FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2022668149> ?p ?o ?g. }

• W2022668149 endingPage "28941" @default.
• W2022668149 startingPage "28924" @default.
• W2022668149 abstract "The Apobec/AID family of cytosine deaminases can deaminate cytosine and thereby contribute to adaptive and innate immunity, DNA demethylation, and the modification of cellular mRNAs. Unique among this family is Apobec2, whose enzymatic activity has been questioned and whose function remains poorly explored. We recently reported that zebrafish Apobec2a and Apobec2b (Apobec2a,2b) regulate retina regeneration; however, their mechanism of action remained unknown. Here we show that although Apobec2a,2b lack cytosine deaminase activity, they require a conserved zinc-binding domain to stimulate retina regeneration. Interestingly, we found that human APOBEC2 is able to functionally substitute for Apobec2a,2b during retina regeneration. By identifying Apobec2-interacting proteins, including ubiquitin-conjugating enzyme 9 (Ubc9); topoisomerase I-binding, arginine/serine-rich, E3 ubiquitin protein ligase (Toporsa); and POU class 6 homeobox 2 (Pou6f2), we uncovered that sumoylation regulates Apobec2 subcellular localization and that nuclear Apobec2 controls Pou6f2 binding to DNA. Importantly, mutations in the zinc-binding domain of Apobec2 diminished its ability to stimulate Pou6f2 binding to DNA, and knockdown of Ubc9 or Pou6f2 suppressed retina regeneration. The Apobec/AID family of cytosine deaminases can deaminate cytosine and thereby contribute to adaptive and innate immunity, DNA demethylation, and the modification of cellular mRNAs. Unique among this family is Apobec2, whose enzymatic activity has been questioned and whose function remains poorly explored. We recently reported that zebrafish Apobec2a and Apobec2b (Apobec2a,2b) regulate retina regeneration; however, their mechanism of action remained unknown. Here we show that although Apobec2a,2b lack cytosine deaminase activity, they require a conserved zinc-binding domain to stimulate retina regeneration. Interestingly, we found that human APOBEC2 is able to functionally substitute for Apobec2a,2b during retina regeneration. By identifying Apobec2-interacting proteins, including ubiquitin-conjugating enzyme 9 (Ubc9); topoisomerase I-binding, arginine/serine-rich, E3 ubiquitin protein ligase (Toporsa); and POU class 6 homeobox 2 (Pou6f2), we uncovered that sumoylation regulates Apobec2 subcellular localization and that nuclear Apobec2 controls Pou6f2 binding to DNA. Importantly, mutations in the zinc-binding domain of Apobec2 diminished its ability to stimulate Pou6f2 binding to DNA, and knockdown of Ubc9 or Pou6f2 suppressed retina regeneration. Zinc-binding domain-dependent, deaminase-independent actions of apolipoprotein B mRNA-editing enzyme, catalytic polypeptide 2 (Apobec2), mediate its effect on zebrafish retina regeneration.Journal of Biological ChemistryVol. 290Issue 10PreviewVOLUME 289 (2014) PAGES Full-Text PDF Open Access Apobec proteins are a family of cytosine deaminases capable of introducing mutations into DNA and/or RNA (1.Conticello S.G. The AID/APOBEC family of nucleic acid mutators.Genome Biol. 2008; 9: 229Crossref PubMed Scopus (396) Google Scholar). Apobec2 was the second Apobec family member identified (2.Liao W. Hong S.H. Chan B.H. Rudolph F.B. Clark S.C. Chan L. APOBEC-2, a cardiac- and skeletal muscle-specific member of the cytidine deaminase supergene family.Biochem. Biophys. Res. Commun. 1999; 260: 398-404Crossref PubMed Scopus (112) Google Scholar, 3.Anant S. Mukhopadhyay D. Sankaranand V. Kennedy S. Henderson J.O. Davidson N.O. ARCD-1, an apobec-1-related cytidine deaminase, exerts a dominant negative effect on C to U RNA editing.Am. J. Physiol. Cell Physiol. 