575-1581PubMed Google Scholar). In addition, there are two separate transcriptional repressor domains designated Rp (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar) and IR (19Kilbey A. Bartholomew C. Oncogene. 1998; 16: 2287-2291Crossref PubMed Scopus (33) Google Scholar). Transcriptional repressor activity is very important to the biological function of the EVI1 protein. EVI1 transforms Rat1 fibroblasts (20Kurokawa M. Ogawa S. Tanaka T. Mitani K. Yazaki Y. Witte O.N. Hirai H. Oncogene. 1995; 11: 833-840PubMed Google Scholar) by deregulating cell cycle control (21Kilbey A. Stephens V. Bartholomew C. Cell Growth Differ. 1999; 10: 601-610PubMed Google Scholar) in an Rp domain-dependent manner (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar), and this activity must be related to its role in leukemia progression. However, the precise mechanism of EVI1-mediated repression is unknown. In the case of several other transcriptional repressor proteins with vital roles in the development of acute leukemias, such as AML1/ETO, PML/RARα, and PLZF/RARα fusion proteins, repression is mediated by the aberrant recruitment of chromatin structure modifying co-repressor complexes comprising N-CoR·mSin3·N-CoR·mSin3·HDAC1HDAC1 proteins (22Wang J. Hoshino T. Redner R.L. Kajigaya S. Liu J.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10860-10865Crossref PubMed Scopus (458) Google Scholar, 23Grignani F. DeMatteis S. Nervi C. Tomassoni L. Gelmetti V. Cioce M. Fanelli M. Ruthardt M. Ferrara F.F. Zamir I. Seiser C. Grignani F. Lazar M.A. Minucci S. Pelicci P.G. Nature. 1998; 391: 815-818Crossref PubMed Scopus (943) Google Scholar). Recruitment of co-repressors is a common theme in transcriptional repression, because several non-DNA binding co-repressors have been identified that become anchored to DNA by interacting with subsets of sequence-specific transcription factors. These co-repressors include pRb (24LaThangue N.B. Trends Biochem. Sci. 1994; 19: 108-114Abstract Full Text PDF PubMed Scopus (320) Google Scholar), SMRT/NcoR (25Chen J.D. Evans R.M. Nature. 1995; 377: 454-457Crossref PubMed Scopus (1715) Google Scholar, 26Horlein A.J. Naar A.M. Heinzel T. Torchia J. Gloss B. Kurokawa R. Ryan A. Kamei Y. Soderstrom M. Glass C.K. et al.Nature. 1995; 377: 397-403Crossref PubMed Scopus (1714) Google Scholar), Groucho (27Fisher A.L. Caudy M. Genes Dev. 1998; 12: 1931-1940Crossref PubMed Scopus (255) Google Scholar), ETO (28Lutterbach B. Westendorf J.J. Linggi B. Patten A. Moniwa M. Davie J.R. Huynh K.D. Bardwell V.J. Lavinsky R.M. Rosenfeld M.G. Glass C. Seto E. Hiebert S.W. Mol. Cell. Biol. 1998; 18: 7176-7184Crossref PubMed Scopus (370) Google Scholar), and the CtBP family (29Turner J. Crossley M. EMBO J. 1998; 17: 5129-5140Crossref PubMed Scopus (280) Google Scholar). Recently, it has been shown that the EVI-1 Rp domain binds a CtBP family protein mCtBP2 in a yeast two-hybrid assay (29Turner J. Crossley M. EMBO J. 1998; 17: 5129-5140Crossref PubMed Scopus (280) Google Scholar). There are at least two human CtBP proteins, hCtBP1 and hCtBP2 (30Schaeper U. Boyd J.N. Verma S. Uhlmann E. Subramanian T. Chinnadurai G. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10467-10471Crossref PubMed Scopus (309) Google Scholar), two murine homologs, mCtBP1 and mCtBP2 (29Turner J. Crossley M. EMBO J. 1998; 17: 5129-5140Crossref PubMed Scopus (280) Google Scholar), and a Drosophilahomolog, dCtBP (31Nibu Y. Zhang H. Levine M. Science. 1998; 280: 101-104Crossref PubMed Scopus (224) Google Scholar), which, based upon a broad range of binding partners, play crucial roles in a number of biological processes. For example, they are essential to Hairy (32Poortinga G. Watanabe M. Parkhurst S.M. EMBO J. 1998; 17: 2067-2078Crossref PubMed Scopus (208) Google Scholar), Knirps, Snail (31Nibu Y. Zhang H. Levine M. Science. 1998; 280: 101-104Crossref PubMed Scopus (224) Google Scholar), and Kruppel (33Nibu Y. Zhang H. Bajor E. Barolo S. Small S. Levine A. EMBO J. 1998; 17: 7009-7020Crossref PubMed Scopus (174) Google Scholar) activities in early embryonic patterning inDrosophila and mediate the transcriptional repressor activities of key regulators of vertebrate differentiation (δEF1, ZEB, FOG, BKLF (29Turner J. Crossley M. EMBO J. 1998; 17: 5129-5140Crossref PubMed Scopus (280) Google Scholar, 34Furusawa T. Moribe H. Kondoh H. Higashi Y. Mol. Cell. Biol. 1999; 19: 8581-8590Crossref PubMed Google Scholar, 35Postigo A.A. Dean D.C. