FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022668082> ?p ?o ?g. }

• W2022668082 endingPage "6654" @default.
• W2022668082 startingPage "6648" @default.
• W2022668082 abstract "The assembly of iron-sulfur (Fe-S) clusters involves several pathways and in prokaryotes the mobilization of the sulfur (SUF) system is paramount for Fe-S biogenesis and repair during oxidative stress. The prokaryotic SUF system consists of six proteins: SufC is an ABC/ATPase that forms a complex with SufB and SufD, SufA acts as a scaffold protein, and SufE and SufS are involved in sulfur mobilization from cysteine. Despite the importance of Fe-S proteins in higher plant plastids, little is known regarding plastidic Fe-S cluster assembly. We have recently shown that Arabidopsis harbors an evolutionary conserved plastidic SufC protein (AtNAP7) capable of hydrolyzing ATP and interacting with the SufD homolog AtNAP6. Based on this and the prokaryotic SUF system we speculated that a SufB-like protein may exist in plastids. Here we demonstrate that the Arabidopsis plastid-localized SufB homolog AtNAP1 can complement SufB deficiency in Escherichia coli during oxidative stress. Furthermore, we demonstrate that AtNAP1 can interact with AtNAP7 inside living chloroplasts suggesting the presence of a plastidic AtNAP1·AtNAP6·AtNAP7 complex and remarkable evolutionary conservation of the SUF system. However, in contrast to prokaryotic SufB proteins with no associated ATPase activity we show that AtNAP1 is an iron-stimulated ATPase and that AtNAP1 is capable of forming homodimers. Our results suggest that AtNAP1 represents an atypical plastidic SufB-like protein important for Fe-S cluster assembly and for regulating iron homeostasis in Arabidopsis. The assembly of iron-sulfur (Fe-S) clusters involves several pathways and in prokaryotes the mobilization of the sulfur (SUF) system is paramount for Fe-S biogenesis and repair during oxidative stress. The prokaryotic SUF system consists of six proteins: SufC is an ABC/ATPase that forms a complex with SufB and SufD, SufA acts as a scaffold protein, and SufE and SufS are involved in sulfur mobilization from cysteine. Despite the importance of Fe-S proteins in higher plant plastids, little is known regarding plastidic Fe-S cluster assembly. We have recently shown that Arabidopsis harbors an evolutionary conserved plastidic SufC protein (AtNAP7) capable of hydrolyzing ATP and interacting with the SufD homolog AtNAP6. Based on this and the prokaryotic SUF system we speculated that a SufB-like protein may exist in plastids. Here we demonstrate that the Arabidopsis plastid-localized SufB homolog AtNAP1 can complement SufB deficiency in Escherichia coli during oxidative stress. Furthermore, we demonstrate that AtNAP1 can interact with AtNAP7 inside living chloroplasts suggesting the presence of a plastidic AtNAP1·AtNAP6·AtNAP7 complex and remarkable evolutionary conservation of the SUF system. However, in contrast to prokaryotic SufB proteins with no associated ATPase activity we show that AtNAP1 is an iron-stimulated ATPase and that AtNAP1 is capable of forming homodimers. Our results suggest that AtNAP1 represents an atypical plastidic SufB-like protein important for Fe-S cluster assembly and for regulating iron homeostasis in Arabidopsis. Iron-sulfur (Fe-S) 1The abbreviations used are: Fe-S, iron-sulfur; SUF, mobilization of sulfur; ABC, ATP-binding cassette; NIF, nitrogen fixation; ISC, iron-sulfur cluster; LAF6, long after far-red 6; NAP, non-intrinsic ABC protein; YFP, yellow fluorescence protein; PMS, phenazine methosulfate; BD, DNA binding domain; AD, activation domain; RT, reverse transcriptase. 1The abbreviations used are: Fe-S, iron-sulfur; SUF, mobilization of sulfur; ABC, ATP-binding cassette; NIF, nitrogen fixation; ISC, iron-sulfur cluster; LAF6, long after far-red 6; NAP, non-intrinsic ABC protein; YFP, yellow fluorescence protein; PMS, phenazine methosulfate; BD, DNA binding domain; AD, activation domain; RT, reverse transcriptase. clusters are important cofactors of Fe-S proteins involved in numerous vital biological processes in all organisms studied (1Beinert H. Holm R.H. Munck E. Science. 