2001; 281: C1904-C1916Crossref PubMed Google Scholar). Although its overexpression has been correlated with tumor formation, and its deletion correlated with perturbations in muscle development, retina regeneration, and left-right axis specification, the biochemical function of Apobec2 remains unknown (4.Sato Y. Probst H.C. Tatsumi R. Ikeuchi Y. Neuberger M.S. Rada C. Deficiency in APOBEC2 leads to a shift in muscle fiber-type, diminished body mass and myopathy.J. Biol. Chem. 2010; 285: 7111-7118Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar, 5.Vonica A. Rosa A. Arduini B.L. Brivanlou A.H. APOBEC2, a selective inhibitor of TGFβ signaling, regulates left-right axis specification during early embryogenesis.Dev. Biol. 2011; 350: 13-23Crossref PubMed Scopus (36) Google Scholar, 6.Etard C. Roostalu U. Strähle U. Lack of Apobec2-related proteins causes a dystrophic muscle phenotype in zebrafish embryos.J. Cell Biol. 2010; 189: 527-539Crossref PubMed Scopus (45) Google Scholar, 7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar, 8.Okuyama S. Marusawa H. Matsumoto T. Ueda Y. Matsumoto Y. Endo Y. Takai A. Chiba T. Excessive activity of apolipoprotein B mRNA editing enzyme catalytic polypeptide 2 (APOBEC2) contributes to liver and lung tumorigenesis.Int. J. Cancer. 2012; 130: 1294-1301Crossref PubMed Scopus (34) Google Scholar). Unlike other Apobecs, Apobec2 fails to induce cytosine deaminase-dependent mutations in bacterial and yeast-based mutagenesis assays (deamination of cytosine results in its conversion to uracil) (9.Harris R.S. Petersen-Mahrt S.K. Neuberger M.S. RNA editing enzyme APOBEC1 and some of its homologs can act as DNA mutators.Mol. Cell. 2002; 10: 1247-1253Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar, 10.Mikl M.C. Watt I.N. Lu M. Reik W. Davies S.L. Neuberger M.S. Rada C. Mice deficient in APOBEC2 and APOBEC3.Mol. Cell. Biol. 2005; 25: 7270-7277Crossref PubMed Scopus (101) Google Scholar, 11.Lada A.G. Krick C.F. Kozmin S.G. Mayorov V.I. Karpova T.S. Rogozin I.B. Pavlov Y.I. Mutator effects and mutation signatures of editing deaminases produced in bacteria and yeast.Biochemistry. 2011; 76: 131-146PubMed Google Scholar), and the ability of Apobec2 to bind polynucleotides is limited (3.Anant S. Mukhopadhyay D. Sankaranand V. Kennedy S. Henderson J.O. Davidson N.O. ARCD-1, an apobec-1-related cytidine deaminase, exerts a dominant negative effect on C to U RNA editing.Am. J. Physiol. Cell Physiol. 2001; 281: C1904-C1916Crossref PubMed Google Scholar, 4.Sato Y. Probst H.C. Tatsumi R. Ikeuchi Y. Neuberger M.S. Rada C. Deficiency in APOBEC2 leads to a shift in muscle fiber-type, diminished body mass and myopathy.J. Biol. Chem. 2010; 285: 7111-7118Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar). Although biochemical data are lacking, prominent models of Apobec2 function include cytosine deaminase-dependent DNA demethylation (12.Rai K. Huggins I.J. James S.R. Karpf A.R. Jones D.A. Cairns B.R. DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and gadd45.Cell. 2008; 135: 1201-1212Abstract Full Text Full Text PDF PubMed Scopus (551) Google Scholar, 13.Guo J.U. Su Y. Zhong C. Ming G.L. Song H. Hydroxylation of 5-methylcytosine by TET1 promotes active DNA demethylation in the adult brain.Cell. 2011; 145: 423-434Abstract Full Text Full Text PDF PubMed Scopus (1074) Google Scholar) and C-to-U mRNA editing (5.Vonica A. Rosa A. Arduini B.L. Brivanlou A.H. APOBEC2, a selective inhibitor of TGFβ signaling, regulates left-right axis specification during early embryogenesis.Dev. Biol. 2011; 350: 13-23Crossref PubMed Scopus (36) Google Scholar, 6.Etard C. Roostalu U. Strähle U. Lack of Apobec2-related proteins causes a dystrophic muscle phenotype in zebrafish embryos.J. Cell Biol. 2010; 189: 527-539Crossref PubMed Scopus (45) Google Scholar, 8.Okuyama S. Marusawa H. Matsumoto T. Ueda Y. Matsumoto Y. Endo Y. Takai A. Chiba T. Excessive activity of apolipoprotein B mRNA editing enzyme catalytic polypeptide 2 (APOBEC2) contributes to liver and lung tumorigenesis.Int. J. Cancer. 