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6683-6688Crossref PubMed Scopus (227) Google Scholar, 36Holmes M. Turner J. Fox A. Chisholm O. Crossley M. Chong B. J. Biol. Chem. 1999; 274: 23491-23498Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar)) and proliferation (Net, Rb, p130, BRCA1 (37Criqui-Filipe P. Ducret C. Maira S.-M. Wasylyk B. EMBO J. 1999; 18: 3392-3403Crossref PubMed Scopus (137) Google Scholar, 38Meloni A.R. Smith E.J. Nevins J.R. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 9574-9579Crossref PubMed Scopus (167) Google Scholar, 39Yu X. Wu L.J. Bowcock A.M. Aronheim A. Baer R. J. Biol. Chem. 1998; 273: 25388-25392Abstract Full Text Full Text PDF PubMed Scopus (329) Google Scholar)). Although the CtBP proteins have been shown to mediate repressor activity for a number of cellular factors, the role of these interactions in mediating biological activity has not been previously demonstrated in mammalian cells. They are good candidates for mediating aspects of the biological activities of EVI1. CtBP protein binding is mediated by a conserved PLDLS motif (40Schaeper U. Subramanian T. Lim L. Boyd J.M. Chinnadurai G. J. Biol. Chem. 1998; 273: 8549-8552Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar), and there are two potential sites, PFDLT and PLDLS, located in the EVI1 Rp domain. In this study we examine the binding of CtBP and EVI-1 proteins and demonstrate their interaction is necessary for the transformation of Rat1 cells and mediate transcriptional repressor activity. RatFL cells have been described before and Rat1, RatFL, Bosc-23, and 293 cells were all maintained as described previously (21Kilbey A. Stephens V. Bartholomew C. Cell Growth Differ. 1999; 10: 601-610PubMed Google Scholar). Procedures for transfections, production of helper free recombinant retrovirus, retroviral infections, growth in soft agar, CAT, and β-galactosidase assays have all been described previously (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar). Cells infected with the zeocin resistance marker (zeo)-containing retroviral vectors were selected and maintained in 1 mg/ml zeocin (Invitrogen). The zeocin gene was initially PCR-amplified with oligonucleotides 1 and 2 and inserted as aBamHI/SalI fragment into pMK20 (gift, C. Stocking). Retroviral vectors p50MX-zeo and p50MΔZF1-zeo were created by replacing the 6418 resistance marker (neo) gene of p50MX-neo (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar) and p50MΔZF1-neo (19Kilbey A. Bartholomew C. Oncogene. 1998; 16: 2287-2291Crossref PubMed Scopus (33) Google Scholar) with a 300-bp EcoRI/SalI zeocin gene fragment from the pMK20 subclone. p50MΔZF1/2-zeo was created by simultaneously ligating 1450-bpNotI/BamHI and 660-bpBamHI/EcoRI PCR fragments derived from the Evi-1 cDNA pBS21 (41Morishita K. Parker D.S. Mucenski M.L. Jenkins N.A. Copeland N.G. Ihle J.N. Cell. 1988; 54: 831-840Abstract Full Text PDF PubMed Scopus (356) Google Scholar) using oligonucleotides 3/4 and 5/6, respectively, into NotI/EcoRI-digested p50MX-zeo. p50MΔRp521–633-neo was created by simultaneous ligation ofNotI/BamHI and BamHI/EcoRI fragments generated by PCR of pBS21 with oligonucleotides 7/8 and 9/6, respectively, into NotI/EcoRI-digested p50MX-neo. The yeast vector pGBT9 (CLONTECH) was modified by replacing the SstI site with NotI, utilizingNotI linkers (New England BioLabs), to create pGBT9N. The vector pGBT9Rp was created by inserting anEcoRI/NotI fragment from pGEV514/724 (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar) into pGBT9N. pGBT9RpΔ514–631 was created by insertingEcoRI/NotI fragments, derived by PCR of pBS21 using oligonucleotides 10 and 11 intoEcoRI/NotI-digested pGBT9N. A cassette containing the Rp domain of Evi-1 encompassing amino acids 521–724 was created by PCR of pBS21 using oligonucleotides 12/13 and inserted as an EcoRI/BamHI fragment into pBluescript KSII (Stratagene). This wild type sequence, designated RpWT was then inserted into pGBT9 as an EcoRI/BamHI fragment producing pGBT9RpWT, into pSG424 as anEcoRI/XhoI fragment producing pSG424RpWT, and as a BglII/BamHI fragment into the BamHI site of p50MΔRp-neo to create p50MFLRpWT-neo. Similarly, mutant Rp domain cassettes, created by site-directed mutagenesis, were inserted as EcoRI/BamHI-digested fragments into pBluescriptKSII to create pKSIICtBPa and pKSIICtBPb. The CtBPa/b double-mutant was created by ligatingEcoRI/Eco0109I andEco0109I/BamHI fragments from pKSIICtBPa and pKSIICtBPb, respectively, intoEcoRI/BamHI-digested pBluescript KSII. The various mutant Rp domain cassettes were subsequently introduced into expression vectors as described above to create pGBT9ΔRpCtBPa, pGBT9ΔRpCtBPb, pGBT9ΔRpCtBPa/b, pSG424ΔRpCtBPa, pSG424ΔRpCtBPb, pSG424ΔRpCtBPa/b, p50MFLRpΔa, p50MFLRpΔb, and p50MFLRpΔa/b. Creation of the Myc-tagged EVI1 expression vector will be described elsewhere. 