1997; 277: 653-659Crossref PubMed Scopus (1486) Google Scholar, 2Beinert H. Kiley P.J. Curr. Opin. Chem. Biol. 1999; 3: 152-157Crossref PubMed Scopus (176) Google Scholar). Although Fe-S clusters are derived from two of the most abundant elements on earth they are not formed spontaneously but arise by controlled biosynthesis requiring an intricate interplay of numerous proteins (3Lill R. Kispal G. Trends Biochem. Sci. 2000; 25: 352-356Abstract Full Text Full Text PDF PubMed Scopus (316) Google Scholar, 4Frazzon J. Dean D.R. Curr. Opin. Chem. Biol. 2003; 7: 166-173Crossref PubMed Scopus (183) Google Scholar). Most research on Fe-S cluster assembly has come from studies on bacteria, and it is clear that three bacterial systems exist termed NIF (nitrogen fixation), ISC (iron-sulfur cluster), and SUF (mobilization of sulfur) (5Takahashi Y. Tokumoto U. J. Biol. Chem. 2002; 277: 28380-28383Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar, 6Loiseau L. Ollagnier-de-Choudens S. Nachin L. Fontecave M. Barras F. J. Biol. Chem. 2003; 278: 38352-38359Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). The NIF system is specifically involved in the assembly and maturation of Fe-S clusters in nitrogenase proteins found in nitrogen-fixing bacteria and ϵ-proteobacteria (7Jacobsen M.R. Cash V.L. Weiss M.C. Laird N.F. Newton W.E. Dean D.R. Mol. Gen. Genet. 1989; 219: 49-57Crossref PubMed Scopus (244) Google Scholar, 8Olson J.W. Agar J.N. Johnson M.K. Maier R.J. Biochemistry. 2000; 39: 16213-16219Crossref PubMed Scopus (85) Google Scholar), whereas the ISC system is more generally involved in the biosynthesis of numerous Fe-S proteins in both bacteria and higher eukaryotes (9Zheng L. Cash V.L. Flint D.H. Dean D.R. J. Biol. Chem. 1998; 273: 13264-13272Abstract Full Text Full Text PDF PubMed Scopus (571) Google Scholar, 10Takahashi Y. Nakamura M.J. Biochem. J. (Tokyo). 1999; 126: 917-926Crossref Scopus (225) Google Scholar, 11Schwartz C.J. Djaman O. Imlay J.A. Kiley P.J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9009-9014Crossref PubMed Scopus (254) Google Scholar).The suf operon (sufABCDSE) represents the third Fe-S system and the relationship between the different Suf proteins during Fe-S cluster formation has recently been reported. SufB, SufC, and SufD seem to be evolutionary conserved and in bacteria SufC, which is an ATP binding cassette (ABC)/ATPase, forms a complex with SufB and SufD (6Loiseau L. Ollagnier-de-Choudens S. Nachin L. Fontecave M. Barras F. J. Biol. Chem. 2003; 278: 38352-38359Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 12Rangachari K. Davis C.T. Eccleston J.F. Hirst E.M. Saldanha J.W. Strath M. Wilson R.J. FEBS Lett. 2002; 514: 225-228Crossref PubMed Scopus (58) Google Scholar, 13Nachin L. Loiseau L. Expert D. Barras F. EMBO J. 2003; 22: 427-437Crossref PubMed Scopus (219) Google Scholar). Although it is thought that this SufC·SufB·SufD complex acts as an ATP-driven energizer during Fe-S cluster assembly the role of SufB and SufD remains unknown. SufE interacts with SufS involved in cysteine desulfuration to mobilize sulfur and although SufE is capable of forming homodimers, the binding of SufE to SufS stimulates the cysteine desulfurase activity of SufS ∼50-fold (6Loiseau L. Ollagnier-de-Choudens S. Nachin L. Fontecave M. Barras F. J. Biol. Chem. 2003; 278: 38352-38359Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). SufA acts as a scaffold protein involved in the assembly of Fe-S clusters and subsequent Fe-S cluster transfer to target apoproteins (14Ollagnier-de-Choudens S. Lascoux D. Loiseau L. Barras F. Forest E. Fontecave M. FEBS Lett. 2003; 555: 263-267Crossref PubMed Scopus (87) Google Scholar). It has been suggested that SufC is probably the most essential Suf protein in that SufC deficiency in E. coli results in a number of phenotypes related to oxidative stress and iron homeostasis, similar to mutants lacking the entire suf operon (13Nachin L. Loiseau L. Expert D. Barras F. EMBO J. 2003; 22: 427-437Crossref PubMed Scopus (219) Google Scholar, 15Nachin L. El Hassouni M. Loiseau L. Expert D. Barras F. Mol. Microbiol. 