2012; 130: 1294-1301Crossref PubMed Scopus (34) Google Scholar). Previously, we demonstrated that Apobec2a,2b 2The abbreviations used are: Apobec2a,2bApobec2a and Apobec2bapobec2a,2bapobec2a and apobec2bSUMOsmall ubiquitin-like modifierMGMüller gliaMGPCMüller glia-derived progenitor cellMOmorpholino antisense oligonucleotidehpih postinjurydpidays postinjuryPCNAproliferating cell nuclear antigenINLinner nuclear layerDBDDNA-binding domain. are necessary for zebrafish retina and optic nerve regeneration (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar). During retina regeneration, Apobec2a,2b regulate Müller glia (MG) activation and the generation of Müller glia-derived progenitor cells (MGPCs). One of the ways they influence these events is by directly or indirectly stimulating expression of the ascl1a gene (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar), a gene that encodes a transcriptional activator necessary for retina regeneration (14.Fausett B.V. Gumerson J.D. Goldman D. The proneural basic helix-loop-helix gene ascl1a is required for retina regeneration.J. Neurosci. 2008; 28: 1109-1117Crossref PubMed Scopus (171) Google Scholar, 15.Ramachandran R. Zhao X.F. Goldman D. Ascl1a/Dkk/β-catenin signaling pathway is necessary and glycogen synthase kinase-3β inhibition is sufficient for zebrafish retina regeneration.Proc. Natl. Acad. Sci. U.S.A. 2011; 108: 15858-15863Crossref PubMed Scopus (149) Google Scholar). Interestingly, knockdown of Apobec2a,2b during retina regeneration does not influence the changes in DNA methylation that accompany retina regeneration, indicating that Apobec2 proteins perform an alternate function (16.Powell C. Grant A.R. Cornblath E. Goldman D. Analysis of DNA methylation reveals a partial reprogramming of the Muller glia genome during retina regeneration.Proc. Natl. Acad. Sci. U.S.A. 2013; 110: 19814-19819Crossref PubMed Scopus (88) Google Scholar). Apobec2a and Apobec2b apobec2a and apobec2b small ubiquitin-like modifier Müller glia Müller glia-derived progenitor cell morpholino antisense oligonucleotide h postinjury days postinjury proliferating cell nuclear antigen inner nuclear layer DNA-binding domain. Here we build upon our previous work aimed at determining the mechanism by which Apobec2 proteins regulate retina regeneration (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar, 16.Powell C. Grant A.R. Cornblath E. Goldman D. Analysis of DNA methylation reveals a partial reprogramming of the Muller glia genome during retina regeneration.Proc. Natl. Acad. Sci. U.S.A. 2013; 110: 19814-19819Crossref PubMed Scopus (88) Google Scholar). Through a combination of bacterial expression assays, transgenic fish, and site-directed mutagenesis, we demonstrate that although zebrafish Apobec2 proteins lack detectable zinc-dependent cytosine deaminase activity, their zinc-binding domain is critical for their function during retina regeneration. To understand how Apobec2 proteins regulate retina regeneration, we turned to a yeast two-hybrid screen to identify Apobec2-interacting proteins. This analysis identified Ubc9, Topors, and Pou6f2, which led us to discover that sumoylation controls Apobec2 subcellular localization and that nuclear Apobec2 regulates the propensity of Pou6f2 to bind DNA. Importantly, we also found that Ubc9 and Pou6f2 regulate retina regeneration. This study reveals previously unrecognized functions for Apobec2 proteins and provides new insight into their regulation and cellular actions. All experiments involving animals were performed in accordance with institutional guidelines and regulations and approved by the University of Michigan's Committee on Use and Care of Animals. Transgenic gfap:gfp (17.Kassen S.C. Ramanan V. Montgomery J.E. T Burket C. Liu C.G. Vihtelic T.S. Hyde D.R. Time course analysis of gene expression during light-induced photoreceptor cell death and regeneration in albino zebrafish.Dev. Neurobiol. 2007; 67: 1009-1031Crossref PubMed Scopus (153) Google Scholar) and 1016 tuba1a:gfp (18.Fausett B.V. Goldman D. A role for α1 tubulin-expressing Muller glia in regeneration of the injured zebrafish retina.J. Neurosci. 2006; 26: 6303-6313Crossref PubMed Scopus (310) Google Scholar) fish have been described. In preparation for the construction of hsp70 transgenic fish, the 1016 tuba1a:gfp SV40 cassette (18.Fausett B.V. Goldman D. A role for α1 tubulin-expressing Muller glia in regeneration of the injured zebrafish retina.J. Neurosci. 