2A. Gill, unpublished.FLAG-tagged mCtBP2 was created by replacing Smad2 in pCMV5B-FLAGSmad2 (gift of Dr. J. Wrana, Toronto) with aSalI/SmaI mCtBP2 fragment PCR-amplified from pGAD424mCtBP2 with oligonucleotides 18 and 19. Site-directed mutants were created using a PCR-based procedure. Briefly, mutation ΔCtBPa was created in two steps. First, PCR reactions were performed with oligonucleotides 12/14 and 15/13 using pBS21 template DNA. The amplified fragments were diluted to 2 ng/µl and mixed, and 20 ng of the mixture was re-amplified by PCR using oligonucleotide primers 12/13 to create an RpΔCtBPa fragment. Creation of the RpΔCtBPb fragment was the same except oligonucleotides 12/16 and 17/13 were utilized in the first PCR reaction. The oligonucleotides were as follows: 1, AATTGGATCCACCATGGCCAAGTTGACCAGTGC; 2, AATTGGATCCTGCTGTTCATGAAGAGCGAAGACT; 3, AATTCGGGCCGCTGCTGTTCATGGAGGGCAAGAACCATT; 4, AAGCTGGATCGTAGCGCTCTTTCCCCT; 5, AAGCTGGATCCGAGAACGGCAACATGTC; 6, AGCTGAATTCATACATGGCTTATGGACTGGAT; 7, AATTGCGGCCGCTGCTGTTCATGAAGAGTGAAGAAGG; 8, AAGCTGGATCCGTACATTGATTGAGAGA; 9, AAGGGATCCCCCTTCTTCATGGACCC; 10, GGAAGAATTCCCCACTCCCTTCTTC; 11, AATTGCGGCCGCTCAGTAGCGCTCTTTCCCCT; 12, AAGCTGAATTCAGATCTCCATTTCCTGATAGAGA; 13, AAGCTGGATCCGTAGCGCTCTTTCCCCT; 14, CCTTTTGCCTCCACCACTAAGAGAAAGGAT; 15, AAGTGGTGGAGGCAAAAGGGGACTCAGAGCTTCC; 16, CCCCTGGCTTCAAGTATGGGCAGTAGGGGTAGA; 17, CCATACTTGAAGCCAGGGGCTGGTCTTGGCTTGT; 18, AAGCTGTCGACTTGTGGATAAGCACAA; 19, AAGCTCCCGGGCT- ATTGCTCGTTGGGGT. Specific DNA sequences were amplified by PCR as described previously (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar). DNA amplification was performed using a PTC-100 96AgVH Programmable Thermal Controller (MJ Research, Inc.). PCR products were either purified directly or resolved by agarose gel electrophoresis and purified, using a NucleoSpin extraction kit (CLONTECH). Nucleotide sequences of constructs were confirmed by sequencing using BigDye Terminator Cycle Sequencing (PE Applied Biosystems) and analysis on an ABI 373A automated sequencer. Total cellular RNAs were prepared from asynchronous exponentially dividing cultures of cells with RNazol B (Biogenesis Ltd.). Northern blots were performed with 20 µg of total RNA/lane as described previously (42Bartholomew C. Ihle J.N. Mol. Cell. Biol. 1991; 11: 1820-1828Crossref PubMed Scopus (87) Google Scholar). Whole cell extracts were prepared as described previously (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar). Proteins were examined by SDS-polyacrylamide gel electrophoresis, transferred to Hybond-ECL nitrocellulose, incubated with appropriate antibodies, and visualized with an ECL Western blotting detection system (Amersham Pharmacia Biotech). Yeast strains SFY526 and AH109 (CLONTECH) were used. YPD media and liquid culture β-galactosidase assays were as described for the MATCHMAKER two-hybrid system (CLONTECH). Synthetic drop out media was prepared as 0.67% yeast nitrogen base without amino acids (Difco laboratories), 0.06% CSM-HIS-LEU-TRP-URA (Bio 101, Inc.), 2% glucose, pH 5.8, and + or −1.5% select agar (Life Technologies, Inc.) or 20 µg/ml l-histidine HCl (Sigma, H-9511). Yeast cells were transformed by a procedure based on LiOAc. Briefly, yeast cultures were grown in YPD overnight at 30 °C and sequentially pelleted and washed in 50%, 20%, and 0.72% volumes of sterile distilled water, SORB (100 mm LiOAc, 10 mmTris/HCl, pH 8, 1 mm EDTA, pH 8, 1 m sorbitol), and 1 mg/ml salmon sperm DNA. Competent cells were transformed by the addition of plasmid DNA and six volumes of PLATE (100 mm LiOAc, 10 mm Tris/HCl, pH 8, 1 mm EDTA, pH 8, 40% polyethylene glycol 3350), at 20 °C for 30 min. Me2SO was added to 10% and incubated at 42 °C for 15 min, then at 0 °C for 1 min, and cells were pelleted, resuspended, and plated in appropriate synthetic drop-out media. Cells were scraped into 0.25 ml of IP buffer (43Matsushime H. Quelle D.E. Shurtleff S.A. Shibuya M. Sherr C.J. Kato J.Y. Mol. Cell. Biol. 1994; 14: 2066-2076Crossref PubMed Scopus (1027) Google Scholar), rapidly frozen, thawed at 0 °C for 1 h, then microcentrifuged at 13,000 rpm for 10 min at 4 °C. The supernatant was removed, 25 µl was aliquoted as whole cell extract for Western blotting, and the remainder was incubated overnight with 1 µl of FLAG M2 antibody (Sigma, F3165) at 4 °C and subsequently incubated with 50 µl of 50% slurry of rabbit anti-mouse IgG-coated protein A-Sepharose beads for 2 h at 4 °C. The beads were washed three times in IP buffer and prepared for Western blot analysis. We examined the ability of various murine Evi-1 mutant proteins to revert the transformed phenotype of RatFL cells (21Kilbey A. Stephens V. Bartholomew C. Cell Growth Differ. 