2001; 39: 960-972Crossref PubMed Scopus (153) Google Scholar).Plant mitochondria harbor a Fe-S cluster biogenesis system involving the ABC protein Sta1 (16Kushnir S. Babiychuk E. Storozhenko S. Davey M.W. Papenbrock J. De Rycke R. Engler G. Stephan U.W. Lange H. Kispal G. Lill R. Van Montagu M. Plant Cell. 2001; 13: 89-100Crossref PubMed Scopus (201) Google Scholar). Moreover, the recent observation that Arabidopsis harbors chloroplast-localized Nif proteins AtCpNIFS/AtNFS2, AtCnfU-V, and AtCnfU-IVb (17Pilon-Smits E.A. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (107) Google Scholar, 18Leon S. Touraine B. Briat J.F. Lobreaux S. Biochem. J. 2002; 366: 557-564Crossref PubMed Scopus (97) Google Scholar, 19Yabe T. Morimoto K. Kikuchi S. Noshio K. Terashima I. Nakai M. Plant Cell. 2004; 16: 993-1007Crossref PubMed Scopus (122) Google Scholar) and HCF101 (20Lezhneva L. Amann K. Meurer J. Plant J. 2004; 37: 174-185Crossref PubMed Scopus (109) Google Scholar) demonstrates that plant Fe-S cluster biogenesis occurs in both mitochondria and plastids. In chloroplasts Fe-S clusters are required for cytochrome b6/f complex, ferredoxin and photosystem I ensuring electron flow in the thylakoids (21Raven J.A. Evans M.C.W. Korb R.E. Photosynth. Res. 1999; 60: 111-150Crossref Google Scholar, 22Kapazoglou A. Mould R.M. Gray J.C. Eur. J. Biochem. 2000; 267: 352-360Crossref PubMed Scopus (13) Google Scholar); however, to date Fe-S cluster biogenesis in plastid is poorly understood. As a step toward understanding SUF-mediated Fe-S cluster assembly in plastids we have recently provided evidence that Arabidopsis plastids most probably contain a complete SUF system (23Xu X.M. M øller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (103) Google Scholar). We have shown that the non-intrinsic ABC protein AtNAP7 is a functional ATPase and that it is a plastidic SufC-like protein (23Xu X.M. M øller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (103) Google Scholar). As in bacteria, AtNAP7 appears to be involved in the maintenance and repair of oxidatively damaged Fe-S clusters in that AtNAP7 can complement growth defects observed in SufC-deficient E. coli, because of damaged oxygen-labile Fe-S clusters, caused by oxidative stress. AtNAP7 clearly plays an essential role in plants as AtNAP7-deficiency in Arabidopsis leads to embryo lethality (23Xu X.M. M øller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (103) Google Scholar), suggesting that Fe-S proteins play vital roles during early stages of embryogenesis. Evidence for a SufC·SufD complex in plastids has come from protein interaction studies where we have shown that AtNAP7 can interact with the SufD homolog AtNAP6 (23Xu X.M. M øller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (103) Google Scholar). Because of the evolutionary conservation of the AtNAP7 mode of action and the fact that an AtNAP6·AtNAP7 complex exists we speculated that a SufB function may also be present in plastids.We previously reported that the plastid localized LAF6 (AtABC1) protein showed good homology to annotated non-intrinsic ABC proteins from cyanobacteria and alga (24M øller S.G. Kunkel T. Chua N.H. Genes Dev. 2001; 15: 90-103Crossref PubMed Scopus (175) Google Scholar). As an extension of this analysis we show here that AtABC1 also exhibits high similarity to prokaryotic SufB proteins. Because of this and keeping in line with recent nomenclature of non-intrinsic ABC proteins (25Sanchez-Fernandez R. Davies T.G. Coleman J.O. Rea P.A. J. Biol. Chem. 2001; 276: 30231-30244Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar) we have redesignated AtABC1 as AtNAP1. We demonstrate that AtNAP1 interacts with AtNAP7 inside chloroplasts, suggesting the presence of an AtNAP1·AtNAP7·AtNAP6 (SufB·SufC·SufD) complex in Arabidopsis plastids. We further show that AtNAP1 is able to complement the susceptibility of an E. coli SufB mutant to oxidative stress, suggesting that AtNAP1 is indeed an evolutionary conserved plastidic SufB protein. Despite this remarkable functional conservation, detailed biochemical characterization showed that in contrast to prokaryotic SufB proteins (12Rangachari K. Davis C.T. Eccleston J.F. Hirst E.M. Saldanha J.W. Strath M. Wilson R.J. FEBS Lett. 2002; 514: 225-228Crossref PubMed Scopus (58) Google Scholar) AtNAP1 is an iron-stimulated ATPase. Furthermore, AtNAP1 is capable of forming homodimers, again in contrast