2006; 26: 6303-6313Crossref PubMed Scopus (310) Google Scholar) was cloned, followed by a second expression cassette encoding 1523 bp of the hsp70 promoter (19.Halloran M.C. Sato-Maeda M. Warren J.T. Su F. Lele Z. Krone P.H. Kuwada J.Y. Shoji W. Laser-induced gene expression in specific cells of transgenic zebrafish.Development. 2000; 127: 1953-1960Crossref PubMed Google Scholar) driving the expression of 1) myc-zapobec2b-Viral2apeptide(V2a)-flag-zapobec2a (hsp70:zapobec2wt), 2) myc-zapobec2b(C180A)-V2a-flag-zapobec2a(C156A) (hsp70:zapobec2mut), or 3) myc-hAPOBEC2 (hsp70:hAPOBEC2) followed by an SV40 sequence (Fig. 4) into the pT2AL200R150G Tol2 vector (20.Urasaki A. Morvan G. Kawakami K. Functional dissection of the Tol2 transposable element identified the minimal cis-sequence and a highly repetitive sequence in the subterminal region essential for transposition.Genetics. 2006; 174: 639-649Crossref PubMed Scopus (399) Google Scholar). The primers and intermediate clones used in the preparation of these constructs are listed in supplemental Table 1. Overlap extension PCR was used for the preparation of constructs including V2a peptide sequences (optimized for zebrafish translation) and constructs including mutations. The V2a peptide allows for polycistronic expression (Fig. 3C) (21.Provost E. Rhee J. Leach S.D. Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos.Genesis. 2007; 45: 625-629Crossref PubMed Scopus (140) Google Scholar). Tol2 transposase-mediated integration of the transgene was performed by injection into single-cell zebrafish embryos, which were raised to adulthood and screened for transgenic progeny (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar). Multiple independent lines were selected and grown to adulthood, each exhibiting a similar phenotype (Fig. 3).FIGURE 3.Analyses of feasibility, transgene expression, and proliferation in uninjured and injured transgenic fish, with and without heat shock. A, graphic depicting the makeup of the pCS2 clones used to create myc-apobec2b-V2a-gfp and flag-apobec2a-V2a-gfp mRNAs for microinjection. B, the expression of myc-apobec2b(m2b)-V2a-gfp and flag-apobec2a(f2a)-V2a-gfp mRNAs escape MO knockdown (0.125 mm), as indicated by the expression of GFP and the expression of a functional protein that rescues the curved body axis caused by Apobec2a,b knockdown (6.Etard C. Roostalu U. Strähle U. Lack of Apobec2-related proteins causes a dystrophic muscle phenotype in zebrafish embryos.J. Cell Biol. 2010; 189: 527-539Crossref PubMed Scopus (45) Google Scholar). Scale bar, 400 µm. C, the proper functioning of the viral 2a (V2a) peptide was demonstrated after microinjection of flag-apobec2a-V2a-gfp or myc-apobec2b-V2a-gfp mRNA. Western blotting showed the proper separation of Apobec2 and GFP proteins. D–I, analyses performed on transgenic fish in the absence of heat shock. Scale bar, 50 µm. D–F, GFP immunostaining of uninjured or 4-dpi retinas shows basal and injury-dependent expression of the 1016 tuba1a:gfp expression cassette in hsp70:zapobec2wt (D), hsp70:zapobec2mut (E), and hsp70:hAPOBEC2 (F) transgenic fish. G–I, BrdU immunostaining of uninjured or 4-dpi transgenic fish retinas indicates that hsp70:zapobec2wt (G), hsp70:zapobec2mut (H), and hsp70:hAPOBEC2 (I) transgenic fish retinas show limited basal cellular proliferation in the uninjured retina and induced injury-dependent levels of cellular proliferation at 4 dpi. Fish were given a pulse of BrdU 3 h prior to harvest. J–L, real-time PCR quantifications were carried out to measure basal and 4-h post-heat shock (4hphs) levels of apobec2a (J), apobec2b (K), and APOBEC2 (L) in retinas isolated from the indicated fish backgrounds. The apobec2a and apobec2b primers recognize both endogenous and exogenous mRNAs. The expression levels of apobec2a and apobec2b were normalized to the expression of gapdh and compared with the basal levels of wild type (wt) fish, which were given a value of 1. The expression levels of APOBEC2 were normalized to the expression of gapdh and compared with its basal level in each respective line, which was given a value of 1. Data represent means ± S.D. (error bars) (n = 3 individual cDNA sets). M, heat shock induced the production of transgenic proteins, as measured by