1999; 10: 601-610PubMed Google Scholar), which express the full-length Evi-1 (FL) protein. Retroviral vectors containing either a zeocin-selectable marker alone (p50MX-zeo) or encoding Evi-1 mutant proteins that lack either the ZF1 (p50MΔZF1-zeo) or both ZF1 and ZF2 (p50MΔZF1/ZF2) DNA binding domains were used to infect RatFL cells, and zeocin-resistant cell lines were isolated. The growth of cell lines, selected because the mutant proteins were expressed at either similar or higher levels than the full-length protein (Fig.1), were examined in soft agar. Both ΔZF1 and ΔZF1/ZF2 proteins behave as dominant negative mutants, reverting the transformed phenotype of RatFL cells as demonstrated by the inhibition of colony formation in soft agar (Fig. 1,RatFL, ΔZF1,ΔZF1/ZF2), whereas expression of zeo alone has no effect (Fig. 1, Zeo). The ability of the non-DNA binding ΔZF1/ZF2 protein to act in a dominant negative fashion suggests that it can bind to, compete for, and sequester cellular factors necessary for Evi-1 biological activity. Recently, it has been shown that the repressor domain binds CtBP proteins (29Turner J. Crossley M. EMBO J. 1998; 17: 5129-5140Crossref PubMed Scopus (280) Google Scholar). The Rp domain-dependent Evi-1 repressor and cell transformation activities have been shown in human 293 embryo kidney cells and Rat1 fibroblasts, respectively, and Northern blot analysis with an mCtBP2-specific probe confirmed both cell lines express this gene (data not shown). To determine if CtBP interactions might be required for Evi-1 biological activity we compared mCtBP2 binding activity in yeast two-hybrid assays with the Evi-1 repressor domain and a deletion mutant that lacks two CtBP PLDLS-like binding motifs located at amino acids 553–557 (CtBPa) and 584–588 (CtBPb). The yeast expression vectors pGBT9Rp and pGBT9ΔRp, containing Evi-1 residues 514–724 and 632–724, respectively, fused in-frame with the GAL4 DNA binding domain (DBD), were introduced into yeast strain SFY526 in combination with pGAD424mCtBP2 encoding a GAL4 activation domain (AD) mCtBP2 fusion protein. Yeast cells expressing only ADmCtBP2 and DBDRp produce active β-galactosidase (Fig. 2 A) clearly demonstrating a functional interaction between these proteins. However, binding activity is lost upon deletion of the repressor domain between amino acids 514 and 631, which includes the two potential CtBP interaction sites (Fig. 2 A,ΔRp). The interaction between Evi-1 and mCtBP2 was independently confirmed by co-immunoprecipitation studies utilizing Evi-1myc and FLAGmCtBP2 epitope-tagged expression vectors. Western blot analysis of anti-FLAG M2-immunoprecipitated cell extracts, with anti-myc 9E10, detects the Evi1myc fusion protein only in cell extracts containing both Evi1myc and FLAGmCtBP2 epitope-tagged proteins (Fig. 2 B), demonstrating the two proteins can interact in mammalian cells. To see if CtBP binding correlates with Evi-1 transforming activity, we examined growth in soft agar of various recombinant retrovirus-infected cell populations. Rat1 cells expressing either FL, ΔRp, or ΔRp521–633 Evi-1 proteins (Fig. 2 C) were isolated. Macroscopic colonies were observed with populations of cells expressing the entire Evi-1 protein (Fig. 2 C, FL). Cells expressing mutants lacking the entire Rp domain, just a partial deletion encompassing both potential CtBP sites, or neo alone produced significantly fewer colonies (Fig. 2 C,ΔRp, ΔRp521–633,Neo). The deletion mutant studies show a correlation between CtBP binding and Evi-1 biological activity. To directly determine the role of CtBP co-repressors, site-directed mutations were made to destroy the two potential CtBP binding sites in the Evi-1 repressor domain. Previous studies have shown that mutation of the consensus CtBP binding motif PLDLS to