to its bacterial counterparts. We suggest that depending on the interaction state of AtNAP1, diverse biological processes can be affected explaining the varied phenotypes observed in mutants deficient for either AtNAP1 (23Xu X.M. M øller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (103) Google Scholar) or AtNAP7 (24M øller S.G. Kunkel T. Chua N.H. Genes Dev. 2001; 15: 90-103Crossref PubMed Scopus (175) Google Scholar). From our findings we propose that AtNAP1 represents an atypical plastidic SufB protein in Arabidopsis involved in Fe-S cluster assembly and regulation of iron homeostasis.EXPERIMENTAL PROCEDURESPlasmid Construction for Protein Expression—All oligonucleotide primers used in this study are listed in Table I. A 1674-bp full-length AtNAP1 (At4g04770) cDNA was amplified by PCR using Pwo DNA polymerase (Roche Applied Science) and primers NAP1/1 and NAP1/2 and ligated into pRSETA (Invitrogen) to generate pRSETA-AtNAP1. To generate a non-functional AtNAP1 protein pRSETA-AtNAP1 was digested with EcoRV removing a 393-bp DNA fragment (nucleotide position 297 to 689 of AtNAP1 removing amino acids 99–229) resulting in pRSETA-AtNAP1Trun (Truncated AtNAP1). All constructs were verified by DNA sequencing.Table ISequence of oligonucleotides used for strains and plasmid constructionsOligonucleotide5′-3′ SequenceNAP1/1AAGGATCCATGGCGTCT CTTCTCGCAAABamHI underlinedNAP1/2AACTCGAGTTAACCCACTGATCCTTCAAGCXhoI underlinedNAP1/4AAGAATTCATGGCGTCTCTTCTCGCAAAEcoRI underlinedNAP1/5AAGGATCCTTAACCCACTGATCCTTCAAGCBamHI underlined5NAP1GFPTACTCGAGATGGCGTCTCTTCTCGCAAACGGXhoI underlined3NAP1GFPATGGTACCACCCACTGATCCTTCAAGCKpn1 underlinedAtNAP1-FGCGATAACTTGGAAGTACCCAtNAP1-RGCTCTCTCGTGATCGATTCCNAP1-UC-LATTCTAGAGGCGTCTCTTCTCGCAAACGXbaI underlinedNAP1-UC-RATGGTACCTTAACCCACTGATCCTTCAAGCKpnI underlinedAtNAP7/1AAGAATTCATGGCCGGCGTTAACCTACEcoRI underlinedAtNAP7/2CTAACCGGATATCGCTTTGTAtSufC-LAATCTCGAGATGGCCGGCGTTAACCTACXhoI underlinedAtSufC-RAAGGTACCACCGGATATCGCTTTGAGCCKpnI underlinedYnhELTCTCGTAATACTGAAGCAACTGACGATGTCAAAACCTGGAGTGTAGGCTGGAGCTGCTTCYnhERCGCTGTGTTCAAGACTGATGGCGAGGAGTTTTTGTGCTTCCATATGAATATCCTCCTTAG Open table in a new tab Protein Expression and Purification—pRSETA-AtNAP1 and pRSETA-AtNAP1Trun were transformed into E. coli strain BL21(DE3) and 100-ml cultures were grown at 37 °C to a density of A600 = 0.6. Protein expression was induced using 1.5 mm isopropyl β-d-thiogalactoside for 3 h at 37 °C. To assess protein solubility 5 ml of each culture was harvested, resuspended in sodium phosphate buffer (50 mm sodium phosphate, 300 mm NaCl, pH 7.0) followed by sonication. The pellet and supernatant were separated by centrifugation, denatured in SDS loading buffer by heating to 95 °C, and used for SDS-PAGE analysis. Both AtNAP1 and AtNAP1Trun were insoluble and therefore dissolved with 1% Sarkosyl in sodium phosphate buffer and purified using Talon metal affinity resin (BD Biosciences) under denaturing conditions following the user manual for Talon metal affinity resins. Proteins were eluted by sodium phosphate buffer (45 mm sodium phosphate, 270 mm NaCl, and pH 7.0) containing 150 mm imidazole and the purity was verified by SDS-PAGE. Purified proteins were refolded by extended dialysis in dialysis buffer (50 mm sodium phosphate, 50 mm NaCl, 0.1 mm EDTA, 1.5 mm dithiothreitol, 10% glycerol, pH 7.2).ATPase Assays—Each reaction mixture (40 μl) contained 50 mm Tris-Cl (pH 7.4), 50 mm NaCl, 0.1 mm EDTA, 1.5 mm dithiothreitol, 10 mm KCl, and 10–80 μm [γ-32P]ATP (specific activity 10 Ci/mmol) unless otherwise stated. 0.4 μm Protein was used in each reaction and all reactions were terminated using 1 μl of 1 m formic acid. For the time course experiments, 40-μl reactions were incubated at 37 °C for the specified time, aliquots were removed and spotted onto PEI-cellulose (POLYGRAM CEL 300 PEI, MACHEREY-NAGEL) TLC plates. Air-dried plates were developed using 0.5 m lithium chloride and 1 m formic acid. Radioactive nucleotides were visualized by autoradiography using x-ray film and for quantification purposes plates were scanned using a phosphorimager.To assess the effect of different cations on the AtNAP1 ATPase activity, 20-μl reactions were incubated at 37 °C for 30 min with 10 μm [γ-32P]ATP, and 10 mm KCl was