immunostaining. Scale bar, 50 µm. N, 4 days of heat shock did not induce proliferation in uninjured zapobec2wt transgenic fish, demonstrating that although Apobec2a,2b are required for retina regeneration, they are not sufficient. Fish were given a pulse of BrdU 3 h prior to harvest. Scale bar, 50 µm. O, real-time PCR quantifications of basal and injury-dependent (with heat shock) ascl1a expression. The expression levels of ascl1a were normalized to the expression of gapdh and compared with the basal levels of wild type (wt) fish, which was given a value of 1. Data represent means ± S.D. (n = 3 individual cDNA sets). P, real-time PCR quantifications of injury-dependent ascl1a expression at 2 dpi following control or Apobec2a,2b knockdown. ascl1a mRNA levels were normalized to the expression of gapdh and compared with the value of the control MO, which was given a value of 1. Data represent means ± S.D. (n = 3 individual cDNA sets). *, p < 0.03088. BF, bright field; L, line; ONL, outer nuclear layer; GCL, ganglion cell layer.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Retina lesions and BrdU injections have been described previously (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar, 16.Powell C. Grant A.R. Cornblath E. Goldman D. Analysis of DNA methylation reveals a partial reprogramming of the Muller glia genome during retina regeneration.Proc. Natl. Acad. Sci. U.S.A. 2013; 110: 19814-19819Crossref PubMed Scopus (88) Google Scholar). Briefly, while anesthetized in 0.02% tricaine methane sulfonate, fish were placed under a dissecting microscope for visualization, and the right eye was gently rotated in its socket and stabbed through the sclera with a 30-gauge needle. Lissamine-tagged MOs (Gene Tools) were delivered at the time of injury by using a Hamilton syringe. MO delivery to cells was facilitated by electroporation as described (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar). The control, apobec2a, apobec2b, and ube2i targeting MOs have been described previously (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar, 12.Rai K. Huggins I.J. James S.R. Karpf A.R. Jones D.A. Cairns B.R. DNA demethylation in zebrafish involves the coupling of a deaminase, a glycosylase, and gadd45.Cell. 2008; 135: 1201-1212Abstract Full Text Full Text PDF PubMed Scopus (551) Google Scholar, 16.Powell C. Grant A.R. Cornblath E. Goldman D. Analysis of DNA methylation reveals a partial reprogramming of the Muller glia genome during retina regeneration.Proc. Natl. Acad. Sci. U.S.A. 2013; 110: 19814-19819Crossref PubMed Scopus (88) Google Scholar, 22.Li X. Lan Y. Xu J. Zhang W. Wen Z. SUMO1-activating enzyme subunit 1 is essential for the survival of hematopoietic stem/progenitor cells in zebrafish.Development. 2012; 139: 4321-4329Crossref PubMed Scopus (26) Google Scholar, 23.Nowak M. Hammerschmidt M. Ubc9 regulates mitosis and cell survival during zebrafish development.Mol. Biol. Cell. 2006; 17: 5324-5336Crossref PubMed Scopus (58) Google Scholar). The coding sequence of the pou6f2 MO is CATGAGAAGCATCTACTCAAAGGTC (5′ → 3′). All morpholinos were designed to inhibit protein translation (targeted to the 5′ end of transcript) and were 3′-conjugated to lissamine to facilitate their electroporation and subsequent visualization. Intraperitoneal BrdU injections were carried out with 20 µl of 20 mm BrdU 3 h before harvesting. Heat shock was carried out at 36.5 °C as has been described (24.Ramachandran R. Zhao X.F. Goldman D. Insm1a-mediated gene repression is essential for the formation and differentiation of Muller glia-derived progenitors in the injured retina.Nat. Cell Biol. 2012; 14: 1013-1023Crossref PubMed Scopus (78) Google Scholar). Unless indicated otherwise, in the analyses of uninjured fish, heat shock was carried out every 12 h for 1 h each over a 4-day period. For analyses of injured fish, heat shock was carried out at 9 h postinjury (hpi) (1-h heat shock), 24 hpi (1-h heat shock), 28 hpi (30-min heat shock), and 33 hpi (1-h heat shock) to mimic the injury-dependent induction of endogenous apobec2a,2b, and fish were harvested at 48 hpi. Analyses were performed using size- and