PLASS blocks CtBP binding to E1A (40Schaeper U. Subramanian T. Lim L. Boyd J.M. Chinnadurai G. J. Biol. Chem. 1998; 273: 8549-8552Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar). Similar changes were made in the Evi-1 Rp domain CtBP-like binding sites, converting PFDLT (CtBPa) and PLDLS (CtBPb) to PFAST (RpΔa) and PLASS (RpΔb), respectively. The wild type and mutant Rp sequences were inserted in-frame back into the Evi-1 mutant cDNA of p50MΔRp-neo (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar) to recreate full-length Evi-1 retroviral vectors (Fig. 3). Rat1 cells were infected with the recombinant retroviruses and G418-resistant cell populations isolated. The growth properties of the various Rat1 cell lines were examined in soft agar to determine the impact of these mutations on Evi-1 biological activity. Numerous macroscopic colonies were produced in cells expressing FLRpWT (Fig. 3), demonstrating that reconstruction of full-length Evi-1 with wild type RpWT sequences creates a protein with similar properties to the wild type protein. Rat1 cells expressing the FLRpΔa mutation still show moderate transforming activity (Fig. 3). However, a dramatic reduction in colony formation is seen with either the FLRpΔb or FLRpΔa/b proteins (Fig. 3), showing that the CtBPa site is partially required and the CtBPb site is essential to biological activity of the Evi-1 protein. Western blot analysis of cell extracts with Evi-1-specific antibodies (1806) revealed that equal amounts of the proteins were expressed that were indistinguishable in size from the wild type Evi-1 protein (Fig.3). This showed that we had successfully recreated and expressed full-length wild type and mutant proteins in each case. CtBP binding of the various site-directed mutants were tested in yeast. The wild type and mutant Rp domain-encoding fragments were inserted in-frame with the DBD of pGBT9. These constructs were introduced into the yeast strain AH109 with pGAD424mCtBP2 and protein interactions assessed using the β-galactosidase assay. As expected the wild type Rp domain (DBDRpWT) binds ADmCtBP2 as indicated by the production of β-galactosidase activity (Fig. 4 A). However, binding of the CtBPa site mutant (DBDRpΔa) is significantly impaired and an even more severe loss of binding is observed with the CtBPb and CtBPa/b site mutations (Fig. 4 A,DBDRpΔb, DBDRpΔa/b). Both Rp domain CtBP sites a or b can complement AH109 cell growth on media lacking histidine in the presence of mCtBP2, indicating that these sites can independently bind this protein (Fig. 4 B). These results show that mutations of the CtBP sites reduce CtBP binding and that there is a direct correlation of binding activity with transforming activity of Evi-1 proteins containing these mutations. Finally we determined if CtBP binding is necessary for Evi-1 repressor activity. The Rp wild type and mutant fragments were inserted in-frame with the DBD of the mammalian expression vector pSG424. We examined the ability of these constructs to inhibit lexA VP16 induction of the reporter construct pL8G5CAT in transiently transfected kidney 293 cells, as we have described previously (16Bartholomew C. Kilbey A. Clark A.M. Walker M. Oncogene. 1997; 14: 569-577Crossref PubMed Scopus (65) Google Scholar). As expected the wild type Rp sequence represses 80% of lexA VP16 induction of reporter activity, whereas the vector alone has no inhibitory effect (Fig. 5,RpWT, DBD). The CtBPa mutation only partially relieves repressor activity, but the CtBPb and CtBPa/b mutations significantly reduce it to 30% (Fig. 5, RpΔa,RpΔb, RpΔa/b). Western blot analysis of cell extracts with GAL4DBD-specific antibodies revealed that equal amounts of the expected size DBD fusion proteins were expressed in each case. Therefore, the Evi-1 Rp CtBP binding sites mediate transcriptional repressor activity in kidney 293 cells. Several invertebrate and vertebrate transcriptional repressor proteins have previously been shown to bind CtBP proteins through evolutionarily highly conserved PLDLS motifs to mediate transcriptional repression. These specific interactions are very likely to be required for some or all of their biological properties, but this has not been previously shown. However, we now show for the first time that CtBP proteins interact with the Evi-1 transcriptional repressor. We demonstrate that this interaction is required for at least one of the known biological activities of the Evi-1 