replaced with either 10 mm CaCl2, MnSO4, MnCl2, MgCl2 or 100 μm FeSO4. A no enzyme control was included to assess the background. To test the pH dependence of the ATPase activity, 20-μl reactions were incubated at 37 °C for 40 min using 50 mm Tris buffer (pH 6.0–9.0), 50 mm NaCl, 0.1 mm EDTA, 1.5 mm dithiothreitol, 10 mm KCl, and 10 μm [γ-32P]ATP. For iron concentration experiments, 10 mm KCl was replaced by different concentrations of FeSO4, together with 10 μm [γ-32P]ATP in 20-μl reaction volumes. The reactions were incubated for 30 min at 37 °C.Generation of an E. coli SufB Mutant and Complementation by AtNAP1—This method was adapted from Ref. 26Datsenko K.A. Wanner B.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6640-6645Crossref PubMed Scopus (10974) Google Scholar. The SufB gene in E. coli strain MG1655 was replaced by the insertion of a chloramphenicol resistance cassette (1.0-kb fragment containing the chloramphenicol resistant gene was PCR amplified with primers ynhEL and ynhER using pKD3 as template), followed by resistance cassette removal using pCP20 to give rise to MG1665ΔsufB. A full-length AtNAP1 cDNA was PCR amplified with primers NAP1-UC-L and NAP1-UC-R, digested with XbaI and KpnI, and ligated into pUC19. The following construct was transformed into MG1665ΔsufB to generate strain MG1665ΔsufBAtNAP1. Complementation analysis in the presence of phenazine methosulfate (PMS) was conducted as described previously (23Xu X.M. M øller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (103) Google Scholar).Yeast Two-hybrid Analysis—A full-length AtNAP1 cDNA was PCR amplified using Pwo DNA polymerase (Roche) and primers NAP1/4 and NAP1/5 and ligated into pGBKT7 (DNA binding domain; BD) and pGADT7 (DNA activation domain; AD) separately (Clontech, Matchmaker 3) to generate pGBK-AtNAP1 and pGAD-AtNAP1. A 1017-bp full-length AtNAP7 cDNA was PCR amplified as above using primers AtNAP7/1 and AtNAP7/2 and ligated into the EcoRI and SmaI of pGBKT7 and pGADT7 separately to generate pGBK-AtNAP7 and pGAD-AtNAP7. All constructs were verified by DNA sequencing.The above four vectors including empty vector controls (pGBKT7 and pGADT7) were transformed into yeast strain HF7c. The different transformation combinations are shown in Fig. 4A. Single transformants were grown on minimal synthetic dropout media (SD medium) either lacking tryptophan (Trp) (pGBKT7 vectors) or lacking leucine (Leu) (pGADT7 vectors). Double transformants were selected for SD medium lacking both Trp and Leu. To test for protein-protein interactions, fresh colonies were streaked onto SD medium plates containing 10 mm 3-aminotrizole but lacking Trp, Leu, and His and allowed to grow for 4–6 days at 30 °C. Yeast growth was classified into 4 categories based on restoration of His auxotrophy from three independent experiments: +++, growth after 2 days; ++, growth after 3 days; +, growth after 5–6 days; –, normal background growth.In Planta Interaction Studies/Bimolecular Fluorescence Complementation—A full-length AtNAP1 cDNA was PCR amplified using Pwo polymerase (Roche) with primers 5NAP1GFP and 3NAP1GFP and inserted into pWEN-C-YFP (containing amino acids 155–238 of YFP) and pWEN-N-YFP (containing amino acids 1–154 of YFP). A full-length AtNAP7 cDNA was PCR amplified with primers AtSufC-L and AtSufC-R and inserted in pWEN-C-YFP. Two combinations of these plasmids, pWEN-AtNAP1-N-YFP/pWEN-AtNAP1-C-YFP or pWEN-AtNAP1-N-YFP/pWEN-AtNAP7-C-YFP, were co-bombarded and transiently expressed in tobacco leaves (27Kost B. Spielhofer P. Chua N.H. Plant J. 1998; 16: 393-401Crossref PubMed Google Scholar). The leaves were placed in darkness for 2 days followed by YFP fluorescence visualization using a Nikon TE-2000U inverted microscope (Nikon, Japan) and image analysis was performed using Openlab software (Improvision).Expression Analysis of AtNAP1 in Iron-starved Seedlings—Wild-type (Ler) Arabidopsis seedlings were grown on Murashige and Skoog plates for 3 weeks followed by transfer to either fresh Murashige and Skoog plates or to Murashige and Skoog plates lacking FeSO4/EDTA but containing 50 μm ferrozine. Seedlings were harvested 3 days after transfer and total RNA was extracted using the Sigma RNA extraction kit (Sigma). The RNA was DNase I (Sigma) treated and 2 μg of RNA was reverse transcribed (Stratagene) according to the manufacturer's instructions. 