age-matched fish. Transgenic fish analyzed in this study were heterozygous to wild type. Site-directed mutagenesis was carried out using overlap extension PCR and the primers listed in supplemental Table 1. Cloning was carried out using Phusion DNA Polymerase (New England Biolabs) and the primers listed in supplemental Table 1. Each clone was sequenced by the University of Michigan DNA Sequencing Core. For this study, clones were used in the following applications: mRNA preparation (pCS2 flag-zapobec2a-V2a-GFP and pCS2+MT myc-zapobec2b-V2a-GFP), creation of transgenic fish (pTal hsp70:zapobec2wt, pTal hsp70:zapobec2mut, and pTal hsp70:hAPOBEC2), mutagenesis assays (pHis, pHis− rApobec1 (removing the His tag), pHis− rApobec1(W90S), pHis− hAID, pHis− hAPOBEC2, pHis− hAPOBEC2(T), pHis− hAPOBEC2(S125W), pHis− zApobec2a, pHis− zApobec2a(T), pHis− zApobec2a(S153W), pHis− zApobec2b, pHis− zApobec2b(T), and pHis− zApobec2b(S177W)), yeast two-hybrid assays (pLexAADE2Noti(pLexA) hAPOBEC2, pLexA hAPOBEC2(T), pLexA hAPOBEC2(C128A), pLexA zApobec2a, pLexA zApobec2a(T), pLexA zApobec2a(C156A), pLexA zApobec2b, pLexA zApobec2b(T), pLexA zApobec2b(C180A), pVP16 zApobec2a, pVP16 Pou6f2DBD, pVP16 Pou6f2M1, pVP16 Pou6f2M2, pVP16 Pou6F1DBD, and pVP16 Pou3F1DBD), bacterial sumoylation assays (pT E1E2S1 (25.Uchimura Y. Nakamura M. Sugasawa K. Nakao M. Saitoh H. Overproduction of eukaryotic SUMO-1- and SUMO-2-conjugated proteins in Escherichia coli.Anal. Biochem. 2004; 331: 204-206Crossref PubMed Scopus (88) Google Scholar), pT E1E2(C93A)S1, pETDuet flag-Toporsa, pGST hAPOBEC2, pGST hAPOBEC2(T), pGST zApobec2a, pGST zApobec2a(T), pGST zApobec2b, pGST zApobec2b(T), pETDuet GST-Pou6f2DBD, pHis- hAPOBEC2, pHis- zApobec2a, and pHis- zApobec2b), tissue culture analyses (pEGFP, pCS2 hSUMO1-gfp, pCS2 hAPOBEC2-gfp, pCS2 hSUMO1-hAPOBEC2-gfp, pCS2 hAPOBEC2(T)-gfp, pCS2 hAPOBEC2(K4R)-gfp, pCS2 zApobec2a-gfp, pCS2 hSUMO1-zApobec2a-gfp, pCS2 zApobec2a(T)-gfp, pCS2 zApobec2b-gfp, pCS2 hSUMO1-zApobec2b-gfp, pCS2 zApobec2b(T)-gfp), pCS2 mCherry-Ubc9, and pCS2 mCherry-Pou6f2), EMSAs (pGST Pou6f2DBD, pGST hAPOBEC2, pGST hAPOBEC2(C128A), pGST zApobec2a, pGST zApobec2a(C156A), pGST zApobec2b, and pGST zApobec2b(C180A)), and MO validation (pCS2 ube2iMObs:gfp and pCS2 pou6f2MObs:gfp). pCDNA V5 hAPOBEC2 (provided by Dr. Hongjun Song, Johns Hopkins University), pTrc99a hAID (provided by Dr. Michael Neuberger, Medical Research Council Laboratory of Molecular Biology), pTrc99a rApobec1 (provided by Dr. Michael Neuberger, Medical Research Council Laboratory of Molecular Biology), pCRIITopo zApobec2a (provided by Dr. David Jones, University of Utah), and pCRIITopo zApobec2b (provided by Dr. David Jones, University of Utah) served as templates for cloning. hSUMO1 was cloned using cDNA prepared from HEK293 cells. The pLexA and pVP16 plasmids were provided by Dr. Anne Vojtek (University of Michigan), and pT-E1E2S1 was provided by Dr. Jeremy Henley (University of Bristol). FACS sorting of GFP+ cells from uninjured gfap:gfp (isolation of MG) and 4-day post injury (dpi) 1016 tuba1a:gfp transgenic fish (isolation of MGPCs) was carried out as described previously (16.Powell C. Grant A.R. Cornblath E. Goldman D. Analysis of DNA methylation reveals a partial reprogramming of the Muller glia genome during retina regeneration.Proc. Natl. Acad. Sci. U.S.A. 2013; 110: 19814-19819Crossref PubMed Scopus (88) Google Scholar). Briefly, zebrafish retinas were collected in 0.8 ml of Leibovitz's L15 medium, treated for 15 min with 1 mg/ml hyaluronidase (Sigma) at room temperature, and then dissociated in 0.01% (v/v) trypsin with frequent trituration. A single-cell suspension was confirmed by microscopy, and cells were washed in Leibovitz's L15 medium before sorting. Cell sorting was performed by the University of Michigan Flow Cytometry Core on a BC Biosciences FACSAria three-laser high speed cell sorter. Total RNA was isolated using TRIzol (Invitrogen) and was DNase-treated (Invitrogen). cDNA synthesis was performed using random hexamers and either SuperScript-II (Invitrogen) or M-mulv (New England Biolabs) reverse transcriptase. PCRs used Taq and