protein, transformation of Rat1 fibroblasts, and in addition transcriptional repressor activity. CtBP binds Evi-1 site b (PLDLSMG) more efficiently in yeast than site a (PFDLTTK), which probably reflects its closer similarity to the consensus core binding site P-DLS (29Turner J. Crossley M. EMBO J. 1998; 17: 5129-5140Crossref PubMed Scopus (280) Google Scholar). This relative binding activity reflects the situation in mammalian cells, because the greater affinity of site b correlates with the greater impact its mutation has on the efficiency of both Evi-1-mediated cell transformation and transcriptional repressor activity. Thus, mutation of just site b is sufficient to block the vast majority of repressor and transforming activities. However, in each case optimal binding, transcriptional repression, and transformation requires both sites (Figs. Figure 3, Figure 4, Figure 5). CtBP proteins can dimerize (32Poortinga G. Watanabe M. Parkhurst S.M. EMBO J. 1998; 17: 2067-2078Crossref PubMed Scopus (208) Google Scholar), and the presence of two adjacent Evi-1 binding sites in the Rp domain might enhance dimerization, which could be necessary to either stabilize intermolecular interactions and/or be necessary for function. In this study we have demonstrated that Evi-1 binds to mCtBP2, which is expressed in 293 and Rat1 cells. There are two murine CtBP genes, mCtBP1 and mCtBP2, which appear to have similar binding specificities (34Furusawa T. Moribe H. Kondoh H. Higashi Y. Mol. Cell. Biol. 1999; 19: 8581-8590Crossref PubMed Google Scholar) and are both likely to bind Evi-1. Therefore, mCtBP1 and mCtBP2 are equally likely to mediate Evi-1 biological activity, but the status of mCtBP1 expression in 293 and Rat1 cells is not known. Interestingly, whole mount in situ hybridization and Northern blot analysis in the mouse show that mCtBP1 is expressed more generally in embryonic and adult tissues, whereas mCtBP2 expression is spatially restricted in the developing embryo (34Furusawa T. Moribe H. Kondoh H. Higashi Y. Mol. Cell. Biol. 1999; 19: 8581-8590Crossref PubMed Google Scholar). Of particular interest is the high level of mCtBP2 expression in the limb buds and dorsal root ganglia of day 10.5 post coitum mouse embryos, which overlaps with the highest levels of Evi-1 expression observed (15Hoyt P.R. Bartholomew C. Davis A.J. Yutzey K. Gomer L.M. Potter S.S. Ihle J.N. Mucenski M.L. Mech. Dev. 1997; 65: 55-70Crossref PubMed Scopus (136) Google Scholar). This strongly suggests that mCtBP2 is important to the role of Evi-1 in development, because Evi-1 FL null mouse embryos have multiple defects, including underdeveloped or absent limb buds and no peripheral nervous system (15Hoyt P.R. Bartholomew C. Davis A.J. Yutzey K. Gomer L.M. Potter S.S. Ihle J.N. Mucenski M.L. Mech. Dev. 1997; 65: 55-70Crossref PubMed Scopus (136) Google Scholar). However, probably not all Evi-1 functions are mediated by CtBP proteins, because these mutant mice also have severe heart defects where mCtBP1 and mCtBP2 are not expressed (34Furusawa T. Moribe H. Kondoh H. Higashi Y. Mol. Cell. Biol. 1999; 19: 8581-8590Crossref PubMed Google Scholar). Although it is well established that CtBP proteins are co-repressors, their mechanism of action is unknown. There are mixed reports, suggesting CtBP proteins need deacetylase activity to repress transcription. One report shows CtBP-dependent repression is sensitive to histone deacetylase inhibitors (37Criqui-Filipe P. Ducret C. Maira S.-M. Wasylyk B. EMBO J. 1999; 18: 3392-3403Crossref PubMed Scopus (137) Google Scholar), whereas another contradicts this (38Meloni A.R. Smith E.J. Nevins J.R. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 9574-9579Crossref PubMed Scopus (167) Google Scholar). It has been reported that hCtBP1 binds histone deacetylase (44Sundqvist A. Sollerbrandt K. Svensson C. FEBS Lett. 1998; 429: 183-188Crossref PubMed Scopus (90) Google Scholar). Curiously, a highly homologous and either new member or isoform of the CtBP family designated CtBP3, involved in Golgi structure and function, has intrinsic acyl transferase activity (45Weigert R. Silletta M.G. Spano S. Turacchio G. Cericola C. Colanzi A. Senatore S. Mancini R. Polishchuk E.V. Salmona M. Facchiano F. Burger K.N.J. Mironov A. Luini A. Corda D. Nature. 