1 μl of first-strand cDNA was used for PCR amplification (25 cycles) with primers AtNAP1-F and AtNAP1-R and products analyzed on a 2% agarose gel.RESULTSSequence Analysis of AtNAP1—We previously reported the cloning and initial characterization of AtABC1, a plastid-localized 557-amino acid protein showing high similarity to annotated ABC-like proteins from cyanobacteria and alga (24M øller S.G. Kunkel T. Chua N.H. Genes Dev. 2001; 15: 90-103Crossref PubMed Scopus (175) Google Scholar). In agreement with our initial classification, subsequent in silico studies by Rea and colleagues (25Sanchez-Fernandez R. Davies T.G. Coleman J.O. Rea P.A. J. Biol. Chem. 2001; 276: 30231-30244Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar) suggested that AtABC1 represents a soluble non-intrinsic ABC protein (NAP) belonging to a heterogeneous group of 15 single nucleotide binding fold proteins. In accordance with this new classification we now refer to AtABC1 as AtNAP1. Interestingly, more recent reports have suggested that AtNAP1 may represent a SufB homolog possibly involved in Fe-S cluster formation and/or repair (12Rangachari K. Davis C.T. Eccleston J.F. Hirst E.M. Saldanha J.W. Strath M. Wilson R.J. FEBS Lett. 2002; 514: 225-228Crossref PubMed Scopus (58) Google Scholar, 28Ellis K.E. Clough B. Saldanha J.W. Wilson R.J. Mol. Microbiol. 2001; 41: 973-981Crossref PubMed Scopus (87) Google Scholar). In agreement with this we find that AtNAP1 shows ∼60% similarity to SufB from both E. coli and Erwinia chrysanthemi (Fig. 1) indicating that AtNAP1 may indeed be a plastid-localized SufB protein. In bacteria, SufB physically interacts with SufC, an ABC/ATPase, and together with SufD this protein complex acts as an ATP-driven energizer for Fe-S cluster biogenesis and repair (9Zheng L. Cash V.L. Flint D.H. Dean D.R. J. Biol. Chem. 1998; 273: 13264-13272Abstract Full Text Full Text PDF PubMed Scopus (571) Google Scholar, 10Takahashi Y. Nakamura M.J. Biochem. J. (Tokyo). 1999; 126: 917-926Crossref Scopus (225) Google Scholar). Although no ATPase activity has to date been demonstrated for prokaryotic SufB proteins, AtNAP1 contains degenerate Walker A and Walker B motifs (Fig. 1). Interestingly, both putative Walker domains are found in regions of limited homology between AtNAP1 and prokaryotic SufB proteins (Fig. 1) possibly indicating some functional divergence. Although AtNAP1 has been classified as a non-intrinsic ABC protein (25Sanchez-Fernandez R. Davies T.G. Coleman J.O. Rea P.A. J. Biol. Chem. 2001; 276: 30231-30244Abstract Full Text Full Text PDF PubMed Scopus (403) Google Scholar, 29Garcia O. Bouige P. Forestier C. Dassa E. J. Mol. Biol. 2004; 343: 249-265Crossref PubMed Scopus (121) Google Scholar) the absence of the conserved ABC signature motif suggests that AtNAP1 does not represent a classical ABC/ATPase but rather an ATPase with similarity to NAPs.Fig. 1Amino acid sequence alignment between AtNAP1 and SufB proteins from E. chrysanthemi (SufB Erw. CAC17125) and E. coli (SufB E. coli P77522). The degenerate Walker A and Walker B motifs are indicated.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Through extended BLAST searches of the Arabidopsis genome we discovered a second possible SufB gene (At5g44316) with high similarity to AtNAP1 (data not shown). Although the predicted amino acid sequence of At5g44316 shows 85% similarity to AtNAP1 we were unable to identify an At5g44316 transcript from extensive RT-PCR experiments and no EST has to date been deposited in any data base. This suggests that Arabidopsis contains only one SufB protein.AtNAP1 Is an Fe2+-stimulated ATPase—Although AtNAP1 has been classified as a NAP with presumed ATPase activity we wanted to examine whether AtNAP1 could indeed bind and hydrolyze ATP. To this end we expressed a hexahistidine-tagged full-length AtNAP1 (WT) fusion protein in E. coli. Fractionation analysis showed that AtNAP1 was insoluble and the protein was therefore purified under denaturing conditions using Ni2+ affinity chromatography followed by refolding by dialysis. The purity of the refolded protein was analyzed