gene-specific primers (supplemental Table 1). Real-time PCRs were carried out with ABsolute SYBR Green Fluorescein Master Mix (Thermo Scientific) on an iCycler real-time PCR detection system (Bio-Rad). The ΔΔCt method was used to determine relative expression of mRNAs. Student's t tests were performed to determine statistical differences between samples. pCS2 flag-zapobec2a-V2a-GFP and pCS3+MT myc-zapobec2b-V2a-GFP plasmids were linearized with NotI (New England Biolabs), and capped mRNAs were synthesized using the mMESSAGE mMACHINE (Ambion). Single cell zebrafish embryos were injected with ∼200 pl of solution containing 0.125 mm MO or 0.125 mm MO with 2 ng/µl mRNA. Validation of MO functionality was carried out in embryos as has been done previously (7.Powell C. Elsaeidi F. Goldman D. Injury-dependent Müller glia and ganglion cell reprogramming during tissue regeneration requires Apobec2a and Apobec2b.J. Neurosci. 2012; 32: 1096-1109Crossref PubMed Scopus (56) Google Scholar). Briefly, purified constructs (pCS2 ube2iMObs:gfp and pCS2 pou6f2MObs:gfp) were microinjected into single cell embryos at a concentration of 2 ng/µl in conjunction with 0.125 mm lissamine-tagged experimental morpholino or control morpholino. Microinjections were analyzed for GFP expression 2 days postfertilization (Fig. 11, A and B). Bacterial mutagenesis assays were carried out as described (9.Harris R.S. Petersen-Mahrt S.K. Neuberger M.S. RNA editing enzyme APOBEC1 and some of its homologs can act as DNA mutators.Mol. Cell. 2002; 10: 1247-1253Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar, 26.Petersen-Mahrt S.K. Harris R.S. Neuberger M.S. AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification.Nature. 2002; 418: 99-103Crossref PubMed Scopus (740) Google Scholar). Briefly, BL21(DE3) cultures harboring the indicated plasmid were grown at 37 °C in 2 ml of LB containing 100 µg/ml ampicillin to an A600 of 0.5. 1 ml of LB containing 100 µg/ml ampicillin, 3 mm isopropyl-β-d-thiogalactopyranoside was then added, and the culture was grown overnight with shaking at either 37 or 25 °C (27.Dancyger A.M. King J.J. Quinlan M.J. Fifield H. Tucker S. Saunders H.L. Berru M. Magor B.G. Martin A. Larijani M. Differences in the enzymatic efficiency of human and bony fish AID are mediated by a single residue in the C terminus modulating single-stranded DNA binding.FASEB J. 2012; 26: 1517-1525Crossref PubMed Scopus (22) Google Scholar, 28.Barreto V.M. Pan-Hammarstrom Q. Zhao Y. Hammarstrom L. Misulovin Z. Nussenzweig M.C. AID from bony fish catalyzes class switch recombination.J. Exp. Med. 2005; 202: 733-738Crossref PubMed Scopus (92) Google Scholar). The next day, 1 ml of the culture was harvested, spun down, and spread onto a plate containing LB and 100 µg/ml rifampicin. Samples were allowed to grow overnight at 37 °C, and the next day, the number of growing colonies was quantified. To identify mutations that were occurring in the rpoB gene, colony PCR was carried out on rifampicin+ colonies using the rpoB primers (supplemental Table 1). PCR products were sequenced by the University of Michigan DNA Sequencing Core. Variants were identified by comparison with the wild type rpoB sequence as has been done by others (9.Harris R.S. Petersen-Mahrt S.K. Neuberger M.S. RNA editing enzyme APOBEC1 and some of its homologs can act as DNA mutators.Mol. Cell. 2002; 10: 1247-1253Abstract Full Text Full Text PDF PubMed Scopus (455)" @default.
• W2022668149 created "2016-06-24" @default.
• W2022668149 creator A5042450973 @default.
• W2022668149 creator A5063235592 @default.
• W2022668149 creator A5075448829 @default.
• W2022668149 date "2014-10-01" @default.
• W2022668149 modified "2023-10-17" @default.
• W2022668149 title "Zinc-binding Domain-dependent, Deaminase-independent Actions of Apolipoprotein B mRNA-editing Enzyme, Catalytic Polypeptide 2 (Apobec2), Mediate Its Effect on Zebrafish Retina Regeneration" @default.
• W2022668149 cites W1969462104 @default.
• W2022668149 cites W1976517931 @default.
• W2022668149 cites W1976917042 @default.
• W2022668149 cites W1978624231 @default.
• W2022668149 cites W1979509436 @default.