1999; 402: 429-433Crossref PubMed Scopus (280) Google Scholar). Alternatively, it has been proposed that CtBP proteins might repress transcription by generating specific areas of heterochromatin, possibly by bridging interactions between sequence-specific transcription factors and Polycomb group complex proteins, which are involved in silencing homeotic genes (46Sewalt R.G.A.B. Gunster M.J. van der Vlag J. Satijn D.P.E. Otte A.P. Mol. Cell. Biol. 1999; 19: 777-787Crossref PubMed Scopus (162) Google Scholar). Recently, Evi-1 has been shown to inhibit transforming growth factor-β signaling by the ZF1 domain interacting with Smad3 (47Kurokawa M. Mitani K. Irie K. Matsuyama T. Takahashi T. Chiba S. Yazaki Y. Matsumoto K. Hirai H. Nature. 1998; 394: 92-96Crossref PubMed Scopus (303) Google Scholar). These studies also show that the Rp domain is necessary for transforming growth factor-β blocking activity. One possibility is that Smad3 binds Evi-1, which then recruits a repressor complex containing CtBP to block signaling. Although the transforming growth factor-β blocking activity is dependent upon amino acids 608–732 of Rp (47Kurokawa M. Mitani K. Irie K. Matsuyama T. Takahashi T. Chiba S. Yazaki Y. Matsumoto K. Hirai H. Nature. 1998; 394: 92-96Crossref PubMed Scopus (303) Google Scholar), which are outside the CtBP sites, such gross deletions might create changes in protein conformation that prevent binding. This possibility is currently under investigation. The Evi-1 dominant negative mutants described in this study are likely to act by two distinct mechanisms. Evi-1 mutants, which lack ZF1, are non-transforming in Rat1 fibroblasts (19Kilbey A. Bartholomew C. Oncogene. 1998; 16: 2287-2291Crossref PubMed Scopus (33) Google Scholar), and competition for endogenous ZF2 DNA binding sites between the defective and wild type proteins is the most plausible explanation of dominant negative activity in this case. Evi-1 mutants, which lack the Rp domain but retain ZF1 and ZF2, also have dominant negative activity (data not shown) supporting the competitive DNA binding mechanism. The dominant negative mutant, which lacks both zinc finger DNA binding domains, most likely sequesters factors that Evi-1 needs to transform cells. Our results suggest CtBP might be such a factor but do not eliminate the possibility that other factors are involved. Therefore, these results show that the expression of partial Evi-1 polypeptides, which either compete for DNA binding activity or co-factors like CtBP, inhibit Evi-1 activity and suggest that smaller peptides designed to block the same targets could be the basis of effective therapeutic agents. The murine Evi-1 PFDLTTK and PLDLSMG motifs are absolutely conserved in the human EVI1 primary amino acid sequence and, therefore, are very likely to be required for its biological activity as well. The interaction of human EVI1 and CtBP proteins might therefore be necessary in the development of leukemias where either EVI1 or EVI1 fusion proteins are produced. In the case of AML1/EVI1 fusion proteins, EVI1 might be required to recruit a repressor complex comprising CtBP proteins to AML1 DNA binding sites in analogy to ETO recruiting NCoR·mSin3·HDAC1 complexes for the AML1/ETO fusion protein (22Wang J. Hoshino T. Redner R.L. Kajigaya S. Liu J.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10860-10865Crossref PubMed Scopus (458) Google Scholar). A possible role for CtBP proteins in the development of leukemias has not been described before. These studies suggest a potential pharmacological use for peptides containing the PLDLS motif in blocking the interaction between EVI1 and CtBP proteins in the treatment of some acute myeloid leukemias, chronic myelogenous leukemias in blast crisis (48Ogawa S. Kurokawa M. Tanaka T. Tanaka K. Hangaishi A. Mitani K. Kamada N. Yazaki Y. Hirai H. Leukemia. 1996; 10: 788-794PubMed Google Scholar), and myelodysplasias (49Russell M. List A. Greenberg P. Woodward S. Glinsmann B. Parganas E. Ihle J. Taetle R. Blood. 1994; 84: 1243-1248Crossref PubMed Google Scholar) where EVI-1 is expressed. We thank Robert McFarlane and the Molecular Technology Services at the Beatson Institute for Cancer Research for sequencing." @default.
• W2022602233 created "2016-06-24" @default.
• W2022602233 creator A5000256814 @default.
• W2022602233 creator A5003112071 @default.
• W2022602233 creator A5011444996 @default.
• W2022602233 creator A5038686653 @default.
• W2022602233 creator A5074741400 @default.
• W2022602233 creator A5082132713 @default.
• W2022602233 creator A5082578710 @default.
• W2022602233 date "2001-07-01" @default.