by SDS-PAGE revealing a single protein band of the expected size (61 kDa) with no detectable contamination (Fig. 2A). Purified AtNAP1 protein (0.4 μm) was then incubated with radiolabeled [γ-32P]ATP at pH 7.4 and analyzed by thin layer chromatography for the release of radiolabeled inorganic phosphate (Pi). Analysis using two different protein batches showed clear AtNAP1-mediated ATP hydrolysis (Fig. 2B).Fig. 2Purified AtNAP1 and ATPase assays.A, SDS-PAGE of purified full-length wild-type AtNAP1 (WT) and truncated AtNAP1 (Trun) stained with Coomassie Blue. B, autoradiography of ATP hydrolysis by purified wild-type AtNAP1 protein. Released radioactively labeled phosphate (Pi) is indicated. No Pi release is observed when using the purified truncated version (Trun) of AtNAP1. A no enzyme reaction is included as a control (Con). C, kinetic parameters of ATP hydrolysis by AtNAP1. A double-reciprocal plot of the rate of Pi formation (1/initial rate (Vo) s pmol–1) versus substrate concentration (1/[ATP] μm) is shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The AtNAP1 polypeptide was not present in the imidazole eluate from E. coli cells lacking the AtNAP1 expression plasmid when chromatographed in parallel with cells expressing AtNAP1 (data not shown). To ensure that the ATPase activity was attributable to AtNAP1 and not because of a contaminating E. coli protein, we expressed a truncated hexahistidine-tagged AtNAP1 fusion protein (AtNAP1Trun) lacking 131 amino acids (see “Experimental Procedures”) predicted to be non-functional in terms of ATPase activity. Similar to the full-length wild-type AtNAP1, the purified and refolded AtNAP1Trun protein (Trun) was analyzed by SDS-PAGE revealing a single protein band of the predicted size (47 kDa) with no detectable contamination (Fig. 2A). As expected no ATPase activity was detected when 0.4 μm AtNAP1Trun (Trun) was incubated with radiolabeled [γ-32P]ATP (Fig. 2B) demonstrating that AtNAP1Trun is non-functional in terms of ATPase activity but more importantly that the measured ATPase activity is attributable to AtNAP1.To more fully characterize the catalytic activity of AtNAP1 we determined key kinetic parameters of AtNAP1-mediated ATP hydrolysis. Using input [γ-32P]ATP concentrations in the range of 10 to 80 μm we quantified the release of radiolabeled Pi as a function of time in separate time course experiments (Supplementary Materials Fig. 1). From the measured initial reaction rates we generated a double-reciprocal plot and calculated a Km of 36 μm ATP and a Vmax of 0.3 pmol s–1 (Fig. 2C). Further kinetic analysis also showed that ATP hydrolysis was optimal at pH 7.5 (Fig. 3A) although hydrolysis under acidic conditions (pH 6–7) was significantly higher than in a more alkaline environment (pH 8–9).Fig. 3Kinetic and expression analysis of AtNAP1.A, effect of pH on ATP hydrolysis by AtNAP1. Activity peaked at pH 7.5. B, the effect of cations on AtNAP1 ATPase activity. FeSO4 had a marked effect on AtNAP1-mediated ATP hydrolysis, whereas MnCl2, MnSO4, and KCl had a modest effect on activity. A no enzyme control (Con) is included. C, the effect of different FeSO4 concentrations on AtNAP1 ATPase activity. The 0 FeSO4 reaction only contains 50 mm NaCl. D, semiquantitative RT-PCR analysis of AtNAP1 transcripts in seedlings grown in the presence (+Fe) and absence (–Fe) of iron. AtNAP1 was significantly down-regulated in seedlings subjected to iron starvation. Actin was used as a control.View Large Image Figure ViewerDownload Hi-res image Download (PPT)As divalent cations have been shown to influence the ATPase activity of bacterial ABC/ATPases (30Morbach S. Tebbe S. Schneider E. J. Biol. Chem. 1993; 268" @default.
• W2022668082 created "2016-06-24" @default.
• W2022668082 creator A5018516855 @default.
• W2022668082 creator A5020931376 @default.
• W2022668082 creator A5042889919 @default.
• W2022668082 creator A5065168048 @default.
• W2022668082 date "2005-02-01" @default.
• W2022668082 modified "2023-10-03" @default.
• W2022668082 title "AtNAP1 Represents an Atypical SufB Protein in Arabidopsis Plastids" @default.
• W2022668082 cites W1512662091 @default.
• W2022668082 cites W1579211638 @default.
• W2022668082 cites W1620865342 @default.