• W2022668149 cites W1980851632 @default.
• W2022668149 cites W1981762066 @default.
• W2022668149 cites W1986299807 @default.
• W2022668149 cites W1997528841 @default.
• W2022668149 cites W1999207703 @default.
• W2022668149 cites W2003788507 @default.
• W2022668149 cites W2021643095 @default.
• W2022668149 cites W2029194185 @default.
• W2022668149 cites W2032864030 @default.
• W2022668149 cites W2032882684 @default.
• W2022668149 cites W2034940803 @default.
• W2022668149 cites W2055612364 @default.
• W2022668149 cites W2056776605 @default.
• W2022668149 cites W2058061737 @default.
• W2022668149 cites W2059560084 @default.
• W2022668149 cites W2061478016 @default.
• W2022668149 cites W2063190524 @default.
• W2022668149 cites W2068858732 @default.
• W2022668149 cites W2090538188 @default.
• W2022668149 cites W2093315874 @default.
• W2022668149 cites W2101689648 @default.
• W2022668149 cites W2108537480 @default.
• W2022668149 cites W2111350536 @default.
• W2022668149 cites W2122883276 @default.
• W2022668149 cites W2123424931 @default.
• W2022668149 cites W2124937806 @default.
• W2022668149 cites W2128473387 @default.
• W2022668149 cites W2136638809 @default.
• W2022668149 cites W2141884494 @default.
• W2022668149 cites W2144015228 @default.
• W2022668149 cites W2149771940 @default.
• W2022668149 cites W2150010396 @default.
• W2022668149 cites W2152167619 @default.
• W2022668149 cites W2156022148 @default.
• W2022668149 cites W2161852106 @default.
• W2022668149 cites W2167536088 @default.
• W2022668149 cites W4245657039 @default.
• W2022668149 doi "https://doi.org/10.1074/jbc.m114.603043" @default.
• W2022668149 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4358241" @default.
• W2022668149 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/25750264" @default.
• W2022668149 hasPublicationYear "2014" @default.
• W2022668149 type Work @default.
• W2022668149 sameAs 2022668149 @default.
• W2022668149 citedByCount "19" @default.
• W2022668149 countsByYear W20226681492015 @default.
• W2022668149 countsByYear W20226681492016 @default.
• W2022668149 countsByYear W20226681492017 @default.
• W2022668149 countsByYear W20226681492018 @default.
• W2022668149 countsByYear W20226681492020 @default.
• W2022668149 countsByYear W20226681492021 @default.
• W2022668149 countsByYear W20226681492022 @default.
• W2022668149 countsByYear W20226681492023 @default.
• W2022668149 crossrefType "journal-article" @default.
• W2022668149 hasAuthorship W2022668149A5042450973 @default.
• W2022668149 hasAuthorship W2022668149A5063235592 @default.
• W2022668149 hasAuthorship W2022668149A5075448829 @default.
• W2022668149 hasBestOaLocation W20226681491 @default.
• W2022668149 hasConcept C104317684 @default.
• W2022668149 hasConcept C105580179 @default.
• W2022668149 hasConcept C169760540 @default.
• W2022668149 hasConcept C171056886 @default.
• W2022668149 hasConcept C181199279 @default.
• W2022668149 hasConcept C185592680 @default.
• W2022668149 hasConcept C2776878037 @default.
• W2022668149 hasConcept C2777093970 @default.
• W2022668149 hasConcept C55493867 @default.
• W2022668149 hasConcept C86803240 @default.
• W2022668149 hasConcept C95444343 @default.
• W2022668149 hasConceptScore W2022668149C104317684 @default.
• W2022668149 hasConceptScore W2022668149C105580179 @default.
• W2022668149 hasConceptScore W2022668149C169760540 @default.
• W2022668149 hasConceptScore W2022668149C171056886 @default.
• W2022668149 hasConceptScore W2022668149C181199279 @default.
• W2022668149 hasConceptScore W2022668149C185592680 @default.
• W2022668149 hasConceptScore W2022668149C2776878037 @default.
• W2022668149 hasConceptScore W2022668149C2777093970 @default.
• W2022668149 hasConceptScore W2022668149C55493867 @default.
• W2022668149 hasConceptScore W2022668149C86803240 @default.
• W2022668149 hasConceptScore W2022668149C95444343 @default.
• W2022668149 hasFunder F4320332161 @default.
• W2022668149 hasIssue "42" @default.
• W2022668149 hasLocation W20226681491 @default.
• W2022668149 hasLocation W20226681492 @default.
• W2022668149 hasLocation W20226681493 @default.
• W2022668149 hasLocation W20226681494 @default.

• next