• W2022602233 modified "2023-09-30" @default.
• W2022602233 title "Evi-1 Transforming and Repressor Activities Are Mediated by CtBP Co-repressor Proteins" @default.
• W2022602233 cites W1486948598 @default.
• W2022602233 cites W1532921008 @default.
• W2022602233 cites W1578441131 @default.
• W2022602233 cites W1633576971 @default.
• W2022602233 cites W1967354329 @default.
• W2022602233 cites W1969917440 @default.
• W2022602233 cites W1973962332 @default.
• W2022602233 cites W1995303485 @default.
• W2022602233 cites W2009469731 @default.
• W2022602233 cites W2011360841 @default.
• W2022602233 cites W2041425399 @default.
• W2022602233 cites W2042426290 @default.
• W2022602233 cites W2047871075 @default.
• W2022602233 cites W2048122656 @default.
• W2022602233 cites W2048835029 @default.
• W2022602233 cites W2051973529 @default.
• W2022602233 cites W2061480425 @default.
• W2022602233 cites W2063014741 @default.
• W2022602233 cites W2065610746 @default.
• W2022602233 cites W2067645150 @default.
• W2022602233 cites W2069532898 @default.
• W2022602233 cites W2083180068 @default.
• W2022602233 cites W2087876663 @default.
• W2022602233 cites W2088992304 @default.
• W2022602233 cites W2099684877 @default.
• W2022602233 cites W2100885802 @default.
• W2022602233 cites W2113702322 @default.
• W2022602233 cites W2115549977 @default.
• W2022602233 cites W2125668148 @default.
• W2022602233 cites W2130463979 @default.
• W2022602233 cites W2151240250 @default.
• W2022602233 cites W2160863166 @default.
• W2022602233 cites W2162540931 @default.
• W2022602233 cites W2164916497 @default.
• W2022602233 cites W2171915984 @default.
• W2022602233 cites W2331620970 @default.
• W2022602233 cites W2333649085 @default.
• W2022602233 cites W2404422179 @default.
• W2022602233 cites W4229958257 @default.
• W2022602233 doi "https://doi.org/10.1074/jbc.m102343200" @default.
• W2022602233 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11328817" @default.
• W2022602233 hasPublicationYear "2001" @default.
• W2022602233 type Work @default.
• W2022602233 sameAs 2022602233 @default.
• W2022602233 citedByCount "94" @default.
• W2022602233 countsByYear W20226022332012 @default.
• W2022602233 countsByYear W20226022332013 @default.
• W2022602233 countsByYear W20226022332014 @default.
• W2022602233 countsByYear W20226022332015 @default.
• W2022602233 countsByYear W20226022332016 @default.
• W2022602233 countsByYear W20226022332017 @default.
• W2022602233 countsByYear W20226022332018 @default.
• W2022602233 countsByYear W20226022332019 @default.
• W2022602233 countsByYear W20226022332020 @default.
• W2022602233 countsByYear W20226022332021 @default.
• W2022602233 countsByYear W20226022332022 @default.
• W2022602233 countsByYear W20226022332023 @default.
• W2022602233 crossrefType "journal-article" @default.
• W2022602233 hasAuthorship W2022602233A5000256814 @default.
• W2022602233 hasAuthorship W2022602233A5003112071 @default.
• W2022602233 hasAuthorship W2022602233A5011444996 @default.
• W2022602233 hasAuthorship W2022602233A5038686653 @default.
• W2022602233 hasAuthorship W2022602233A5074741400 @default.
• W2022602233 hasAuthorship W2022602233A5082132713 @default.
• W2022602233 hasAuthorship W2022602233A5082578710 @default.
• W2022602233 hasBestOaLocation W20226022331 @default.
• W2022602233 hasConcept C101762097 @default.
• W2022602233 hasConcept C104317684 @default.
• W2022602233 hasConcept C150194340 @default.
• W2022602233 hasConcept C158448853 @default.
• W2022602233 hasConcept C185592680 @default.
• W2022602233 hasConcept C55493867 @default.
• W2022602233 hasConcept C62944979 @default.
• W2022602233 hasConcept C86339819 @default.
• W2022602233 hasConcept C86803240 @default.
• W2022602233 hasConcept C95444343 @default.
• W2022602233 hasConceptScore W2022602233C101762097 @default.
• W2022602233 hasConceptScore W2022602233C104317684 @default.
• W2022602233 hasConceptScore W2022602233C150194340 @default.
• W2022602233 hasConceptScore W2022602233C158448853 @default.
• W2022602233 hasConceptScore W2022602233C185592680 @default.
• W2022602233 hasConceptScore W2022602233C55493867 @default.
• W2022602233 hasConceptScore W2022602233C62944979 @default.
• W2022602233 hasConceptScore W2022602233C86339819 @default.
• W2022602233 hasConceptScore W2022602233C86803240 @default.
• W2022602233 hasConceptScore W2022602233C95444343 @default.

• next