• W2022668082 cites W1655025181 @default.
• W2022668082 cites W1881646695 @default.
• W2022668082 cites W1970359761 @default.
• W2022668082 cites W1981871034 @default.
• W2022668082 cites W1984882823 @default.
• W2022668082 cites W1987675760 @default.
• W2022668082 cites W1998142761 @default.
• W2022668082 cites W1998551227 @default.
• W2022668082 cites W2007826649 @default.
• W2022668082 cites W2010961029 @default.
• W2022668082 cites W2014746315 @default.
• W2022668082 cites W2018119138 @default.
• W2022668082 cites W2028890624 @default.
• W2022668082 cites W2030671072 @default.
• W2022668082 cites W2033367616 @default.
• W2022668082 cites W2038942260 @default.
• W2022668082 cites W2039943732 @default.
• W2022668082 cites W2046824381 @default.
• W2022668082 cites W2051317564 @default.
• W2022668082 cites W2052823571 @default.
• W2022668082 cites W2059831206 @default.
• W2022668082 cites W2061400912 @default.
• W2022668082 cites W2090079874 @default.
• W2022668082 cites W2102489917 @default.
• W2022668082 cites W2108992291 @default.
• W2022668082 cites W2115498985 @default.
• W2022668082 cites W2116137883 @default.
• W2022668082 cites W2123058210 @default.
• W2022668082 cites W2132750410 @default.
• W2022668082 cites W2147221793 @default.
• W2022668082 cites W2151357324 @default.
• W2022668082 cites W2157433322 @default.
• W2022668082 cites W2575789697 @default.
• W2022668082 doi "https://doi.org/10.1074/jbc.m413082200" @default.
• W2022668082 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1401503" @default.
• W2022668082 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15611066" @default.
• W2022668082 hasPublicationYear "2005" @default.
• W2022668082 type Work @default.
• W2022668082 sameAs 2022668082 @default.
• W2022668082 citedByCount "93" @default.
• W2022668082 countsByYear W20226680822012 @default.
• W2022668082 countsByYear W20226680822013 @default.
• W2022668082 countsByYear W20226680822014 @default.
• W2022668082 countsByYear W20226680822015 @default.
• W2022668082 countsByYear W20226680822017 @default.
• W2022668082 countsByYear W20226680822018 @default.
• W2022668082 countsByYear W20226680822019 @default.
• W2022668082 countsByYear W20226680822020 @default.
• W2022668082 countsByYear W20226680822021 @default.
• W2022668082 countsByYear W20226680822022 @default.
• W2022668082 crossrefType "journal-article" @default.
• W2022668082 hasAuthorship W2022668082A5018516855 @default.
• W2022668082 hasAuthorship W2022668082A5020931376 @default.
• W2022668082 hasAuthorship W2022668082A5042889919 @default.
• W2022668082 hasAuthorship W2022668082A5065168048 @default.
• W2022668082 hasBestOaLocation W20226680821 @default.
• W2022668082 hasConcept C104317684 @default.
• W2022668082 hasConcept C143065580 @default.
• W2022668082 hasConcept C185592680 @default.
• W2022668082 hasConcept C2779491563 @default.
• W2022668082 hasConcept C55493867 @default.
• W2022668082 hasConcept C69305403 @default.
• W2022668082 hasConcept C70721500 @default.
• W2022668082 hasConcept C86803240 @default.
• W2022668082 hasConcept C93829228 @default.
• W2022668082 hasConceptScore W2022668082C104317684 @default.
• W2022668082 hasConceptScore W2022668082C143065580 @default.
• W2022668082 hasConceptScore W2022668082C185592680 @default.
• W2022668082 hasConceptScore W2022668082C2779491563 @default.
• W2022668082 hasConceptScore W2022668082C55493867 @default.
• W2022668082 hasConceptScore W2022668082C69305403 @default.
• W2022668082 hasConceptScore W2022668082C70721500 @default.
• W2022668082 hasConceptScore W2022668082C86803240 @default.
• W2022668082 hasConceptScore W2022668082C93829228 @default.
• W2022668082 hasIssue "8" @default.
• W2022668082 hasLocation W20226680821 @default.
• W2022668082 hasLocation W20226680822 @default.
• W2022668082 hasLocation W20226680823 @default.
• W2022668082 hasOpenAccess W2022668082 @default.
• W2022668082 hasPrimaryLocation W20226680821 @default.
• W2022668082 hasRelatedWork W1973114439 @default.
• W2022668082 hasRelatedWork W2077851344 @default.
• W2022668082 hasRelatedWork W2331451241 @default.
• W2022668082 hasRelatedWork W2409674730 @default.
• W2022668082 hasRelatedWork W2419493798 @default.
• W2022668082 hasRelatedWork W2773612361 @default.

• next